Application of tomato SlAOS gene as positive regulatory factor in regulating tomato to respond to high VPD

Abstract

The invention relates to the technical field of plant molecular breeding, and particularly discloses application of a tomato SlAOS gene as a positive regulatory factor in regulating tomato response to high VPD. Through construction of an overexpression and gene editing strain of the SlAOS gene, it is verified that the gene can enhance the responsiveness of a plant to high VPD by regulating jasmonic acid (JA) synthesis, and it is shown that stomata closing is accelerated, the leaf water retention rate is increased, and the transpiration effect is reduced. Furthermore, a molecular selection marker taking SlAOS as a core is constructed and is used for screening a high-VPD-resistant tomato material. The invention provides a new molecular target and application strategy for genetic improvement of tomato stress resistance characters under facility agriculture conditions, and has good popularization and application prospects.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of plant molecular breeding, and particularly relates to application of a tomato SlAOS gene as a positive regulatory factor in regulating response of tomatoes to high VPD, including a functional mechanism of the gene in improving tolerance of tomatoes to high VPD stress, a construction method of transgenic plants, and a screening method of stress-tolerant tomato materials, and is suitable for stress-tolerant breeding and functional gene development of tomatoes in a facility agricultural environment. BACKGROUND

[0002] In modern facility agriculture, dramatic fluctuations of environmental factors have a significant impact on crop growth, especially changes in air humidity, which has become one of the important abiotic stress factors limiting high and stable yield. Vapor pressure deficit (VPD) as a measure of air humidity reflects the degree of air water deficit and is an important driving factor of plant transpiration. When VPD increases, the relative water content in the air decreases, leading to rapid evaporation of water from plant leaves, inducing water deficit, physiological imbalance, and yield reduction.

[0003] In facility-cultivated crops such as tomatoes (Solanum lycopersicum), high VPD environments can easily cause abnormal stomatal closure, reduced photosynthetic efficiency, poor fruit coloring, and other phenomena, and further affect fruit development, quality formation, and final yield. In order to reduce the harm caused by VPD stress to crops, traditional measures mainly rely on environmental control systems (such as mist cooling, shading, wet curtain fans, etc.), but such means are costly, have a lagging response, and have limited control effect, making it difficult to fundamentally improve the tolerance of plants to VPD stress.

[0004] In the process of plant adaptation to drought or high VPD environment, the regulation mechanism of stomatal movement plays a core role. Stomata, as the main channel for water loss and CO2 exchange in plant leaves, their opening and closing state directly affects the transpiration and photosynthesis of plants. Previous studies have shown that jasmonic acid (JA) and its derivatives in plants play an important role in regulating stomatal closure and inducing stress resistance. Allene oxide synthase (AOS) gene, as a key enzyme in the JA synthesis pathway, its expression changes can significantly affect the JA level, and further affect the stomatal response and stress resistance of plants.

[0005] Although previous studies have reported the role of JA signaling in drought, salinity and other stress, there is no clear study to systematically reveal the regulatory mechanism of tomato SlAOS gene in response to high VPD stress and its breeding application value. Especially in the background of facility agriculture, the lack of molecular mechanism analysis, genetic improvement materials and screening methods based on SlAOS and other regulatory factors limits the transformation efficiency and popularization and application of key genes in practical stress resistance breeding.

[0006] Therefore, it is urgent to explore and verify the functional role of SlAOS gene in response to high VPD, to clarify its regulation mechanism of stomatal movement and water retention capacity, and to apply it to the creation and molecular assisted screening of VPD tolerant tomato materials, and to provide new theoretical basis and technical means for tomato germplasm improvement in facility environment. SUMMARY

[0007] In order to solve the problems of imbalance of stomatal regulation and decline of water retention capacity of tomato under high water vapor pressure deficit (VPD) environment due to accelerated water loss, the present application constructs SlAOS gene overexpression and gene editing type transgenic tomato plants through functional verification and molecular biology methods, and clarifies its key role as a positive regulatory factor in response to high VPD. On this basis, the present application further provides various application embodiments based on SlAOS gene, the specific content is as follows:

[0008] In an embodiment of the present application, the application of tomato SlAOS gene in regulating tomato response to high water vapor pressure deficit (VPD) stress is provided, the nucleotide sequence of the SlAOS gene is shown as SEQ ID NO: 1, and the amino acid sequence encoded by the SlAOS gene is shown as SEQ ID NO: 2; the SlAOS gene as a positive regulatory factor improves the plant jasmonic acid (JA) synthesis ability by overexpression, thereby enhancing the water regulation ability and stomatal responsiveness of the plant under high VPD conditions, which is manifested as: improving the leaf water retention rate, enhancing the stomatal closure reaction, and reducing water loss.

[0009] Preferably, the tomato is Solanum lycopersicum variety Ailsa Craig.

[0010] In another embodiment of the present application, the SlAOS gene is applied to cultivate high VPD tolerant transgenic tomato plants, including: constructing SlAOS gene overexpression or editing type recombinant vector, and transforming it into tomato to obtain target transgenic plants; wherein the overexpression strain shows JA level increase, water retention rate improvement, stomatal dynamic change enhancement and other phenotypic characteristics significantly different from wild type under high VPD stress.

[0011] Further, the recombinant vector is a SlAOS expression vector constructed based on pSAK277 or CP098 as an initial vector.

[0012] Alternatively, the transgenic operation is implemented by using Agrobacterium GV3101 to mediate the genetic transformation of tomato explants.

[0013] Preferably, the tomato material is Solanum lycopersicum variety Ailsa Craig.

[0014] In an embodiment of the present application, a method for improving the response ability of tomato to high VPD stress is provided, comprising the following steps: cloning the SlAOS gene shown in SEQ ID NO: 1, constructing an overexpression vector thereof; obtaining a SlAOS high expression strain through transformation; and evaluating the water retention rate, JA content and stomatal opening under the condition of VPD≥2.50 kPa to verify the tolerance of the strain to VPD.

[0015] Further, the JA content is determined by chemical extraction combined with high performance liquid chromatography (HPLC) or enzyme-linked immunosorbent assay (ELISA); and the stomatal opening is evaluated by observing and measuring the change of stomatal aperture under a microscope.

[0016] In an embodiment of the present application, a molecular marker for screening tomato materials resistant to high VPD is provided, the molecular marker is based on the specific primers designed according to the sequence of SlAOS gene (SEQ ID NO: 1) for detecting the expression level or mutation site of the gene; and the correlation analysis is performed between the molecular marker and the plant phenotype indexes including the water retention rate, JA content and stomatal behavior by using qRT-PCR, Sanger sequencing or high resolution melting curve (HRM) technology.

[0017] Preferably, the primers are the forward primer and the reverse primer shown in SEQ ID NO: 3 and SEQ ID NO: 4.

[0018] Based on the above technical solution, the application “Application of tomato SlAOS gene as a positive regulatory factor in regulating the response of tomato to high VPD” firstly determines the key role of the gene in regulating the stomatal response of plants, improving the water retention capacity and enhancing the adaptability to high VPD by deeply mining and applying the function of SlAOS gene, and constructs a complete technical chain from gene regulation to physiological mechanism to phenotype response.

[0019] Under high vapor pressure deficit (high VPD) environment, water loss in plants is intensified, and stomatal behavior is disordered, leading to photosynthesis inhibition, slow growth and even death. Traditional regulation methods rely on environmental control and irrigation management, which are costly and slow to respond, and are difficult to fundamentally solve the problem of plant adaptation to severe environmental changes.

[0020] The present application constructs SlAOS gene overexpression and editing type tomato plants, and finds that the gene can significantly regulate endogenous JA synthesis in plants, and further affect the response intensity of stomata to external VPD changes. The experimental results show that the tomato plants overexpressing SlAOS gene can quickly close the stomata and effectively reduce water loss under high VPD stress, and show higher leaf water retention rate and physiological stability; and the SlAOS gene editing lines show slow response and decreased water retention capacity, further verifying the positive regulation effect of SlAOS gene.

[0021] In addition, the present application also establishes a molecular marker system with SlAOS expression level as the core, which can detect the expression of SlAOS or mutation site by qRT-PCR or sequencing means, and associate it with stomatal opening, JA accumulation, water retention performance and other phenotype indexes, for rapid screening of excellent tomato germplasm with high VPD tolerance, and significantly improving the breeding efficiency of stress resistance.

[0022] The technical path provided by the present application has the following advantages:

[0023] Clear mechanism: focusing on the JA synthesis pathway and stomatal regulation behavior, the target is clear;

[0024] High breeding efficiency: a molecular marker assisted screening system is constructed to shorten the breeding period;

[0025] Strong environmental adaptation: significantly improving the survival ability of plants in facility cultivation, drought or strong evaporation environment;

[0026] Strong practicality: can be widely used in tomato variety improvement, facility agricultural production, molecular breeding and other fields.

[0027] In summary, the present application focuses on the function of SlAOS gene, and constructs a whole process technical system from gene editing and expression regulation to stress tolerant plant creation and efficient screening method, which provides a feasible genetic improvement strategy for solving the problem of high VPD stress in facility agriculture, and has broad industrial application prospect and important scientific research value. BRIEF DESCRIPTION OF DRAWINGS

[0028] Figure 1 Column chart of expression amount change of SlAOS gene in wild type tomato plants before and after high VPD treatment;

[0029] Figure 2 Figure for comparison of SlAOS gene expression in wild type, SlAOS gene overexpression and edited lines before and after high VPD treatment;

[0030] Figure 3 Figure for comparison of leaf water retention rate in wild type, SlAOS gene overexpression and edited lines after high VPD treatment for different time;

[0031] Figure 4 Figure for stomatal morphology microscopic images in wild type, SlAOS gene overexpression and edited lines before and after high VPD treatment;

[0032] Figure 5 Figure for comparison of stomatal aperture in wild type, SlAOS gene overexpression and edited lines before and after high VPD treatment;

[0033] Figure 6 Figure for comparison of leaf jasmonic acid (JA) content in wild type, SlAOS gene overexpression and edited lines before and after high VPD treatment (unit: μg / g FW (1 μg / g = 1000 ng / g FW)). DETAILED DESCRIPTION

[0034] To make the technical solutions of the present application clearer and more complete, the present application will be further described below in combination with the drawings and specific examples. However, it should be understood that these examples are only used to illustrate the technical solutions of the present application and do not constitute a limitation on the protection scope of the present application. Those skilled in the art can make various modifications and replacements to the embodiments of the present application without departing from the spirit and essence of the present application, and these should all fall within the protection scope of the present application.

[0035] Example 1: Verification of expression change of SlAOS gene in high VPD response

[0036] To verify the expression response characteristics of tomato SlAOS gene under high water vapor pressure deficit (VPD) conditions, this example constructed control treatment and high VPD stress treatment experiments, and used quantitative real-time fluorescence PCR (qRT-PCR) method to dynamically detect the expression amount of SlAOS gene in wild type tomato plants.

[0037] I. Experimental materials

[0038] The experimental material was Solanum lycopersicum cultivar "Ailsa Craig" provided by the resource library of Henan Agricultural University. After sowing, the experimental plants were cultured in a phytotron, and seedlings with consistent growth and 3 unfolded true leaves were selected for experimental treatment.

[0039] II. Growth environment control

[0040] The plant culture environment was set as follows:

[0041] Day / night temperature: 28℃ / 20℃;

[0042] Light cycle: 14h light / 10h dark;

[0043] Light intensity: 30000lx;

[0044] Air CO2 concentration: regular atmospheric concentration;

[0045] Normal VPD environment setting: VPD=1.32kPa during the day and VPD=0.47kPa at night;

[0046] High VPD treatment environment: VPD was raised to 2.50kPa (relative humidity was reduced) during the day.

[0047] The temperature and humidity parameters were adjusted by the environmental control system to achieve stable VPD regulation.

[0048] III. Sample collection and RNA extraction

[0049] The selected tomato seedlings were placed under normal VPD and high VPD conditions, respectively, and leaf samples (the 3rd true leaf) were taken at 0min and 15min of treatment, which were immediately frozen in liquid nitrogen and stored at -80℃.

[0050] Total RNA was extracted using a commercially available plant total RNA extraction kit (such as SM139-02, Savyon Innovation), and the RNA purity and concentration were detected by 1% agarose electrophoresis and Nanodrop 2000 spectrophotometer, ensuring that A260 / A280 was between 1.8-2.1.

[0051] IV. cDNA synthesis and qRT-PCR detection

[0052] The first strand cDNA was synthesized using a reverse transcription kit (such as SRQ-01, Savyon Innovation), and the following system configuration and program were used:

[0053] Reaction system: total RNA 1μL, reverse transcription buffer 14μL, dsDNase 1μL, nuclease inhibitor 4μL;

[0054] Reaction conditions: 50℃ for 8min, 85℃ for 5sec, and termination of reaction.

[0055] The obtained cDNA was used as a template, and qRT-PCR reaction was performed using QuantStudio 5Flex fluorescent quantitative PCR system, as follows:

[0056] Primer sequences (see sequence listing):

[0057] SlAOS gene:

[0058] Forward: SEQ ID NO: 3 (GGGTCGGAAACTGAAAACGC)

[0059] Reverse: SEQ ID NO: 4 (GAGGAACAGTTCGACCAGCA)

[0060] ACTIN internal reference gene:

[0061] Forward: SEQ ID NO: 5

[0062] Reverse: SEQ ID NO: 6

[0063] Reaction system (10 μL): cDNA 0.5 μL, SYBR Green Mix 5 μL, forward primer 0.5 μL, reverse primer 0.5 μL, ddH2O 3.5 μL;

[0064] PCR cycle program:

[0065] 95℃ 30 s (pre-denaturation);

[0066] 95℃ 15 s, 60℃ 25 s, cycle 40 times;

[0067] Melting curve: 95℃ 10 s, 65℃ 60 s, 40℃ 1 s.

[0068] Three biological replicates were set for each sample, and the relative expression was calculated by ΔΔCt method.

[0069] V. Experimental results and analysis

[0070] As shown in Table 1, the relative expression of SlAOS gene was significantly higher after 15 minutes of high VPD treatment than that at 0 minute (untreated), about 42 times higher. Statistical analysis showed that the difference was highly significant (P < 0.001). Figure 1 This result shows that SlAOS gene can quickly respond to VPD changes, and its up-regulated expression trend supports its function as a positive regulatory factor under high VPD stress, participates in JA synthesis pathway and regulates plant stomatal behavior, providing basis for subsequent construction of overexpression lines and molecular function verification.

[0071] Example 2: Cloning of SlAOS gene and construction of expression vector

[0072] I. Target gene information and sequence source

[0073]

[0074] ​The SlAOS gene provided by the application is a gene encoding allene oxide synthase (AOS) in Solanum lycopersicum, the gene number is Solyc04g079730, the nucleotide sequence is shown as SEQ ID NO: 1, and the encoded protein amino acid sequence is shown as SEQ ID NO: 2.

[0075] The target cDNA sequence is obtained from the Sol Genomics Network (SGN) database, and no mismatch and intron is confirmed.

[0076] II. Total RNA extraction and cDNA synthesis

[0077] Tomato variety Ailsa Craig young leaves are used as materials, RNAkey Reagent is combined with nucleic acid separating agent (BCP) to extract total RNA, and the following reference operation steps are used:

[0078] 1. 100 mg of fresh leaves are added to each tube, and 1 mL of RNAkey lysis is added;

[0079] 2. After lysis at room temperature for 5 min, 0.1 mL of BCP is added and shaken vigorously;

[0080] 3. 12000 g centrifugation at 4℃ for 10 min, and the supernatant is transferred to a new tube;

[0081] 4. 0.5 mL of isopropanol is added to precipitate RNA;

[0082] 5. Centrifugation again, washing with 75% ethanol, drying and dissolving RNA in RNA dissolving solution;

[0083] 6. After verification of the concentration and purity of RNA by NanoDrop and 1% agarose electrophoresis, the subsequent steps are entered.

[0084] A commercial reverse transcription kit (SciVinnova SRQ-01) is used to reverse transcribe 1 μg of RNA to generate first-strand cDNA, and the reaction system and procedure are as follows:

[0085] System (20 μL): RNA 1 μg, 5×RTMix 4 μL, dsDNase 1 μL, Nuclease-Free Water 14 μL;

[0086] Program: 50℃ reaction for 8 min, 85℃ reaction for 5 sec, and reaction termination.

[0087] III. SlAOS gene primer design and PCR amplification

[0088] According to the SlAOSCDS sequence, the following specific primers (without vector homologous arm) are designed:

[0089] Forward primer: 5'-ATGGCATCAACTTCTCTTTC-3'(SEQ ID NO: 7);

[0090] Reverse primer: 5'-TCAAAAACTGGCTCTTCTCA-3'(SEQ ID NO: 8);

[0091] In order to realize seamless cloning, fusion primers with vector homologous arms are also designed:

[0092] pSAK277 vector homologous arm (front / back): SEQ ID NO: 11 and SEQ ID NO: 12.

[0093] CP098 vector homologous arm (front / back): SEQ ID NO: 9 and SEQ ID NO: 10;

[0094] High-fidelity enzyme (P520 PhantaFlash DNA polymerase) is used for amplification, and the reaction system is as follows:

[0095] Total system 50 μL: cDNA template 2 μL, 2xMaster Mix 25 μL, forward / reverse primer 2 μL each, ddH2O 19 μL;

[0096] PCR program:

[0097] 98°C pre-denaturation for 30 sec;

[0098] 35 cycles:

[0099] 98°C for 10 sec;

[0100] 55°C for 5 sec;

[0101] 72°C for 10 sec;

[0102] 72°C extension for 1 min, and reaction termination.

[0103] The PCR product is verified by 1% agarose gel electrophoresis, and the length of the amplified band is about 1600 bp, which is consistent with the full length of SlAOS CDS.

[0104] Four, expression vector construction

[0105] 1. Vector preparation:

[0106] The two initial vectors pSAK277 and CP098 are treated with single enzyme EcoRI and BSaI, respectively;

[0107] The enzyme digestion system was performed according to the commercial standard, and the residual enzyme and fragments were removed by column purification.

[0108] 2. Connection and transformation:

[0109] The target PCR fragment was connected with the linearized vector using In-Fusion or T5 ligase;

[0110] The ligation product was transformed into competent E. coli DH5a, and after heat shock at 42°C, it was recovered and inoculated on LB plates containing antibiotics;

[0111] Resistance screening used kanamycin (Kana, 100 μg / mL).

[0112] 3. Positive clone screening and verification:

[0113] Single colonies were selected, and after plasmid extraction, the vector insert was verified by PCR using the following primers:

[0114] SlAOS-pSAK277 identification primer:

[0115] Forward: SEQ ID NO: 15 (CATCGAAAGGACAGTAGAAAAGG)

[0116] Reverse: SEQ ID NO: 16 (CATTAGAATGAACCGAAACCG)

[0117] SlAOS-CP098 identification primer:

[0118] Forward: SEQ ID NO: 13 (ATGGATTACAAGGACCACGAC)

[0119] Reverse: SEQ ID NO: 14 (GAGCCTAGCGGACAGGATAG)

[0120] After observing the target fragment by gel electrophoresis, the PCR product was sent to a biological company for sequencing. After confirming that the sequence was accurate and had no mutations, it was named:

[0121] Overexpression construct: SlAOS-pSAK277;

[0122] Editing construct: SlAOS-CP098.

[0123] 4. Bacterial liquid preservation: The positive clone bacterial liquid was added with glycerol to a final concentration of 25%, and stored at -80°C for long-term preservation.

[0124] The present embodiment successfully obtains the expression and editing constructs of SlAOS gene by full-length cDNA cloning, vector construction and verification, which lays a foundation for subsequent transformation, phenotype verification and function research.

[0125] Example 3: Construction and identification of transgenic plants

[0126] The present embodiment aims to introduce the constructed SlAOS expression or editing vector into tomato plants by Agrobacterium-mediated genetic transformation technology, and screen the stable expression of transgenic lines for subsequent function verification.

[0127] I. Agrobacterium transformation vector

[0128] The recombinant plasmid SlAOS-pSAK277 (overexpression) or SlAOS-CP098 (editing) with correct sequence is transformed into Agrobacterium strain GV3101, and the freeze-thaw method is used as follows:

[0129] 1. Take 50 μL of GV3101 competent cells, add 1 μL of constructed plasmid;

[0130] 2. Place on ice for 5 min, quickly freeze in liquid nitrogen for 5 min;

[0131] 3. 37°C water bath for 5 min, quickly put back on ice for 5 min;

[0132] 4. Add 500 μL of LB liquid medium without antibiotics, and incubate at 28°C for 3 h;

[0133] 5. Spread on LB solid plate containing kanamycin (100 μg / mL) + rifampicin (50 μg / mL);

[0134] 6. Incubate at 28°C for 48-72 h, and select white single colonies for transformation.

[0135] Use SlAOS specific primers (SEQ ID NO: 13-16) for PCR identification, and positive colonies for plant transformation.

[0136] II. Establishment of tomato genetic transformation system

[0137] 1. Preparation of explants:

[0138] Select Ailsa Craig tomato seeds, disinfect with 75% ethanol and sodium hypochlorite (2.5%), and sow in 1 / 2MS solid medium (containing 3% sugar, pH 5.8, 0.8% agar). Incubate under light for 5-7 days. Take the cotyledons of seedlings as explants, cut into about 0.5 cm 2 pieces for standby.

[0139] 2. Agrobacterium infection and co-culture:

[0140] The positive Agrobacterium liquid (OD600≈1.5) was centrifuged and collected, and then resuspended with 0.2MS liquid medium;

[0141] The explants were placed in the bacterial liquid for 2min of infection, the bacterial liquid was sucked dry, and then transferred to the pre-culture medium under dark conditions for 2 days of culture;

[0142] Example of pre-culture medium formula:

[0143] MS+1.0mg / L 6-BA+0.1mg / L IAA+100μM acetyl-syringone (AS);

[0144] An appropriate amount of agar (0.7%) and sucrose (3%) was added, and the pH was adjusted to 5.8;

[0145] Dark culture at 25°C.

[0146] 3. Callus induction:

[0147] The pre-cultured explants were transferred to the screening medium, and callus induction and screening were started:

[0148] Kanamycin (100μg / mL) and cephalosporin (250μg / mL) were added;

[0149] White callus was formed after 10-20 days of culture.

[0150] 4. Shoot regeneration and rooting culture:

[0151] The callus was transferred to the redifferentiation medium (with high concentration of 6-BA and low NAA) to promote the formation of adventitious shoots;

[0152] After the shoots grew to more than 1cm, they were cut and transferred to the rooting medium containing 0.1mg / L IBA;

[0153] During the culture, 16h light and a temperature of 26°C were maintained, and after 2-3 weeks, rooted seedlings were obtained.

[0154] III. Screening of transgenic plants and verification of expression

[0155] 1. Positive identification:

[0156] Genomic DNA was extracted from the obtained T0 generation seedlings, and PCR identification of the exogenous fragment was performed using primer pairs (such as SEQ ID NO: 17 and 18);

[0157] After screening the positive lines, self-crossing was performed to the T1, T2, and T3 generations, and continuous generation screening and stability verification were performed.

[0158] 2. Expression amount detection:

[0159] The T3 generation of positive lines and wild type controls were selected, leaf RNA was extracted, and qRT-PCR expression analysis was performed;

[0160] SlAOS expression levels were detected using SlAOS specific primers (SEQ ID NO: 3 and SEQ ID NO: 4), and ACTIN was used as an internal reference;

[0161] The results are shown in Figure 2 Overexpression lines showed significantly up-regulated SlAOS expression, and edited lines showed significantly down-regulated expression, verifying that the constructed system was reliable.

[0162] In summary, this example successfully achieved the construction and sub-generation stable screening of SlAOS overexpression and edited transgenic tomato plants, and obtained basic materials for subsequent functional verification and application research. The construction system is stable and the method is mature, and can be widely used in the functional research of other stress response related genes.

[0163] Example 4: Water retention capacity and stomatal responsiveness determination

[0164] This example aims to compare the leaf water retention capacity and stomatal response characteristics of wild type tomato (WT), SlAOS overexpression lines (SlAOS-OE) and SlAOS gene edited lines (SlAOS-CR) under high VPD treatment conditions, and further verify the role of SlAOS gene in stomatal movement and water retention regulation.

[0165] I. Experimental materials and treatment conditions

[0166] T3 generation SlAOS transgenic tomato plants identified by screening were used in the experiment, including:

[0167] Wild type (WT)

[0168] SlAOS overexpression lines (SlAOS-OE)

[0169] SlAOS gene edited lines (SlAOS-CR)

[0170] The plants were grown in a suitable VPD environment control system until the third true leaf fully expanded, then transferred to a high VPD environment for treatment, with the following environmental settings:

[0171] Suitable VPD environment: day 1.32 kPa / night 0.47 kPa

[0172] High VPD environment: VPD≥2.50 kPa

[0173] II. Leaf water retention rate determination method

[0174] 1. Sampling method:

[0175] At the beginning of treatment (0 min), the 3rd leaf was selected and the fresh weight (FW0) was measured;

[0176] 2. Weighing and calculation:

[0177] After that, the fresh weight (FW t ) of each time point (15, 30, 60, 90 min) was measured and recorded;

[0178] The water retention rate calculation formula is as follows:

[0179]

[0180] Wherein:

[0181] FW t : Fresh weight of leaf at t time point;

[0182] FW0: Initial fresh weight (0 min).

[0183] 3. Statistical processing:

[0184] Each treatment group was set with biological repeats of 3 times;

[0185] Single factor variance analysis (ANOVA) and LSD method were used to compare the differences between groups;

[0186] Significant difference results correspond to the "*", "**" or "***" mark in the figure.

[0187] The results are shown in Figure 3 .

[0188] 4. Interpretation of results:

[0189] WT showed a significant decrease in water retention rate after 60 min of treatment;

[0190] SlAOS-OE strain decreased the slowest, showing strong water retention capacity.

[0191] SlAOS-CR strain decreased faster and had the lowest water retention rate;

[0192] III. Stoma morphology and aperture determination

[0193] To further evaluate the ability of SlAOS gene to regulate stoma movement, the imprinting method was used to observe the stoma state of each strain leaf.

[0194] 1. Microscopic image acquisition Figure 4 (as shown in the figure):

[0195] Each group of samples was taken at 0 min (before treatment) and 15 min (after treatment) using the imprinting method to obtain the lower epidermis sample of the leaf;

[0196] Randomly take 5 fields under optical microscope (400x) and take pictures;

[0197] Save the pictures for later image analysis.

[0198] 2. Stomata aperture measurement method:

[0199] Measure the aperture of each stomata using image processing software (ImageJ);

[0200] Measure no less than 60 stomata for each sample.

[0201] 3. Stomata response tendency: Figure 5 ):

[0202] The average aperture of WT stomata decreased by about 46% after high VPD treatment;

[0203] The SlAOS-OE line closed the stomata most quickly, with an average aperture decrease of about 70%.

[0204] The SlAOS-CR line showed almost no significant change in aperture, with a sluggish response;

[0205] 4. Data analysis method:

[0206] Each group of measurement data is represented by mean ± standard deviation;

[0207] Single factor analysis of variance (ANOVA) and LSD method were used to compare the differences between groups;

[0208] Significant difference results correspond to the "*", "**" or "***" annotations in the figure.

[0209] Combining the results of leaf water retention rate and stomata behavior determination:

[0210] Overexpression of SlAOS gene can significantly enhance the water retention capacity of tomato under high VPD stress;

[0211] By accelerating the stomata closure response and reducing water transpiration, it is one of the core mechanisms of its function;

[0212] Gene editing lines due to down-regulation of SlAOS expression, JA synthesis is blocked, leading to stomata disorder and decreased water retention capacity.

[0213] The above experiments fully support the technical effects of the three action paths in the claims: "promote JA synthesis, enhance stomata closure, and improve water retention rate".

[0214] Example 5: SlAOS gene enhances high VPD tolerance by regulating JA accumulation

[0215] This example aims to detect the change trend of jasmonic acid (JA) content in leaves of wild type (WT), SlAOS overexpression line (SlAOS-OE) and SlAOS gene editing line (SlAOS-CR) before and after high VPD treatment, to verify the regulatory role of SlAOS gene in JA synthesis pathway from the molecular metabolic level.

[0216] I. Experimental materials and treatment conditions

[0217] The T3 generation positive plants obtained by screening were used, including:

[0218] Wild type (WT)

[0219] SlAOS overexpression line (SlAOS-OE)

[0220] SlAOS editing line (SlAOS-CR)

[0221] The plants were grown in a phytotron until the 3rd true leaf fully expanded, and then subjected to high VPD treatment in the phytotron, with the following settings:

[0222] Treatment condition: daytime temperature 28℃, relative humidity reduced to 45%, VPD≈2.50kPa;

[0223] Control condition: daytime VPD≈1.32kPa;

[0224] Sampling time: before treatment (0min) and after treatment (15min);

[0225] Sampling site: the 3rd true leaf, immediately frozen with liquid nitrogen, and stored at -80℃ for standby.

[0226] II. JA extraction and detection method

[0227] 1. Sample pretreatment:

[0228] Weigh 300mg of frozen leaves for each group of samples; grind them into slurry with a grinder, and extract overnight at 4℃. Centrifuge at 8000g for 10min, take the supernatant, and extract the residue with 0.5mL of 80% methanol solution for 2 hours. After centrifugation, take out the supernatant, combine the two supernatants, and evaporate to remove organic phase under nitrogen. Extract and decolorize with 1mL of petroleum ether for three times, adjust the pH to 2-3 with an appropriate amount of 2mol / L hydrochloric acid solution, extract with 1mL of ethyl acetate twice, transfer the upper organic phase to a new EP tube, and evaporate to dryness under nitrogen.

[0229] 2. Derivation of jasmonic acid

[0230] Add 200 uL of ether: methanol (9:1, v / v), add 20 uL of 2 mmol / L trimethylsilane diazomethane in n-hexane, mix well and stand at room temperature for 30 min at 25°C. Add 20 uL of 2 mol / L glacial acetic acid in n-hexane, mix well and stand at room temperature for 30 min at 25°C. Dry in an ice water bath under nitrogen. Add 0.2 mL of mobile phase for dissolution, take an appropriate amount of solution and filter with a needle filter into a sample bottle with an inner liner for testing.

[0231] 3. Instrument detection conditions (using HPLC):

[0232] Chromatographic column: C18 reversed-phase column (250 mm x 4.6 mm, 5 μm);

[0233] Mobile phase: 0.1% phosphoric acid aqueous solution: acetonitrile = 52:48 (V / V);

[0234] Flow rate: 1.0 mL / min, injection volume: 10 μL. 4. Standard curve preparation:

[0235] Prepare concentration gradients (0.04, 0.1, 0.2, 0.4, 1.0, 2.0, 4.0, 10.0 μg / mL) of methyl jasmonate standard;

[0236] Draw the standard curve and calculate the linear regression formula for quantitative analysis of JA content in each sample.

[0237] III. Results analysis and data presentation

[0238]

[0239] As Figure 6 shown, the results are as follows:

[0240] Statistical analysis (n = 3):

[0241] The JA content of SlAOS-OE strain was significantly higher than that of WT after high VPD treatment (P < 0.01);

[0242] The JA content of SlAOS-CR strain did not change significantly, and was significantly lower than that of WT and SlAOS-OE strain;

[0243] It is shown that SlAOS gene as a positive regulator of JA synthesis, rapidly activates downstream metabolism in response to high VPD stimulation.

[0244] IV. Conclusion

[0245] Through dynamic detection and comparison of JA content, it is found that:

[0246] 1. Overexpression of SlAOS gene can significantly increase the accumulation of JA under high VPD induction;

[0247] 2. The process is highly consistent with stomata closure and water retention improvement;

[0248] 3. SlAOS gene editing leads to JA synthesis obstruction, affecting the sensitivity and response ability of plants to high VPD;

[0249] 4. From the metabolic pathway, it is proved that SlAOS is an important connecting point of high VPD signal -> JA pathway -> stomatal regulation -> water retention capacity improvement.

[0250] The above experiments provide clear biochemical support for the role of SlAOS gene in JA regulation and stress response, and provide a key biomarker index (JA accumulation level) for molecular breeding screening.

[0251] Example 6: Molecular marker assisted screening method based on SlAOS gene

[0252] Based on the research results of the expression characteristics of SlAOS gene and its regulation function in high VPD response, a set of molecular marker screening strategy applicable in tomato stress resistance breeding is established, which can be used for early identification of plant materials with potential high VPD tolerance.

[0253] I. Classification of marker types

[0254] In the present application, two types of molecular markers are constructed for SlAOS gene:

[0255] 1. Expression marker (based on qRT-PCR)

[0256] Suitable for screening transgenic lines or natural variation materials with significantly increased SlAOS expression;

[0257] 2. Allelic mutation marker (based on sequencing or HRM)

[0258] Suitable for analyzing SNP / InDel variation of SlAOS gene in different materials, and constructing genetic linkage sites associated with phenotypes.

[0259] II. qRT-PCR expression marker screening process

[0260] 1. RNA extraction and cDNA synthesis

[0261] Extract total RNA from tomato leaves of different strains or hybrid offspring materials;

[0262] Use commercial kit to reverse transcribe into cDNA, and standardize the concentration before entering real-time quantitative PCR.

[0263] 2. Primer information

[0264] SlAOS expression was detected using specific primer pairs shown in SEQ ID NO: 3 and SEQ ID NO: 4, and ACTIN gene was used as internal reference (primer sequences are shown in SEQ ID NO: 5 and 6).

[0265] 3. Detection conditions and determination criteria

[0266] QuantStudio 5 real-time fluorescent PCR instrument was used.

[0267] ΔΔCt method was used to calculate the relative expression amount.

[0268] If the expression amount of SlAOS is more than 1.5 times that of the control (wild type), it is determined to be a candidate for expression enhancement.

[0269] III. Mutation marker design and detection

[0270] 1. Sequence region selection

[0271] According to the full-length sequence of SlAOS CDS (SEQ ID NO: 1), a SNP dense segment was selected to design a universal sequencing primer pair.

[0272] It can be used for:

[0273] Sanger sequencing method: suitable for small amount of sample and clear single base mutation;

[0274] High-resolution melting curve (HRM) method: suitable for large-scale material preliminary screening.

[0275] 2. Sample amplification and sequencing

[0276] After PCR product purification, bidirectional sequencing was performed.

[0277] Different materials were aligned using software (such as SnapGene, DNAMAN);

[0278] Find specific sites that are co-distributed with high JA accumulation and high water retention rate phenotypes;

[0279] 3. Establish marker-trait association model

[0280] Combine the phenotype data (JA content, water retention rate, stomatal opening) from Examples 4 and 5;

[0281] Use statistical regression or linkage analysis method to establish the correlation between expression type / mutation type and stress tolerance phenotype.

[0282] IV. Explanation of practical breeding value

[0283] This marker system can be widely used in:

[0284] Early screening of tomato F2 or recombinant inbred line (RIL) population;

[0285] Identification of excellent high VPD tolerance materials in natural germplasm resources;

[0286] Combination of marker assisted selection (MAS) and stomata traits or JA signal indicators to quickly aggregate stress resistance gene sites;

[0287] Evaluation of whether the target expression of genetically transformed plants reaches the physiological response threshold standard.

[0288] Compared with the traditional phenotype selection method, the SlAOS gene molecular marker system established in the application has the advantages of high accuracy, short cycle, low cost, strong applicability and the like.

[0289] V. Conclusion

[0290] Based on the core regulatory position of SlAOS in high VPD response, the embodiment provides a complete set of marker assisted screening strategies from molecular detection to phenotype correlation. The system can not only be used for SlAOS related function research, but also provides a methodological template for subsequent multiple stomatal regulation related gene stress resistance breeding.

[0291] In summary, through systematic construction and function verification, the application first determines the positive regulation of tomato SlAOS gene in response to high water vapor pressure deficit (VPD), establishes a genetic transformation method, a functional expression vector, a stress tolerance trait evaluation system and a molecular marker assisted screening strategy based on the gene. The application not only provides a reliable molecular basis for tomato stress tolerance breeding in a facility environment, but also provides a new research idea and technical path for environmental adaptability improvement of other crops.

[0292] It should be noted that, although the present application is described in detail through specific embodiments, those skilled in the art should understand that, without departing from the basic concept of the present application, various equivalent substitutions or functional extensions can be made to the details, parameters, reagents, vectors, strains, treatment conditions and the like of the embodiments, and these modifications and improvements should all belong to the protection scope of the present application.

[0293] Therefore, the protection scope of the present application should be subject to the appended claims. The embodiments in the specification and drawings are only used to illustrate the technical solutions of the present application, and do not constitute a limitation on the protection scope of the present application.

Claims

1. The application of the tomato SlAOS gene as a positive regulator in regulating the tomato response to high VPD, characterized in that: The nucleotide sequence of the SlAOS gene is shown in SEQ ID NO:1, and the amino acid sequence it encodes is shown in SEQ ID NO:

2. The SlAOS gene acts as a positive regulator; overexpression of this gene can enhance the plant's jasmonic acid (JA) synthesis capacity, thereby strengthening the plant's water regulation capacity and stomatal response under high VPD conditions, as shown in the following ways: 1) Improve the water retention rate of the leaves; 2) Enhances the stomatal closure reaction; 3) Reduce moisture loss.

2. The application according to claim 1, characterized in that: The tomato in question is of the Solanum lycopersicum variety, Ailsa Craig.

3. The application of an SlAOS gene in the cultivation of transgenic tomato plants with high VPD tolerance, characterized in that: The target plants were obtained by constructing an overexpression or editing recombinant vector of the SlAOS gene and transforming it into tomatoes. The transgenic lines exhibited phenotypes significantly different from the wild type under high VPD stress, including changes in JA level, water retention rate, and stomatal dynamics.

4. The application according to claim 3, characterized in that: The recombinant vector is an SlAOS expression vector constructed using pSAK277 or CP098 as the initial vector.

5. The application according to claim 3 or 4, characterized in that: The transgenic operation was carried out using the Agrobacterium GV3101-mediated method.

6. The application according to any one of claims 3 to 5, characterized in that: The tomato in question is the Solanumlycopersicum variety, Ailsa Craig.

7. A method for improving the response of tomatoes to high VPD stress, characterized in that, Includes the following steps: Cloned the SlAOS gene shown in SEQ ID NO:1 and constructed its overexpression vector; The vector was introduced into tomato tissue to obtain a high SlAOS expression line; Its water retention rate, JA content and stomatal aperture were evaluated under VPD≥2.50kPa conditions to determine its response to VPD.

8. The method according to claim 7, characterized in that: The JA content was determined by chemical extraction combined with high performance liquid chromatography (HPLC) or enzyme-linked immunosorbent assay (ELISA); the stomatal aperture was evaluated by microscopic observation and measurement of stomatal diameter.

9. A molecular marker for screening high VPD-tolerant tomato materials, characterized in that: Specific primers were designed based on the SlAOS gene sequence (SEQ ID NO:1) to detect the expression level or mutation site of SlAOS. The correlation between the data and phenotypic data such as water retention, JA content, and stomatal reactivity was analyzed using qRT-PCR, Sanger sequencing, or high-resolution melting curve (HRM) methods.

10. The molecular marker according to claim 9, characterized in that: The primers are the forward and reverse primers shown in SEQ ID NO:3 and SEQ ID NO:4.

Images