Application of slwrky51 gene in improving disease resistance of tomato plants

By constructing an overexpression vector for the SlWRKY51 gene and transforming it with Agrobacterium-mediated transformation, transgenic positive lines were obtained, which solved the problem of insufficient tomato disease resistance gene resources, enhanced the resistance of tomato plants to gray mold, regulated multiple defense signaling pathways, and improved the expression of defense genes.

CN121065247BActive Publication Date: 2026-04-14合肥海关技术中心
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
合肥海关技术中心
Filing Date
2025-09-23
Publication Date
2026-04-14

AI Technical Summary

Technical Problem

There is a lack of disease resistance gene resources in tomato plants. Traditional chemical control methods are prone to causing drug resistance in pathogens and pose a risk of environmental pollution. Current technologies have not clarified the function of the SlWRKY51 gene in regulating tomato disease resistance.

Method used

By constructing an overexpression vector for the SlWRKY51 gene, transgenic positive lines were obtained through Agrobacterium-mediated transformation, thereby enhancing the disease resistance of tomato plants. The specific steps included designing specific primers to clone the SlWRKY51 gene, digesting and ligating the vector with enzymes, infecting tomato tissues with Agrobacterium, and verifying gene expression.

Benefits of technology

It significantly enhanced the resistance of tomato plants to gray mold, regulated multiple defense signaling pathways, increased the expression of defense-related genes, and provided important molecular breeding resources for disease resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121065247B_ABST
    Figure CN121065247B_ABST
Patent Text Reader

Abstract

The application discloses SlWRKY51 The application belongs to the technical field of bioengineering, and relates to application of a gene in improving disease resistance of a tomato plant. SlWRKY51 The application is achieved by constructing a gene overexpression vector, transforming a transgenic positive strain through mediation of agrobacterium, and performing a grey mold infection experiment. SlWRKY51 Compared with a wild type, the transgenic positive strain shows significantly enhanced disease resistance after being infected by the grey mold. Further real-time fluorescent quantitative PCR detection data show that the expression amount of PR family and defense-related genes in the transgenic positive strain is significantly up-regulated, and it is confirmed that the gene can enhance the disease resistance of the tomato by regulating multiple defense signal pathways, and important gene resources are provided for tomato disease resistance molecular breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of bioengineering technology, and in particular to... SlWRKY51 Application of genes in improving the disease resistance of tomato plants. Background Technology

[0002] tomato( Solanum lycopersicum Tomatoes (L.) belong to the genus *Solanum* of the Solanaceae family and are an important global vegetable crop. However, their cultivation has long been threatened by fungal diseases such as gray mold. These diseases not only reduce tomato yields by 20-50% in the field but also continue to cause damage during post-harvest storage and transportation, further negatively impacting yield and quality, resulting in significant economic losses. Currently, traditional chemical control methods not only easily lead to drug resistance in pathogens but also pose environmental pollution risks. Therefore, enriching the endogenous disease-resistant gene resources of tomatoes and cultivating new disease-resistant varieties are urgent needs for sustainable agriculture.

[0003] The WRKY transcription factor family in plants is a key factor regulating plant growth, development, and responses to environmental changes. Its typical characteristic is a highly conserved N-terminal WRKY domain, including a conserved WRKYGQK domain and zinc finger structures (CX4-5CX22-23HX1H or CX7CX23HXC). Related studies have shown that *Ilex spp.* (…) Ammopiptanthus mongolicus In ) AmWRKY51 Genes respond to drought and salt stress by regulating the expression of related stress-resistance genes; roses ( Rosa rugosa In ) RrWRKY51 Genes enhance rose resistance to black spot disease by increasing the content of osmotic regulatory substances and the activity of antioxidant enzymes; cucumbers ( Cucumis sativus L.) CsWRKY51 Genes enhance the cold resistance of chilled cucumbers by regulating SA content and the interaction of genes related to SA synthesis; the JAV1-JAZ8-WRKY51 (JJW) complex synthesized in plants resists insect infestation by regulating jasmonic acid biosynthesis.

[0004] However, SlWRKY51 The specific functional mechanism of the (Solyc04g051690) gene in regulating tomato disease resistance is not yet clear. This invention constructs... SlWRKY51 Gene overexpression lines were confirmed to participate in regulating the expression of tomato disease resistance genes, providing new gene resources for tomato disease resistance breeding. Summary of the Invention

[0005] Therefore, the object of the present invention is to provide SlWRKY51 The application of genes in improving the disease resistance of tomato plants aims to address the problem of insufficient tomato resistance gene resources.

[0006] To achieve the above objectives, the present invention provides the following technical solution:

[0007] This invention provides SlWRKY51 The application of genes in improving the disease resistance of tomato plants, the aforementioned SlWRKY51 The nucleotide sequence of the gene is shown in SEQ ID No. 1.

[0008] Preferably, the method of application is: to make tomatoes SlWRKY51 The gene is overexpressed in tomato plants, enhancing the disease resistance of tomatoes.

[0009] Preferably, the method of application includes the following steps:

[0010] (1) According to SlWRKY51 Gene amplification primers were designed, including RT-PCR-F and RT-PCR-R. The nucleotide sequence of RT-PCR-F is shown in SEQ ID No. 2, and the nucleotide sequence of RT-PCR-R is shown in SEQ ID No. 3. Specifically:

[0011] RT-PCR-F (SEQ ID No. 2):

[0012] 5´-tactattctagtcgagaattcATGGAAAATTTTCCCTATAGCTCATC-3´;

[0013] RT-PCR-R (SEQ ID No. 3):

[0014] 5´-accatcccgggtaccgagctcAAGGTGAAGATTGTGAAGGGCA-3´.

[0015] (2) Extract total RNA from tomatoes, reverse transcribe it into cDNA, and use the cDNA as a template to perform RT-PCR amplification using the above-mentioned amplification primers to obtain RT-PCR products. The specific RT-PCR reaction system and amplification procedure are as follows:

[0016] The 50 μL RT-PCR reaction system contains: 10 μL SF buffer, 1 μL each of RT-PCR-F and RT-PCR-, 1 μL dNTP, 1 μL SF DNA Polymerase, 2 μL cDNA, and 32 μL ddH2O;

[0017] Amplification program: 95℃, 3 min; 95℃, 10 s; 55℃, 30 s; 72℃, 45 s; 35 cycles; 72℃, 7 min; 4℃, ∞.

[0018] Take 2 μL of RT-PCR product and perform agarose gel electrophoresis to confirm. SlWRKY51To determine if the size of the target fragment meets expectations, purify the target fragment using a DNA product purification kit and determine its concentration, ensuring it is ≥5 ng / μL.

[0019] (3) Use EcoRI and SacI respectively to process the data obtained in step (2). SlWRKY51 The target fragment and vector are digested with enzymes, specifically:

[0020] Enzyme digestion SlWRKY51 Target fragments and vectors

[0021] Use EcoRI and SacI to analyze the results obtained in step (2). SlWRKY51 The target fragment and the vector were digested with enzymes to obtain... SlWRKY51 The target fragment digestion products and vector digestion products, along with the specific digestion system and reaction procedure, are as follows:

[0022] The 50 μL enzyme digestion system contains: 5 μL of 10×cutsmart buffer, 20 ng of vector, 2 μL of EcoRI, 2 μL of SacI, and ddH2O to make up to 50 μL;

[0023] Reaction procedure: 37℃, 30 min.

[0024] Purified using a DNA product purification kit SlWRKY51 The target fragment digestion product and the vector digestion product.

[0025] Connecting carrier

[0026] Will SlWRKY51 The target fragment digestion product and the vector digestion product were ligated to obtain the recombinant. The specific ligation system and reaction procedure are as follows:

[0027] The 10 μL ligation system consisted of: 1 μL CE ligase, 2 μL 5×CE buffer, and 4.5 μL of BGFP digested vector product. SlWRKY51 1.5 μL of the target fragment product and 1 μL of ddH2O;

[0028] Reaction procedure: 37℃, 30 min.

[0029] Take 2 μL of the purified double-enzyme digested vector and perform agarose gel electrophoresis to verify its purification effect and determine its concentration to ensure ≥5 ng / μL.

[0030] E. coli transformation

[0031] Take 1 μL of recombinant cells and add them to a centrifuge tube containing 100 μL of Escherichia coli DH5α competent cells. Incubate on ice for 25 min, heat shock at 42℃ for 45 s, and incubate on ice again for 2 min. Add 700 μL of antibiotic-free LB liquid medium to the centrifuge tube and incubate at 37℃ and 200 rpm for 60 min to obtain a bacterial suspension. Centrifuge the bacterial suspension obtained above at 5000 rpm for 1 min, and resuspend the bacterial cells in 100 μL of the supernatant. Spread the resuspended bacterial suspension evenly on LB solid medium containing spectinomycin hydrochloride (sp+) and incubate upside down at 37℃ for 16 h to obtain single colonies.

[0032] Colony PCR identification

[0033] Pick a single colony and mix it with 10µL of sterile water by pipetting to obtain the test bacterial solution; take 2µL of the test bacterial solution for PCR amplification to obtain the bacterial PCR product, and screen for positive recombinants. The specific PCR reaction system and amplification procedure are as follows:

[0034] The 25 μL PCR reaction system contains: 12.5 μL of 2×Rapid Taq Master Mix, 1 μL each of RT-PCR-F and RT-PCR-R, 2 μL of bacterial culture, and 8.5 μL of ddH2O;

[0035] Amplification program: 95℃, 3 min; 95℃, 15 s; 55℃, 1 min; 72℃, 45 s; 35 cycles; 72℃, 5 min; 4℃, ∞.

[0036] The PCR products from the bacterial culture were verified by agarose gel electrophoresis. Bacterial cultures with band sizes matching the expected values ​​were inoculated into 3 mL of LB liquid medium (containing SP+) and cultured at 37℃ and 200 rpm for 16 h with shaking. Plasmids were extracted from the cultured bacterial cultures using a plasmid extraction kit and verified by agarose gel electrophoresis. Plasmids matching the expected size were sent to a biotechnology company for further sequencing identification, and the results confirmed the correct plasmids were obtained. SlWRKY51 Gene overexpression vector.

[0037] Preferably, the vector is pBG-GFP.

[0038] Preferably, the SlWRKY51 Gene overexpression vectors are used to prepare transgenic positive lines, thereby improving the disease resistance of tomato plants. The specific steps for preparing transgenic positive lines are as follows:

[0039] (1) Preparation of the product containing the above SlWRKY51 Agrobacterium MS suspension containing gene overexpression vector was used to infect tomato tissue. Specifically:

[0040] Agrobacterium transformation

[0041] Take 100 μL of Agrobacterium EHA105 competent cells into a 1.5 mL centrifuge tube and thaw them in an ice bath; add 1 μL of [unclear text - possibly a specific ingredient or solution] to the centrifuge tube. SlWRKY51 Gene overexpression vector, gently tap the bottom of the centrifuge tube to mix, and perform the following steps: ice bath for 5 min, liquid nitrogen for 5 min, 37℃ water bath for 5 min, ice bath for 5 min; add all liquid from the centrifuge tube to 700 μL of antibiotic-free LB liquid medium, and incubate at 28℃ with shaking for 2-3 h; centrifuge at 6000 rpm for 1 min, and resuspend the bacterial cells in 100 μL of supernatant to obtain a resuspended bacterial suspension. Spread this suspension evenly on LB solid medium containing SP+ and rifampicin (Rif), and incubate upside down at 28℃ for 2-3 days to obtain a bacterial suspension containing SP+. SlWRKY51 Single colony of gene overexpression vector.

[0042] Preparation of Agrobacterium MS suspension

[0043] Picking SlWRKY51 Single colonies of the gene overexpression vector were inoculated into 3 mL of LB liquid medium (containing sp+ and Rif) and cultured at 28 °C with shaking at 200 rpm for 12–16 h to obtain primary cultures containing sp+ and Rif. SlWRKY51 Agrobacterium MS suspension overexpressing the vector was then transferred (500 µL) to 30 mL of LB liquid medium (containing sp+ and Rif) and cultured at 28 °C and 200 rpm for 12–16 h with shaking to obtain secondary culture containing the vector. SlWRKY51 Agrobacterium MS suspension overexpressing the vector; the OD600 of the suspension was measured to be 0.6-0.8 using a spectrophotometer; the bacterial cells were collected by centrifugation at 5000 rpm for 5 min, resuspended in sterile water, and diluted to OD600 = 0.1-0.15. The solution was prepared fresh for use to obtain the product containing... SlWRKY51 Agrobacterium MS suspension containing gene overexpression vector.

[0044] Tomato tissue infection and transformation

[0045] After pre-culturing tomato tissue in the dark for 2 days, it was immersed in a solution containing... SlWRKY51 In Agrobacterium MS suspension containing gene overexpression vector, the mixture was shaken for 5 min for infection.

[0046] (2) The tomato tissues infected in step (1) were cultured to obtain transgenic positive lines, specifically:

[0047] Acquisition of transgenic lines

[0048] Tomato tissue was removed with sterile tweezers, briefly drained, and placed on sterile filter paper to absorb excess bacterial solution. The infected tomato tissue was then passed through culture media containing different plant hormones to complete the processes of bud induction, bud elongation, and rooting. The rooted transgenic lines were then transferred to nutrient soil and cultured in a greenhouse to obtain transgenic lines.

[0049] Identification of transgenic positive lines

[0050] Using GFP tag detection, 0.1–0.2 g of leaves from the obtained transgenic lines were taken, ground in liquid nitrogen, and total plant DNA was extracted using a plant genomic DNA extraction kit. GFP-specific primer pairs GFP-F (SEQ ID No. 4) and GFP-R (SEQ ID No. 5) were designed, and the target DNA was amplified using specific PCR primers. Specific experimental parameters are as follows:

[0051] GFP-F: 5´-CACAAGTTCAGCGTGTCCG (SEQ ID No. 4)-3´;

[0052] GFP-R: 5´-GTTCACCTTGATGCCGTTC (SEQ ID No. 5)-3´;

[0053] The 50 μL PCR reaction system contains: 10 μL SF buffer, 1 μL each of GFP-F and GFP-R, 1 μL dNTP, 1 μL SF DNA Polymerase, 2 μL DNA, and 32 μL ddH2O;

[0054] Amplification program: 95℃, 3 min; 95℃, 10 s; 56℃, 30 s; 72℃, 45 s; 35 cycles; 72℃, 7 min; 4℃, ∞.

[0055] Transgenic positive lines were screened using agarose gel electrophoresis results.

[0056] Subsequently, 0.1–0.2 g of leaves from transgenic positive lines containing the GFP tag were collected, ground in liquid nitrogen, and total RNA was extracted using a plant genomic RNA extraction kit. The RNA was then reverse transcribed into cDNA and stored at -20°C. Specific qRT-PCR primers were then used to target… SlWRKY51 The gene was analyzed using real-time quantitative PCR (qRT-PCR), and the specific experimental parameters are as follows:

[0057] qRT-PCR-F1: 5´-AGAGTTGGAGGTGTTGGATG (SEQ ID No. 6)-3´;

[0058] qRT-PCR-R2: 5´-ATCTTTATTGTCCCTTTCTACTCTTTTC (SEQ ID No. 7)-3´;

[0059] The 10 μL qRT-PCR reaction system contains: 5 μL 2×SYBR Green mix, 0.2 μL each of qRT-PCR-F1 and qRT-PCR-R2, 0.8 μL cDNA, and 3.8 μL RNase-free water;

[0060] Amplification program: 95℃, 15s; 94℃, 15s; 60℃, 15s; 72℃, 20s; 45 cycles.

[0061] Confirm its SlWRKY51 Whether the gene is overexpressed.

[0062] Preferably, in step (1), the Agrobacterium MS suspension is used to infect the cotyledons and stem segments of tomatoes.

[0063] Preferably, the transgenic positive line plants exhibit significantly higher resistance to gray mold than wild-type plants at the same stage, specifically manifested in the following ways: infected leaves show milder disease symptoms, and the accumulation of hydrogen peroxide and the area of ​​dead cells shown by staining are significantly reduced compared to the wild-type at the same stage; this is verified through the following gray mold infection experiment:

[0064] Preparation of Botrytis cinerea

[0065] Activate the *Botrytis cinerea* strain on PDA medium and incubate at 25°C in the dark for 10 days. Scrape off *Botrytis cinerea* spores, prepare a spore suspension with sterile water, filter through double-layered sterile gauze, and count the spores using a hemocytometer to dilute the sterile water to 10⁻⁶. 6 per mL.

[0066] Botrytis cinerea in tomatoes

[0067] Select multiple healthy WT plants that are about 6 weeks old. SlWRKY51 For gene-overexpressing plants, select healthy leaves from the same growth position and inject 30µL of bacterial infection solution from the underside of the leaf using a 1mL needleless syringe.

[0068] Disease observation

[0069] Infected leaves were removed and placed in petri dishes with moistened sterile filter paper at the bottom. The dishes were then treated in the dark for 5 days. On the 3rd and 5th days, the disease status of the leaves was observed and the phenotype and staining were recorded.

[0070] Preferably, the staining includes DAB staining and trypan blue staining, specifically:

[0071] DAB staining

[0072] Staining solution preparation: Weigh 0.05g DAB and dissolve it in 45mL distilled water. Adjust the pH to 3.0 with hydrochloric acid, add 25µL Tween 20 and 2.5mL 200mM Na2HPO4 and mix well.

[0073] Staining method: Place the leaves in a glass petri dish containing the staining solution, incubate at room temperature for 1 hour with a shaker at 50 rpm, rinse the leaves with distilled water to remove residual staining solution, and then transfer them to anhydrous ethanol for decolorization at room temperature with a shaker at 50 rpm for 12 hours, changing the decolorization solution continuously during this period.

[0074] Trypan blue staining

[0075] Preparation of staining solution: Measure 10 mL of 85% lactic acid, 10 mL of saturated phenol, 10 mL of glycerol, and 10 mL of distilled water, and weigh 40 mg of trypan blue and mix well.

[0076] Staining method: Immerse the leaves in the staining solution, add 0.01% Silwet L-77, and apply a vacuum of 0.8 kgf / cm². 2 After soaking the leaves for 1 minute, stain them at room temperature in the dark on a shaker at 80 rpm for 12 hours. After staining, decolorize them directly with anhydrous ethanol on a shaker at 80 rpm for 3 hours at room temperature.

[0077] For leaves that are difficult to decolorize, they need to be treated with heated anhydrous ethanol.

[0078] Preferably, samples are further taken from the infected leaves and qRT-PCR is performed to detect the expression level of the disease resistance gene. Specifically:

[0079] Fresh plant samples were rapidly ground in liquid nitrogen, and total RNA was extracted using a plant RNA extraction kit. The RNA was then reverse transcribed into cDNA and stored at -20°C. Using the cDNA template, specific qRT-PCR primers were used to quantify the target disease resistance gene. Specific experimental parameters are as follows:

[0080] qRT-PCR-F3: 5´-TCTCACGCATTGACCACAAG (SEQ ID No. 8)-3´;

[0081] qRT-PCR-R4: 5´-CAACCTCCTCATAATCCTTCCG (SEQ ID No. 9)-3´;

[0082] The 10 μL qRT-PCR reaction system contains: 5 μL 2×SYBR Green mix, 0.2 μL each of qRT-PCR-F3 and qRT-PCR-R4, 0.8 μL cDNA, and 3.8 μL RNase-free water;

[0083] Amplification program: 95℃, 15s; 94℃, 15s; 60℃, 15s; 72℃, 20s; 45 cycles.

[0084] Tomato Tubulin The expression level of the gene (Solyc08g006890) was used as an internal control, according to 2 -△△Ct The method was used to calculate the relative expression level of the disease resistance gene.

[0085] Preferably, the disease-resistant gene contains PR1 , PR1a , PR1b , PR5 , PR7 , NPR1 , DCD1 , DCD2 , LCD1 and LCD2 .

[0086] Compared with the prior art, the present invention has the following beneficial effects:

[0087] This invention SlWRKY51 The application of genes in improving the disease resistance of tomato plants, through the design of specific primer cloning. SlWRKY51 Gene coding sequences were constructed by ligation via EcoRI and SacI restriction enzymes. SlWRKY51 Gene overexpression vectors were used, followed by Agrobacterium-mediated transformation to obtain transgenic positive lines. Disease resistance analysis showed that, compared to the wild type, the transgenic positive lines exhibited significantly enhanced resistance to Botrytis cinerea infection. Further real-time quantitative PCR detection revealed that the PR family (…)… PR1 , PR1a , PR1b , PR5 and PR7 ) and defense-related genes ( NPR1 , DCD1 , DCD2 , LCD1 and LCD2 The expression levels of all of them were significantly upregulated, confirming that SlWRKY51 Genes can enhance tomato disease resistance by regulating multiple defense signaling pathways, providing important genetic resources for molecular breeding of tomato disease resistance. Attached Figure Description

[0088] To more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are merely exemplary, and those skilled in the art can derive other embodiments based on the provided drawings without creative effort.

[0089] The structures, proportions, sizes, etc. illustrated in this specification are only for the purpose of assisting those skilled in the art in understanding and reading the content disclosed herein, and are not intended to limit the conditions under which the present invention can be implemented. Therefore, they have no substantial technical significance. Any modifications to the structure, changes in the proportions, or adjustments to the size, without affecting the effects and objectives that the present invention can produce, should still fall within the scope of the technical content disclosed in the present invention.

[0090] Figure 1 For the present invention SlWRKY51 Sequence alignment results of gene overexpression vector;

[0091] Figure 2 For the present invention SlWRKY51 Figure 1 shows the results of qRT-PCR (A) and GFP tag detection (B) in gene-overexpressing plants.

[0092] Figure 3 This is a comparison of DAB and trypan blue staining on days 0, 2, and 5 after gray mold infection (dark treatment for 5 days) of leaves from the transgenic positive line (T0 generation) and WT plants of this invention.

[0093] Figure 4 This is a graph showing the quantitative analysis results of disease resistance genes related to plant leaves in the transgenic positive lines (T0 generation) and WT plants of this invention. Detailed Implementation

[0094] The following specific embodiments illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. Obviously, the described embodiments are only some, not all, of the embodiments of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0095] Preparation Example 1

[0096] Preparation of Botrytis cinerea

[0097] Activate the *Botrytis cinerea* strain on PDA medium and incubate at 25°C in the dark for 10 days. Scrape off *Botrytis cinerea* spores, prepare a spore suspension with sterile water, filter through double-layered sterile gauze, and count the spores using a hemocytometer to dilute the sterile water to 10⁻⁶. 6 per mL.

[0098] Preparation Example 2

[0099] Preparation of staining solution

[0100] DAB staining solution: Weigh 0.05g DAB and dissolve it in 45mL distilled water. Adjust the pH to 3.0 with hydrochloric acid, add 25µL Tween 20 and 2.5mL 200mM Na2HPO4 and mix well.

[0101] Trypan blue staining solution: Measure 10 mL of 85% lactic acid, 10 mL of saturated phenol, 10 mL of glycerol, and 10 mL of distilled water, and weigh 40 mg of trypan blue and mix well.

[0102] Example 1

[0103] tomato SlWRKY51 Cloning of gene coding sequences

[0104] (1) RNA extraction and cDNA synthesis

[0105] Total RNA was extracted from tomato leaves using an RNA extraction kit. RNA quality was verified by agarose gel electrophoresis, and its concentration was determined using a spectrophotometer. The obtained total RNA was reverse transcribed into cDNA using a reverse transcription kit and stored at -20°C.

[0106] (2) SlWRKY51 RT-PCR amplification of gene coding sequences

[0107] The tomato cDNA obtained in step (1) was amplified using RT-PCR-F (SEQ ID No. 2) and RT-PCR-R (SEQ ID No. 3). SlWRKY51 The target fragment was sequenced and analyzed, and identified as tomato. SlWRKY51 Gene coding sequence.

[0108] The specific RT-PCR reaction system and amplification procedure are as follows:

[0109] The 50 μL RT-PCR reaction system contains: 10 μL SF buffer, 1 μL each of RT-PCR-F and RT-PCR-R, 1 μL dNTP, 1 μL SF DNA Polymerase, 2 μL cDNA, and 32 μL ddH2O;

[0110] Amplification program: 95℃, 3 min; 95℃, 10 s; 55℃, 30 s; 72℃, 45 s; 35 cycles; 72℃, 7 min; 4℃, ∞.

[0111] (3) SlWRKY51 Purification of target fragment

[0112] Agarose gel electrophoresis confirmed that the size met the expected specifications. SlWRKY51 The target fragment was purified using a DNA product purification kit, and its concentration was determined to be ≥5 ng / μL.

[0113] Example 2

[0114] SlWRKY51 Construction of overexpression vector and transformation of Agrobacterium

[0115] (1) SlWRKY51 Construction of overexpression vectors

[0116] connect

[0117] Using EcoRI and SacI to SlWRKY51 The target fragment and pBG-GFP vector were digested with enzymes to obtain... SlWRKY51 The target fragment digestion product and the vector digestion product, along with the specific double digestion system and reaction procedure, are as follows:

[0118] The 50 μL double digestion system contains: 5 μL of 10×cutsmart buffer, 20 ng of vector, 2 μL of EcoRI, 2 μL of Sac I, and ddH2O to make up to 50 μL;

[0119] Reaction procedure: 37℃, 30 min.

[0120] Purified using a DNA product purification kit SlWRKY51 The target fragment digestion product and the vector digestion product.

[0121] Will SlWRKY51 The target fragment digestion product and the vector digestion product were ligated to obtain the recombinant. The specific ligation system and reaction procedure are as follows:

[0122] The 10 μL ligation system consisted of: 1 μL CE ligase, 2 μL 5×CE buffer, and 4.5 μL of BGFP digested vector product. SlWRKY51 1.5 μL of the target fragment product and 1 μL of ddH2O;

[0123] Reaction procedure: 37℃, 30 min.

[0124] Take 2 μL of the purified double-enzyme digested vector and perform agarose gel electrophoresis to verify its purification effect and determine its concentration to ensure ≥5 ng / μL.

[0125] E. coli transformation

[0126] Take 1 μL of recombinant cells and add them to a centrifuge tube containing 100 μL of Escherichia coli DH5α competent cells. Incubate on ice for 25 min, heat shock at 42℃ for 45 s, and incubate on ice again for 2 min. Add 700 μL of antibiotic-free LB liquid medium to the centrifuge tube and incubate at 37℃ and 200 rpm for 60 min to obtain a bacterial suspension. Centrifuge the bacterial suspension obtained above at 5000 rpm for 1 min, and resuspend the bacterial cells in 100 μL of the supernatant. Spread the resuspended bacterial suspension evenly on LB solid medium containing spectinomycin hydrochloride (sp+) and incubate upside down at 37℃ for 16 h to obtain single colonies.

[0127] Colony PCR identification

[0128] Pick a single colony and mix it with 10µL of sterile water by pipetting to obtain the test bacterial solution; take 2µL of the test bacterial solution for PCR amplification to obtain the bacterial PCR product, and screen for positive recombinants. The specific PCR reaction system and amplification procedure are as follows:

[0129] The 25 μL PCR reaction system contains: 12.5 μL of 2×Rapid Taq Master Mix, 1 μL each of RT-PCR-F and RT-PCR-R, 2 μL of bacterial culture, and 8.5 μL of ddH2O;

[0130] Amplification program: 95℃, 3 min; 95℃, 15 s; 55℃, 1 min; 72℃, 45 s; 35 cycles; 72℃, 5 min; 4℃, ∞.

[0131] The PCR products from the bacterial culture were verified by agarose gel electrophoresis. Bacterial cultures with band sizes matching the expected values ​​were inoculated into 3 mL of LB liquid medium (containing SP+) and cultured at 37℃ and 200 rpm for 16 h with shaking. Plasmids were extracted from the cultured bacterial cultures using a plasmid extraction kit and verified by agarose gel electrophoresis. Plasmids matching the expected size were sent to a biotechnology company for further sequencing identification, and the results confirmed the correct plasmids were obtained. SlWRKY51 Gene overexpression vectors (see) Figure 1 ).

[0132] (2) Agrobacterium transformation

[0133] Take 100 μL of Agrobacterium EHA105 competent cells into a 1.5 mL centrifuge tube and thaw them in an ice bath; add 1 μL of [unclear text - possibly a specific ingredient or solution] to the centrifuge tube. SlWRKY51After overexpressing the vector, gently tap the bottom of the centrifuge tube to mix it thoroughly, and perform the following steps: ice bath for 5 min, liquid nitrogen for 5 min, 37℃ water bath for 5 min, ice bath for 5 min; add all the liquid in the centrifuge tube to 700 μL of antibiotic-free LB liquid medium, and incubate at 28℃ with shaking for 2-3 h; centrifuge at 6000 rpm for 1 min, and resuspend the bacterial cells in 100 μL of the supernatant to obtain the resuspended bacterial suspension. Spread the resuspended bacterial suspension evenly on LB solid medium (containing sp+ and Rif), and incubate upside down at 28℃ for 2-3 days to obtain the overexpression vector. SlWRKY51 Monoclonal colonies of overexpression vectors.

[0134] Example 3

[0135] Transgenic line (T0 generation) breeding

[0136] (1) Obtaining tomato cotyledons and stem segments

[0137] Take 8g of healthy tomato seeds and place them in a sterile Erlenmeyer flask. Perform the following sterilization procedures: rinse twice with sterile water, rinse once with 75% alcohol, rinse twice with sterile water, soak in 5% hypochlorous acid solution, rinse twice with sterile water, and then place them on sterile filter paper to air dry.

[0138] Sterilized seeds were inoculated into MS solid medium and treated in the dark for 2 days. After germination, the seeds were placed in a light-controlled tissue culture incubator for 4 days of growth. Culture conditions: 25℃, 16h / day light, 8h / day darkness.

[0139] Seven days after the tomato seeds have matured, use a sterile knife to remove the cotyledons and stem segments with axillary buds as explants.

[0140] (2) Preparation of Agrobacterium MS suspension

[0141] Pick the above-obtained ingredients containing SlWRKY51 Single colonies of the overexpression vector were inoculated into 3 mL of LB liquid medium (containing sp+ and Rif) and cultured at 28 °C with shaking at 200 rpm for 12–16 h to obtain primary cultures containing sp+ and Rif. SlWRKY51 The overexpression vector suspension was then transferred (500 µL) to 30 mL of LB liquid medium (containing sp+ and Rif) and cultured at 28 °C and 200 rpm for 12–16 h with shaking to obtain the secondary culture containing sp+ and Rif. SlWRKY51 The overexpression vector suspension was prepared; the OD600 of the suspension was measured to be 0.6-0.8 using a spectrophotometer; the bacterial cells were collected by centrifugation at 5000 rpm for 5 min, resuspended in sterile water, and diluted to OD600 = 0.1-0.15. The solution was prepared fresh for immediate use to obtain the product containing... SlWRKY51 Agrobacterium MS suspension containing gene overexpression vector.

[0142] (3) Infection and transformation of explants

[0143] Explants were treated in the dark for 2 days, then immersed in Agrobacterium MS suspension and agitated for 5 minutes. The explants were then removed with sterile forceps, briefly drained, and placed on sterile filter paper to remove excess suspension.

[0144] (4) Seedling culture of explants

[0145] Screening of resistant callus and bud induction

[0146] The dried explants were transferred to MS basal medium for shoot induction (containing 2 mg / L 6-BA, 0.1 mg / L IAA, 50 mg / L Kan and 400 mg / L Cef) for shoot induction; culture conditions: 25℃, 16h light / 8h dark culture.

[0147] Bud elongation culture

[0148] The differentiated buds were transferred to MS basal medium for bud elongation (1 mg / L GA3, 0.5 mg / L IAA, 30 mg / L Kan and 300 mg / L Cef) to promote bud elongation; culture conditions: 25℃, 16h light / 8h dark culture.

[0149] Rooting culture

[0150] Cut healthy shoots (≥1cm in length), dip the base into 1 / 2 MS basal medium for rooting (containing 0.5mg / L IBA and 20mg / L Kan), and insert them into a culture flask containing the same medium for rooting culture; culture conditions: 25℃, 16h light / 8h dark culture.

[0151] Fourteen days later, the formation of white root primordia at the base was observed. When the roots grew to 2 cm, they were transferred to nutrient soil and cultured in a greenhouse to obtain transgenic lines (T0 generation).

[0152] Example 4

[0153] SlWRKY51 Identification of Tomato Plants with Overexpressed Genes

[0154] (1) GFP tag identification of transgenic positive lines (T0 generation)

[0155] Fresh leaves (0.1 g each) from transgenic lines (T0 generation) and wild-type (WT, negative control) plants were ground in liquid nitrogen. Total plant DNA was extracted using a plant genomic DNA extraction kit. GFP-specific primer pairs GFP-F (SEQ ID No. 4) and GFP-R (SEQ ID No. 5) were designed, and the target DNA was amplified using specific PCR primers. Specific experimental parameters are as follows:

[0156] GFP-F: CACAAGTTCAGCGTGTCCG (SEQ ID No. 4);

[0157] GFP-R: GTTCACCTTGATGCCGTTC (SEQ ID No. 5);

[0158] The 50 μL PCR reaction system contains: 10 μL SF buffer, 1 μL each of GFP-F and GFP-R, 1 μL dNTP, 1 μL SF DNA Polymerase, 2 μL DNA, and 32 μL ddH2O;

[0159] Amplification program: 95℃, 3 min; 95℃, 10 s; 56℃, 30 s; 72℃, 45 s; 35 cycles; 72℃, 7 min; 4℃, ∞.

[0160] The presence of GFP tags in transgenic lines (T0 generation) was analyzed by agarose gel electrophoresis to screen for transgenic positive lines (T0 generation).

[0161] (2) SlWRKY51 Gene expression analysis

[0162] Fresh leaves (0.1 g each) from the selected transgenic positive lines (T0 generation) and WT (negative control) plants were collected. Total RNA was extracted using a plant genomic RNA extraction kit, and the RNA was reverse transcribed into cDNA and stored at -20℃. Specific qRT-PCR primers were used to target... SlWRKY51 The specific experimental parameters for quantitative gene analysis are as follows:

[0163] qRT-PCR-F1: AGAGTTGGAGGTGTTGGATG (SEQ ID No. 6);

[0164] qRT-PCR-R2: ATCTTTATTGTCCCTTTCTACTCTTTTC (SEQ ID No. 7);

[0165] The 10 μL qRT-PCR reaction system contains: 5 μL 2×SYBR Green mix, 0.2 μL each of qRT-PCR-F1 and qRT-PCR-R2, 0.8 μL cDNA, and 3.8 μL RNase-free water;

[0166] Amplification program: 95℃, 15s; 94℃, 15s; 60℃, 15s; 72℃, 20s; 45 cycles.

[0167] Confirm its SlWRKY51Whether the gene is overexpressed.

[0168] from Figure 2 It can be seen that, compared with WT, the transgenic positive lines (T0 generation) SlWRKY51 The gene expression level was 7 times higher than that of WT, indicating that this strain is... SlWRKY51 Tomato plants with overexpressed genes.

[0169] Test Example 1

[0170] Select multiple WT and transgenic positive lines (T0 generation) plants that have grown for 6 weeks and are in good condition. Select healthy leaves from the same growth position and inject 30µL of gray mold infection solution from the back of the leaves using a 1mL needleless syringe.

[0171] After infection, leaves were removed and placed in petri dishes with moistened sterile filter paper at the bottom. After 5 days of dark treatment, the disease progression and DAB and trypan blue staining were observed on days 0, 2, and 5. The specific staining methods are as follows:

[0172] DAB staining method: Place the leaves in a glass petri dish containing the staining solution, incubate at room temperature for 1 hour with a shaker at 50 rpm, rinse the leaves with distilled water to remove residual staining solution, and then transfer them to anhydrous ethanol for decolorization at room temperature with a shaker at 50 rpm for 12 hours, changing the decolorization solution continuously during this period.

[0173] Trypan blue staining: Immerse the leaves in the staining solution, add 0.01% Silwet L-77, and apply a vacuum of 0.8 kgf / cm². 2 After soaking the leaves for 1 minute, stain them at room temperature in the dark on a shaker at 80 rpm for 12 hours. After staining, decolorize them directly with anhydrous ethanol on a shaker at 80 rpm for 3 hours at room temperature.

[0174] For leaves that are difficult to decolorize, they need to be treated with heated anhydrous ethanol.

[0175] from Figure 3 It can be seen that, compared to WT, SlWRKY51 Transgenic positive lines with overexpressed genes (T0 generation) showed milder disease symptoms on infected leaves, and the hydrogen peroxide accumulation shown by DAB staining and the dead cell area shown by trypan blue staining were significantly lower than those in the WT generation, indicating that... SlWRKY51 Gene overexpression effectively enhanced the ability of tomatoes to resist botrytis cinerea infection.

[0176] Test Example 2

[0177] To more accurately reflect the differences between the two, qPCR quantitative analysis was performed on the disease resistance genes related to the leaves of WT and transgenic positive lines (T0 generation) stained with DAB and trypan blue.

[0178] Fresh plant samples were rapidly ground in liquid nitrogen, and total RNA was extracted using a plant RNA extraction kit. The RNA was then reverse transcribed into cDNA and stored at -20°C. Specific qRT-PCR primers were used to quantify the target disease resistance gene. The specific experimental parameters are as follows:

[0179] qRT-PCR-F3:TCTCACGCATTGACCACAAG (SEQ ID No. 8);

[0180] qRT-PCR-R4: CAACCTCCTCATAATCCTTCCG (SEQ ID No. 9);

[0181] The 10 μL qRT-PCR reaction system contains: 5 μL 2×SYBR Green mix, 0.2 μL each of qRT-PCR-F3 and qRT-PCR-R4, 0.8 μL cDNA, and 3.8 μL RNase-free water;

[0182] Amplification program: 95℃, 15s; 94℃, 15s; 60℃, 15s; 72℃, 20s; 45 cycles.

[0183] Tomato Tubulin The expression level of the gene (Solyc08g006890) was used as an internal control, according to 2 -△△Ct Methods to calculate the PR family of disease resistance genes ( PR1 , PR1a , PR1b , PR5 , PR7 and defense-related genes ( NPR1 , DCD1 , DCD 2. LCD1 and LCD2 The relative expression level of ).

[0184] from Figure 4 It can be seen that the PR family ( PR1 , PR1a , PR1b , PR5 and PR7 ) and defense-related genes ( NPR1 , DCD1 , DCD2 , LCD1 and LCD2 The expression level of ) was significantly upregulated, further confirming SlWRKY51 Gene overexpression increases the disease resistance of tomato plants.

[0185] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. SlWRKY51 The application of genes in improving the disease resistance of tomato plants is characterized by, The SlWRKY51 The nucleotide sequence of the gene is shown in SEQ ID No. 1; the application is performed by making a gene containing the nucleotide sequence... SlWRKY51 This is achieved by overexpressing the gene in tomato plants to enhance their resistance to gray mold.

2. As described in claim 1 SlWRKY51 The application of genes in improving the disease resistance of tomato plants is characterized by, The method of application includes the following steps: (1) According to SlWRKY51 Gene design amplification primers, including RT-PCR-F and RT-PCR-R, the nucleotide sequence of RT-PCR-F is shown in SEQ ID No. 2, and the nucleotide sequence of RT-PCR-R is shown in SEQ ID No. 3; (2) Total RNA was extracted from tomatoes and reverse transcribed into cDNA. The cDNA was then used as a template for RT-PCR amplification with the aforementioned primers to obtain... SlWRKY51 Target segment; (3) Use EcoRI and SacI respectively to process the data obtained in step (2). SlWRKY51 The target fragment and vector are digested with enzymes, ligated, and transformed to obtain... SlWRKY51 Gene overexpression vector.

3. As described in claim 2 SlWRKY51 The application of genes in improving the disease resistance of tomato plants is characterized by, The vector is pBG-GFP.

4. As described in claim 2 SlWRKY51 The application of genes in improving the disease resistance of tomato plants is characterized by, The SlWRKY51 Gene overexpression vectors are used to prepare transgenic positive lines, thereby improving the disease resistance of tomato plants. The specific steps for preparing transgenic positive lines are as follows: (1) Preparation of the product containing the above SlWRKY51 Agrobacterium MS suspension containing gene overexpression vector; tomato tissue was infected with this suspension. (2) The tomato tissues infected in step (1) were cultured to obtain transgenic positive lines. 。 5. As described in claim 4 SlWRKY51 The application of genes in improving the disease resistance of tomato plants is characterized by, In step (1), the tomato tissues infected with the Agrobacterium MS suspension were cotyledons and stem segments.

6. As described in claim 5 SlWRKY51 The application of genes in improving the disease resistance of tomato plants is characterized by, The transgenic positive lines showed significantly higher resistance to gray mold than wild-type plants at the same time. Specifically, the infected leaves of the transgenic positive lines exhibited milder disease symptoms, and the accumulation of hydrogen peroxide and the area of ​​dead cells were significantly reduced compared to the wild-type plants at the same time.

7. As described in claim 6 SlWRKY51 The application of genes in improving the disease resistance of tomato plants is characterized by, The staining methods include DAB staining and trypan blue staining.

8. As described in claim 6 SlWRKY51 The application of genes in improving the disease resistance of tomato plants is characterized by, Further samples were taken from the infected leaves and the expression level of the disease resistance gene was detected by real-time quantitative PCR.

9. As described in claim 8 SlWRKY51 The application of genes in improving the disease resistance of tomato plants is characterized by, The disease-resistant gene includes the PR family. PR1 , PR1a , PR1b , PR5 and PR7 and defense-related genes NPR1 , DCD1 , DCD2 , LCD1 and LCD2 .

Citation Information

Patent Citations

  • Polynucleotides and polypeptides in plants

    US20070033671A1