Application of hsacirc0114356 in evaluation of risk of triple negative breast cancer

By detecting the expression level of hsa_circ_0114356 and applying its inhibitor, combined with exosomes of triple-negative breast cancer cells, the challenges of risk assessment and treatment of triple-negative breast cancer have been solved, providing a molecular biomarker for early diagnosis and treatment, and promoting research on triple-negative breast cancer cells and drug development.

CN121065342APending Publication Date: 2025-12-05TANGSHAN PEOPLES HOSPITAL
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511414981.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-29
Publication Date
2025-12-05

AI Technical Summary

Technical Problem

Current technologies are insufficient to effectively assess the risk of triple-negative breast cancer, and there is a lack of effective molecular biomarkers for early diagnosis and treatment.

Method used

The nucleotide sequence of hsa_circ_0114356 and its specific primer pair were used for detection. By detecting the expression level of hsa_circ_0114356, combined with the extraction of exosomes from triple-negative breast cancer cells and the application of hsa_circ_0114356 inhibitors, a triple-negative breast cancer model was constructed to study its pathogenesis and development mechanism and develop corresponding drugs.

Benefits of technology

It has enabled accurate assessment of the risk of triple-negative breast cancer, provided molecular biomarkers for early diagnosis and treatment, promoted research on the proliferation, migration and invasion of triple-negative breast cancer cells, and developed corresponding preventive and therapeutic drugs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121065342A_ABST
    Figure CN121065342A_ABST
Patent Text Reader

Abstract

The invention provides application of hsacirc0114356 in evaluation of risk of triple negative breast cancer, and belongs to the technical field of molecular biology. The invention provides an application of hsacirc0114356 in evaluation of the risk of triple negative breast cancer, and the nucleotide sequence of the hsacirc0114356 is shown as SEQ ID NO. 1. The invention also provides an application of the hsacirc0114356 in evaluation of the risk of triple negative breast cancer. According to the present invention, the research results show that the hsacirc0114356 has high expression in the MDA-MB-231 cell exosome, and the hsacirc0114356-containing triple negative breast cancer cell exosome can promote the proliferation of breast cancer cells and the dry balling of the breast cancer cells, and can promote the migration and the invasion of the breast cancer cells; the detection of the expression quantity of the hsacirc0114356 can be used for evaluating the risk of the triple negative breast cancer.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the field of molecular biology technology, and particularly relates to application of hsa_circ_0114356 in evaluating risk of triple-negative breast cancer. BACKGROUND

[0002] Breast cancer is a worldwide disease that seriously threatens human health. In the past five years, with the implementation of self-conscious intervention of cancer disease, the emergence of new drugs, and the continuous research and development of new clinical treatment methods, more and more breast cancer patients are discovered and treated in early stage, so that the effective rate of breast cancer treatment and the 5-year overall survival time of breast cancer patients are significantly improved. Triple-negative breast cancer (TNBC) is a type of breast cancer that lacks estrogen receptor (ER), progesterone receptor (PR) and human epidermal receptor-2 (HER2). In the past five years, retrospective studies have found that the prevalence of TNBC accounts for about 24% of all types of breast cancer, and compared with other types of breast cancer, TNBC has the characteristics of earlier age of onset, stronger histological invasiveness, more extensive surgical range, higher risk of 5-year local recurrence, and poorer 5-year overall survival rate.

[0003] In recent years, the reports about the relationship between circular RNAs (circRNAs) and breast cancer chemotherapy have become a hot research topic. Circular RNAs (circRNAs) have the function of regulating apoptosis caused by chemotherapy drugs. People call this kind of covalently closed circular non-coding RNA (non-coding RNAs, ncRNAs) circRNAs, which can regulate the progression of cancer by sponging a variety of microRNAs (microRNA, miRNA) associated with carcinogenesis. From the structure, circRNAs lack the cap-like structure of 5'-methylguanine and the 3'-poly A tail, so they are free from exonuclease hydrolysis, and widely exist in tumor tissues, blood and body fluids of cancer patients. With the all-round exploration of circRNAs from biosynthesis to function, people found that circRNAs can compete with miRNAs, affect the stability or translation of target mRNA, and thus regulate the expression of genes at the transcriptional level. Studies have shown that the biological behavior of various types of tumor cells such as proliferation, apoptosis, invasion and migration are involved in circRNAs. With the development of transcriptome sequencing and RT-qPCR technology, and the characteristics of circRNAs being stable and easy to extract in tissues, serum and urine, its detection has become faster and more convenient. With in-depth research on its function, the advantages of circRNAs as a new generation of molecular biology markers are becoming more and more prominent, which also lays a theoretical basis for its use to evaluate and predict the treatment effect and prognosis of cancer.

[0004] Exosomes are 30-100 nm endocytosis-derived membrane vesicles released by living cells. Exosomes contain a variety of substances, including proteins, mRNAs, microRNAs (miRNAs) and non-coding RNAs (non-coding RNAs, ncRNAs), which can be transferred from donor cells to recipient cells and can activate or regulate cell activities such as protein expression, cell proliferation and differentiation or antiviral response, thereby affecting tumor development. Exosome-mediated cell-cell communication can change tumor growth, cell migration, antiviral infection and liver cell regeneration, and has great potential for development in the diagnosis or treatment of liver cancer. So far, the analysis of serum exosomal miRNAs has found a large number of candidate miRNAs regulated in breast cancer, and the use of single or multiple miRNAs for diagnostic tests shows good sensitivity and specificity. In addition, some candidate circRNAs have been identified to play an important role in breast cancer, and more and more exosomal circRNAs have been found to be potential biomarkers for breast cancer. SUMMARY

[0005] Therefore, one of the purposes of the present application is to provide application of hsa_circ_0114356 in evaluating risk of triple-negative breast cancer.

[0006] The second purpose of the present application is to provide a primer pair for detecting hsa_circ_0114356.

[0007] The third purpose of the present application is to provide application of the primer pair in preparing a product for evaluating risk of triple-negative breast cancer.

[0008] The fourth purpose of the present application is to provide application of an inhibitor of hsa_circ_0114356 in preparing a medicament for preventing and / or treating triple-negative breast cancer.

[0009] The fifth purpose of the present application is to provide triple-negative breast cancer cell exosomes containing hsa_circ_0114356.

[0010] The sixth purpose of the present application is to provide application of the triple-negative breast cancer cell exosomes in any one or more of constructing a triple-negative breast cancer model, researching mechanism of occurrence and development of triple-negative breast cancer, and developing or screening a medicament for preventing and / or treating triple-negative breast cancer.

[0011] In order to achieve the above-mentioned purposes of the present application, the present application provides the following technical solutions. Application of hsa_circ_0114356 in evaluating risk of triple-negative breast cancer, wherein the nucleotide sequence of the hsa_circ_0114356 is shown as SEQ ID NO. 1.

[0012] Preferably, the hsa_circ_0114356 promotes proliferation of triple-negative breast cancer cells.

[0013] Preferably, the hsa_circ_0114356 promotes spheroid formation of triple-negative breast cancer cells.

[0014] Preferably, the hsa_circ_0114356 promotes migration and invasion of triple-negative breast cancer cells.

[0015] The present application also provides a primer pair for detecting the hsa_circ_0114356, wherein the nucleotide sequence of the upstream primer is shown as SEQ ID NO. 2, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 3.

[0016] The present application also provides application of the primer pair in preparing a product for evaluating risk of triple-negative breast cancer.

[0017] The application also provides application of the hsa_circ_0114356 inhibitor in preparation of a drug for preventing and / or treating triple-negative breast cancer, wherein the hsa_circ_0114356 inhibitor inhibits expression of hsa_circ_0114356.

[0018] Preferably, the inhibitor comprises hsa_circ_0114356 siRNA, wherein the nucleotide sequence of the hsa_circ_0114356 siRNA is shown as SEQ ID NO. 4.

[0019] The application also provides triple-negative breast cancer cell exosomes containing hsa_circ_0114356.

[0020] The application also provides application of the triple-negative breast cancer cell exosomes in any one or more of the following aspects: constructing a triple-negative breast cancer model, researching a mechanism of occurrence and development of triple-negative breast cancer, and developing or screening a drug for preventing and / or treating triple-negative breast cancer.

[0021] Compared with the prior art, the application has the following beneficial effects: The application provides application of hsa_circ_0114356 in evaluating a risk of triple-negative breast cancer, and the application researches and finds that hsa_circ_0114356 is highly expressed in MDA-MB-231 cell exosomes, that triple-negative breast cancer cell exosomes containing hsa_circ_0114356 can promote proliferation of breast cancer cells, stemness of breast cancer cells, and migration and invasion of breast cancer cells, and that detecting an expression amount of hsa_circ_0114356 can be used to evaluate the risk of triple-negative breast cancer. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 TEM detection results of extracted exosomes after different treatments of cells; Figure 2 pLCDH-circRERE exosome Malvern nanoparticle size analyzer detection results; Figure 3 Expression levels of circRERE in MDA-MB-231 cell exosomes, wherein A represents that circRERE is highly expressed in MDA-MB-231 cell exosomes, B represents that circRERE is lowly expressed in circRERE intervention group cell exosomes, and C represents that circRERE is highly expressed in circRERE overexpression group cell exosomes; Figure 4Effects of different exosomes on proliferation, sphere formation of TBC cells; wherein, A-C: TNBC cell exosomes can inhibit cell proliferation by inhibiting circRERE; D-F: TNBC cell exosomes can regulate cell stemness by transmitting inhibiting circRERE; Figure 5 Effects of different exosomes on proliferation, migration and invasion of TBC cells; Figure 6 circRERE levels in serum of healthy subjects and clinical patients with breast cancer. DETAILED DESCRIPTION

[0023] The present application provides application of hsa_circ_0114356 (circRERE) in evaluating risk of triple-negative breast cancer, wherein the nucleotide sequence of the hsa_circ_0114356 is shown as SEQ ID NO. 1: CTCCTGGTCTGTAGACCACATCATCTTCAGTGATGTAGGATGTTATCTCACCGGTATCTGTCCTTTCATAACGAGACTTTTTTTTCGGTGGTTTCTTCTTATTCTTCTTCGTGGACTCCTCTGCGGTGGCACTATTGTTGTCATTGTCCTCGTCTTCACTGTGATCACTCTCAGCATAATTTTTGGCTCCTCCTTCCAAGGTACAGCTCCGGCGTGGCCTTGAATTCTCACTCTCTCTTGCTTTGTCTCTTTTCtctctctctcggtcccggtctcggtcccggtccttctctttgtctttgtctttgtctttgtcCGCTGTCATGATTCGCCACGTGCCTTCTTCTGTCCTCTCACGGCTAGGCCTCCGTGAAAGGTAGACAGTAAGCCTGGGCTTCAGTCTTCTGAATTTCTCACTCAATTCCAGGGAAAATCCAACCACTCCAACAACCCCAACGTTTCAAAAATG, wherein the lowercase letters are introns. The present application finds that hsa_circ_0114356 is highly expressed in MDA-MB-231 cell exosomes.

[0024] The application further provides a primer pair for detecting the hsa_circ_0114356, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO. 2: GAGGAGTCCACGAAGAAGAATAAG, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO. 3: CAAAATGCTCCTGGTCTGTAG.

[0025] The application further provides application of the primer pair in preparation of a product for evaluating the risk of triple-negative breast cancer. The expression amount of hsa_circ_0114356 can be accurately detected by performing quantitative PCR detection using the primer pair provided by the application, and then the risk of triple-negative breast cancer can be evaluated. The product in the application includes a reagent containing the primer pair or a kit containing the primer pair.

[0026] The application further provides a triple-negative breast cancer cell exosome containing hsa_circ_0114356.

[0027] The extraction method of the exosome provided by the application preferably comprises the following steps: triple-negative breast cancer cells are cultured in a DMEM high-sugar culture medium containing 10% FBS for 24 hours to obtain a culture solution, the culture solution is centrifuged at 500g, 2000g, 6000g and 20000g in sequence, the supernatant is taken after each centrifugation for the next centrifugation, the supernatant is taken after the last centrifugation, centrifuged at 100000g, the precipitate is collected, resuspended with a buffer, centrifuged at 130000g, the precipitate is collected, resuspended with a buffer, and an exosome sample is obtained, which is divided and stored at -80℃ for long-term preservation.

[0028] In the extraction method of the exosome, the centrifugation is preferably 10-12min at 500g, 30-35min at 2000g, 60-70min at 6000g, 60-70min at 20000g, 90-120min at 100000g, and 70-80min at 130000g; in the application, the precipitate is preferably resuspended with PBS (0.1 mM, pH=7.4). The exosome containing hsa_circ_0114356 in the application has a cup-shaped or tea-tray-shaped structure with a diameter of 30-150nm.

[0029] The present application researches and finds that the exosomes extracted after transfecting MDA-MB-231 cells with overexpression plasmid pLCDH-hsa_circ_0114356 and the exosomes extracted after transfecting MDA-MB-231 cells with hsa_circ_0114356 siRNA are used to culture MDA-MB-231 and MCF-7 cells, and the results show that the exosomes extracted after overexpression of hsa_circ_0114356 can significantly promote the colony formation, cell proliferation and stemness of MDA-MB-231 and MCF-7 cells, and can significantly promote the migration and invasion of the cells. The exosomes extracted after knockdown of hsa_circ_0114356 significantly slow down the cell colony formation, cell proliferation and stemness of MDA-MB-231 and MCF-7 cells.

[0030] The present application also provides application of the hsa_circ_0114356 inhibitor in preparation of a drug for preventing and / or treating triple-negative breast cancer, wherein the hsa_circ_0114356 inhibitor inhibits expression of hsa_circ_0114356. The inhibitor includes hsa_circ_0114356 siRNA, and the nucleotide sequence of the hsa_circ_0114356 siRNA is shown in SEQ ID NO. 4: ACGAGGACAATGACAACAATA.

[0031] The present application also provides application of the exosomes of the triple-negative breast cancer cells in any one or more of the following aspects: constructing a triple-negative breast cancer model, researching the occurrence and development mechanism of triple-negative breast cancer, and developing or screening a drug for preventing and / or treating triple-negative breast cancer.

[0032] The technical solutions provided by the present application are described in detail below in combination with examples, but they should not be understood as limiting the scope of protection of the present application.

[0033] Example 1 Exosome extraction

[0034] One day before transfection, triple-negative breast cancer cells MDA-MB-231 cells were inoculated in a 10 cm dish, and the next day the cells were confluent to a concentration of 70-80%. The cells were washed with PBS for 2-3 times to remove serum interference, and replaced with 4 mL of serum-free DMEM high-glucose medium.

[0035] MDA-MB-231 cells were transfected with knockdown si-RNA of circRERE (hsa_circ_0114356), control si-NC (SEQ ID NO. 5: TGCCTCCTCAATGACAACAATA), overexpression plasmid pLCDH-circRERE (Guangzhou Jise), and control empty plasmid pLCDH-NC, respectively, as follows: Different A solutions were prepared: 600 μL of base medium (serum-free DMEM high-sugar medium) was mixed with 12 μg of si-RNA, control si-NC, overexpression plasmid pLCDH-circRERE, or control empty plasmid pLCDH-NC, respectively, and blown and aspirated to mix well.

[0036] B solution was prepared: 600 μL of base medium (serum-free DMEM high-sugar medium) was mixed with 60 μL of PEI 40 K transfection reagent, and blown and aspirated to mix well.

[0037] B solution was added to A solution, gently blown to mix well, and incubated at room temperature for 20 min to form a transfection complex.

[0038] The transfection complex was evenly dropped into a 10 cm dish with 5 mL of serum-free medium in a cross pattern. The dish was gently mixed to fully mix the transfection complex and evenly distribute it in the dish. Incubation was continued at 37°C in a 5% CO2 incubator for 6 h. 10 mL of new DMEM high-sugar complete medium containing 10% FBS was added, and incubation was continued in the incubator for 36 h. After washing with PBS for 3 times, DMEM / F12 containing 10% exosome-free serum (purchased from Aibisheng) was added, and incubation was continued for 24 h. The conditioned medium supernatant was collected and centrifuged at 500g for 10 min, 2000g for 30 min, 6000g for 60 min, 20000g for 60 min, and 100000g for 90 min. After centrifugation, the precipitate was resuspended with PBS (2.7 mM KCl, 2.0 mM KH2PO4, 137 mM NaCl, 10 mM Na2HPO4, pH=7.4). The resuspended solution was filtered through a 0.22 μm sterile filter. The liquid was then centrifuged at 130000g for 70 min at 4°C. The supernatant was discarded, and the precipitate was resuspended in PBS. The sample was transferred to a sterile EP tube, aliquoted, and stored at -80°C for long-term storage.

[0039] Exosomes extracted from MDA-MB-231 cells transfected with hsa_circ_0114356 siRNA were denoted as si-circRERE; exosomes extracted from MDA-MB-231 cells transfected with the control si-NC were denoted as si-NC; exosomes extracted from MDA-MB-231 cells transfected with the overexpression plasmid pLCDH-circRERE were denoted as pLCDH-circRERE; and exosomes extracted from MDA-MB-231 cells transfected with the control empty vector pLCDH-NC were denoted as pLCDH-NC.

[0040] 100 μL of exosomes from each group were fixed with 50 μL of glutaraldehyde. After 1 hour, 10 μL of the sample was transferred to a copper grid, precipitated for 1 minute, and the liquid was absorbed with filter paper. 10 μL of phosphotungstic acid was added to the copper grid, stained for 1 minute, the liquid was absorbed with filter paper, and the sample was air-dried. The results were then examined and photographed under a transmission electron microscope. Figure 1 As shown, the exosomes were morphologically identified as cup-shaped or saucer-shaped structures with a diameter of approximately 30–150 nm.

[0041] pLCDH-circRERE exosomes were analyzed using a Malvern nanoparticle size analyzer, and the results are as follows: Figure 2 As shown, the exosome concentration was 4 × 10⁻⁶. 11 The number of particles per mL was 125.8 nm.

[0042] Example 2 Expression level of hsa_circ_0114356 in exosomes of MDA-MB-231 cells.

[0043] 1. Following the method described in Example 1, exosomes were extracted from MDA-MB-231 cells transfected with circRERE (hsa_circ_0114356) knockdown si-RNA, control si-NC, and overexpression plasmid pLCDH-circRERE (as a control with empty vector plasmid pLCDH-NC).

[0044] Meanwhile, MDA-MB-231 cells were passaged at a 1:2 ratio and seeded in 10cm petri dishes. They were then incubated overnight in complete culture medium (DMEM high-glucose medium containing 10% FBS), washed three times with PBS, and the Ctrl control group was replaced with a DMEM / F12 culture system containing 10% exosome-free serum. The GW4869 treatment group was replaced with a DMEM / F12 culture system containing 10μM GW4869 and 10% exosome-free serum. After culturing for another 24 hours, exosomes were extracted using the same method as in Example 1.

[0045] 2. Exosomal RNA extraction.

[0046] Exosome RNA extraction kit (Aibisheng). Take out the washing solution of the kit, add anhydrous ethanol at a final concentration of 80%, and mix well. Add 150 μL of the purified exosome sample, 100 μL of lysis solution, and 10 μL of digestion solution to a 1.5 mL centrifuge tube without enzyme, vortex for 10 seconds, and incubate in a 65°C water bath for 10 minutes. Then add 0.55 mL of anhydrous ethanol and mix well by inverting. Extract RNA by conventional column centrifugation.

[0047] The circular RNA reverse transcription qPCR kit (Aivei) is used for RT-qPCR detection of circRERE.

[0048] The reverse transcription system is: 5×RT Buffer 4 μL, TransScript RT Enzyme (M-MLV) 2 μL, Reverse Transcrption Primer 2 μL, Total RNA 1 μg, RNase free Water To 20 μL, and the total volume is 20 μL.

[0049] The first strand cDNA synthesis reaction program is: 25°C, 10 min; 42°C, 30 min; 85°C, 5 min.

[0050] The quantitative PCR reaction system is: 2×qPCR SYBR Green Master Mix 10 μL, upstream primer (10 μM) 0.5 μL, downstream primer (10 μM) 0.5 μL, DNA template 1 μL, RNase-free Water 8 μL, and the total volume is 20 μL.

[0051] The quantitative PCR program is: pre-denaturation 95°C, 5 min; 95°C, 10 s, 60°C 30 s, 40 cycles; 57°C, 34 s.

[0052] The upstream primer (SEQ ID NO. 2) for detecting hsa_circ_0114356 is: GAGGAGTCCACGAAGAAGAATAAG; and the downstream primer (SEQ ID NO. 3) is: CAAAATGCTCCTGGTCTGTAG.

[0053] The upstream primer (SEQ ID NO. 6) for detecting the internal reference GAPDH is: ACCCAGAAGACTGTGGATGG; and the downstream primer (SEQ ID NO. 7) is: TCAGCTCAGGGATGACCTTG.

[0054] The primers are synthesized by Shengong.

[0055] The results are as follows Figure 3As shown, hsa_circ_0114356 was highly expressed in MDA-MB-231 cell exosomes, and the expression of hsa_circ_0114356 decreased after treatment with exosome inhibitor (GW4869) Figure 3 A in FIG. 6B shows that circRERE was lowly expressed in exosomes of circRERE inhibition group cells (two repeated experiments), Figure 3 B in FIG. 6B shows that circRERE was lowly expressed in exosomes of circRERE inhibition group cells (two repeated experiments), Figure 3 C in FIG. 6B shows that circRERE was highly expressed in exosomes of cells in circRERE overexpression group.

[0056] Example 3 1. Effect of TNBC cell exosomes on cell proliferation and stemness sphere formation.

[0057] 1.1 The exosomes extracted after transfection of si-NC, circRERE (hsa_circ_0114356) si-RNA in MDA-MB-231 in Example 2 were used for subsequent experiments.

[0058] Ctrl: MDA-MB-231 or MCF-7 cells were cultured in DMEM / F12 culture system containing 10% exosome-depleted serum (such as 9 mL DMEM / F12 basic culture medium + 1 ml complete culture medium containing exosome-depleted serum), as a control group without exosome treatment, for cell proliferation and stemness sphere formation experiments.

[0059] exo: Compared with the Ctrl group, 10 10 particles / mL of exosomes derived from supernatant of si-NC transfected MDA-MB-231 cells were added to the DMEM / F12 culture system containing 10% exosome-depleted serum, and after the cells were cultured, whether the exosomes had a promoting effect on MDA-MB-231 cell or MCF-7 cell proliferation and stemness was studied; exo+si-circRERE: Compared with the Ctrl group, 10 10 particles / mL of exosomes derived from supernatant of si-circRERE (hsa_circ_0114356) transfected MDA-MB-231 cells were added to the DMEM / F12 culture system containing 10% exosome-depleted serum, and after the cells were cultured, whether the exosomes of the si-circRERE group had an inhibitory effect on MDA-MB-231 cell or MCF-7 cell proliferation and stemness was studied.

[0060] 37℃, 5% CO2 incubator for 48h, when the cell confluence rate reached 80%~90%, passaged, inoculated in six-hole plate (500 cells per hole). After 14 days, 4% paraformaldehyde, room temperature fixed cells for 15 min, PBS rinse 2 times; using 0.1% crystal violet solution, avoid light incubation for 15 min, wash with water. Mobile phone photography, FIJI software analysis and calculate the number of clones (counted clone cell number ≥ 50). Graphpad software for plotting and statistical analysis.

[0061] Results are shown in A~C of Figure 4 As shown in A~C of

[0062] 1.2 Take the exosomes extracted from MDA-MB-231 transfected with si-NC, circRERE (hsa_circ_0114356) knockdown si-RNA in Example 2 for subsequent experiments.

[0063] Ctrl, exo, exo+si-circRERE treatment is the same as 1.1 in Example 3.

[0064] 37℃, 5% CO2 incubator for 48h, when the cell confluence rate reached 80%~90%, passaged, inoculated in six-hole plate (500 cells per hole). After 14 days, 4% paraformaldehyde, room temperature fixed cells for 15 min, PBS rinse 2 times; using 0.1% crystal violet solution, avoid light incubation for 15 min, wash with water. Mobile phone photography, FIJI software analysis and calculate the number of clones (counted clone cell number ≥ 50). Graphpad software for plotting and statistical analysis.

[0065] Results are shown in A~C of Figure 4As shown in D-F, the exosome negative control group (exo) of TNBC cell can significantly promote the stemness of MDA-MB-231 and MCF-7 cells (compared with the untreated group Ctrl). After the exosome derived from the circRERE intervention group is used to treat the cells (exo+si-circRERE group), the stemness of MDA-MB-231 and MCF-7 cells is significantly slowed down compared with the exosome negative control group (exo). Thus, it is proved that the exosome of TNBC cell can regulate the stemness of MDA-MB-231 and MCF-7 cells by transmitting circRERE.

[0066] 2. High expression of circRERE in exosomes can further promote cell proliferation, sphere formation, migration and invasion. The exosomes extracted from MDA-MB-231 transfected with overexpression plasmid pLCDH-circRERE and control empty plasmid pLCDH-NC in Example 2 are used for subsequent experiments.

[0067] Ctrl: MDA-MB-231 or MCF-7 cells are cultured in DMEM / F12 culture system containing 10% exosome-depleted serum (such as 9 mL DMEM / F12 basic medium + 1 mL complete medium containing exosome-depleted serum), which is used as a control group without exosome treatment; Exo pLCDH : In DMEM / F12 containing 10% exosome-depleted serum, 10 10 particles / mL of exosomes derived from MDA-MB-231 transfected with control empty plasmid pLCDH-NC are added for culturing MDA-MB-231 cells or MCF-7 cells; Exo circRERE : In DMEM / F12 containing 10% exosome-depleted serum, 10 10 particles / mL of exosomes derived from MDA-MB-231 transfected with overexpression plasmid pLCDH-circRERE are added for culturing MDA-MB-231 cells or MCF-7 cells; Exo circRERE +GW4869: In DMEM / F12 containing 10% exosome-depleted serum, 10 10 particles / mL of exosomes derived from MDA-MB-231 transfected with overexpression plasmid pLCDH-circRERE are added for culturing MDA-MB-231 cells or MCF-7 cells.

[0068] 37℃, 5% CO2 incubator, every 24 h, change the liquid, when the cell confluence rate reached 80%~90%, passaged, inoculated in six-hole plate (300 cells per hole), and performed the cloning formation experiment, and performed staining analysis on the 14th day, 4% paraformaldehyde, room temperature, fixed cells for 20 min, PBS rinse for 2 times; using 0.1% crystal violet solution, avoid light, incubate for 20 min, wash with water. Take a photo with a mobile phone, analyze and calculate the number of clones (the number of counted clones is ≥50) by using FIJI software. Draw a graph and perform statistical analysis by using Graphpad software. The passaged cells were inoculated in the six-hole plate without adhesion treatment (500 cells per hole). After 14 days, the stemness sphere change of the cells was observed. The image was taken under a microscope with 40 times magnification.

[0069] The results are shown in Figure 5 The exosomes derived from the control empty plasmid pLCDH-NC transfected cells significantly enhanced the cloning formation and stemness sphere formation of the cells after treatment. The exosomes of the circRERE overexpression group more significantly promoted the cloning formation and stemness sphere formation of the cells than the empty group. The cloning formation and stemness sphere formation of the cells treated by the exosome inhibitor GW4869 were reduced.

[0070] The passaged cells obtained in each group were resuspended in serum-free basic medium (100000 cells / mL), and 200 μL was inoculated in the upper chamber of the Transwell (Jiete). The finished Transwell chamber (Jiete) coated with matrigel was used for the invasion experiment. The lower well plate was added with the medium containing 20% fetal bovine serum. After 16 h, the cell migration and invasion were observed, and the cells were fixed with 4% paraformaldehyde at room temperature for 15 min, and then rinsed with PBS for 2 times; 0.1% crystal violet solution was used, avoid light, incubate for 20 min, wash the excess crystal violet with PBS, and then observe the cells that passed through the membrane of the chamber under an inverted microscope. The image was taken under a 100 times magnification.

[0071] The results are shown in Figure 5 The results of migration and invasion showed that the exosomes derived from the pLCDH empty group significantly enhanced the migration and invasion ability of the cells after treatment; the exosomes of the circRERE overexpression group more significantly promoted the migration and invasion of the cells than the empty group. The migration and invasion of the cells treated by the exosome inhibitor GW4869 were reduced.

[0072] Example 4 Ten serum samples of healthy subjects, 29 serum samples of patients with estrogen receptor (ER) positive breast cancer, and 31 serum samples of patients with triple negative breast cancer (TNBC) were collected. The circRERE level in each group of serum was detected by RT-qPCR.

[0073] The results are shown inFigure 6 The results show that there is no statistical significance in the level of circRERE between ER-positive breast cancer patients and healthy subjects, while the level of circRERE in the serum of TNBC patients is significantly higher than that of healthy subjects and ER-positive breast cancer patients. The above results suggest that the level of serum circRERE can be used to evaluate the risk of triple-negative breast cancer.

[0074] The above only describes the preferred embodiments of the present application, and it should be noted that those skilled in the art can make several improvements and refinements without departing from the principles of the present application, and these improvements and refinements should also be considered as the protection scope of the present application.

Claims

1. Use of hsa_circ_0114356 in assessing the risk of triple-negative breast cancer, characterized in that, The nucleotide sequence of the hsa_circ_0114356 is shown as SEQ ID NO.

1.

2. Use according to claim 1, characterized in that, The hsa_circ_0114356 promotes the proliferation of triple-negative breast cancer cells.

3. Use according to claim 1, characterized in that, The hsa_circ_0114356 promotes the sphere-forming ability of triple-negative breast cancer cells.

4. Use according to claim 1, characterized in that, The hsa_circ_0114356 promotes the migration and invasion of triple-negative breast cancer cells.

5. A pair of primers, characterized in that, The primer pair for detecting the hsa_circ_0114356 of claim 1, wherein the nucleotide sequence of the upstream primer is shown as SEQ ID NO. 2, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.

3.

6. The primer pair of claim 5 in the preparation of a product for assessing the risk of triple-negative breast cancer.

7. Use of an hsa_circ_0114356 inhibitor in the preparation of a medicament for preventing and / or treating triple-negative breast cancer, wherein the hsa_circ_0114356 inhibitor inhibits the expression of hsa_circ_0114356.

8. Use according to claim 7, characterized in that, The inhibitor includes an hsa_circ_0114356 siRNA, wherein the nucleotide sequence of the hsa_circ_0114356 siRNA is shown as SEQ ID NO.

4.

9. A triple negative breast cancer exosome, characterized in that, The triple-negative breast cancer cell exosome contains hsa_circ_0114356.

10. The triple-negative breast cancer cell exosome of claim 9 is used in any one or more of the following (1)~(3): (1) constructing a triple-negative breast cancer model; (2) studying the mechanism of occurrence and development of triple-negative breast cancer; (3) developing or screening drugs for preventing and / or treating triple-negative breast cancer.