Molecular detection kit and detection method for tomicus yunnanensis RPA-Cas12a

Abstract

The invention belongs to the technical field of molecular detection, and particularly discloses a molecular detection kit and a detection method for tomicus yunnanensis RPA-Cas12a. The kit comprises an RPA (recombinase polymerase amplification) primer, Cas12a, crRNA (complementary ribose nucleic acid) and ssDNA (single-stranded deoxyribonucleic acid), wherein the protein of the Cas12a is LbCas12a; the ssDNA is 5 '-FAM-TTATT-BHQ1-3'. According to the molecular identification system disclosed by the invention, a set of molecular identification system based on combination of recombinase polymerase amplification (RPA) and a CRISPR-Cas12a system is constructed by taking tomicus yunnanensis as a detection target, and the molecular identification system is used for realizing high-specificity, high-sensitivity and rapid field detection of forestry pests.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecular detection, and particularly relates to a RPA-Cas12a molecular detection kit and a detection method for Yunnan bark beetle. BACKGROUND

[0002] The bark beetle mainly feeds on the top of the pine tree in the form of adult, cuts off the supply of water and nutrients in the tree, causes the tree top to wither and fall off, and the tree to die. Yunnan bark beetle, horizontal pit bark beetle and short hair bark beetle often occur mixedly in the southwest of China, causing the whole forest to wither, wherein the Yunnan bark beetle can harm the healthy Yunnan pine, and the horizontal pit bark beetle is a secondary dry wood pest. The bark beetle is difficult to control, and it is necessary to timely distinguish and take corresponding control strategies. The Yunnan bark beetle and its close relatives such as the horizontal pit bark beetle and the vertical pit bark beetle are extremely similar in morphology. The traditional identification method mainly depends on observing the morphological characteristics such as the elytra dot of the adult under a microscope, which requires high professional experience of the operator, and is time-consuming and low in accuracy. When the insect body is in the form of larva or the sample amount is large, morphological identification is almost impossible. Therefore, a method for quickly distinguishing and identifying the Yunnan bark beetle is urgently needed, so as to monitor and control the occurrence and development of the Yunnan bark beetle in the early stage. SUMMARY

[0003] The application takes the Yunnan bark beetle as a detection target, and constructs an RPA-Cas12a molecular identification system. By designing specific primers and probes that only bind to the species, a clear result can be obtained within 35 min. Specifically, the application provides the following technical scheme:

[0004] The application provides a Yunnan bark beetle RPA-Cas12a molecular detection kit, which contains RPA amplification primers, Cas12a, crRNA and ssDNA. The sequence of the RPA amplification primer is TTATTTTACCATAGGAGGCTTAACGGGAG and TAATCATTCAATAGAAGTAGATAAATTTAAT.

[0005] The sequence of the crRNA is UAAUUUCUACUAAGUGUAGAUCUCCUACAAAUAUAGAUAUAA, and the Cas12a protein is LbCas12a; and the ssDNA is 5'-FAM-TTATT-BHQ1-3'.

[0006] The application further provides a Yunnan bark beetle molecular detection method, which comprises the following steps:

[0007] (1) extracting genomic DNA of a sample to be detected;

[0008] (2) using RPA amplification primers to amplify the target gene; the sequence of the RPA amplification primer is TTATTTTACCATAGGAGGCTTAACGGGAG and TAATCATTCAATAGAAGTAGATAAATTTAAT;

[0009] (3) using the RPA amplification product, Cas12a protein, crRNA and ssDNA to construct a detection system, and obtaining a reaction product after reaction; and identifying by fluorescence detection method; if there is fluorescence phenomenon, it is Tomicus yunnanensis;

[0010] The sequence of the crRNA is UAAUUUCUACUAAGUGUAGAUCUCCUACAAAUAUAGAUAUAA, the Cas12a protein is LbCas12a; and the ssDNA is 5'-FAM-TTATT-BHQ1-3'.

[0011] Further, in step (2), the RPA amplification reaction condition is 37℃, 20min;

[0012] Further, in step (3), the reaction condition is 37℃, 15min.

[0013] Technical effects achieved by the present application:

[0014] The present application takes Tomicus yunnanensis as the detection target, and constructs a molecular identification system based on recombinase polymerase amplification (RPA) combined with CRISPR-Cas12a system, which is used for realizing high specificity, high sensitivity and rapid on-site detection of the forestry pest. The core of the system is that a pair of high-specificity RPA amplification primers and a CRISPR RNA (crRNA) probe are designed and screened according to the specific sequence of Tomicus yunnanensis. The probe can guide the Cas12a protein to specifically recognize the target DNA sequence of Tomicus yunnanensis, and activate its “collateral cleavage” activity, so as to cut the labeled fluorescent reporter probe in the system, and generate a detectable fluorescent signal.

[0015] The whole detection process is carried out under constant temperature (37℃) condition, without the need of complex thermal cycling equipment, and only needs about 35 minutes to complete the whole process from sample nucleic acid release to result interpretation, which significantly shortens the time required by traditional morphological identification or PCR detection. More importantly, the system exhibits high species specificity: through strict bioinformatics alignment and experimental verification, the designed primer-crRNA combination only binds to the target sequence of Tomicus yunnanensis efficiently, and has no cross reaction with its close relatives such as Tomicus minor, Tomicus piniperda and the like, effectively avoiding misjudgment and realizing the accurate identification of single species in a true sense.

[0016] In terms of sensitivity, the system can stably detect as low as 1.0 ng / µL of genomic DNA, which is equivalent to the DNA concentration of microtissue extract of a single insect individual, and is suitable for early monitoring, port quarantine or rapid screening of trace samples in forestry investigation. In addition, the system has good field applicability, and can be combined with portable fluorescence detection equipment or test strip visual reading platform to realize point-of-care detection without relying on professional laboratory conditions.

[0017] In summary, the RPA-Cas12a molecular identification system established by the application not only breaks through the dependence of traditional morphological identification on professional knowledge and complete specimens, but also overcomes the limitations of long time consumption and high equipment requirement of conventional PCR technology, and provides strong technical support for rapid, accurate and on-site detection of Tomicus yunnanensis. It has important practical significance and popularization value for improving the monitoring and early warning ability of forestry harmful organisms in China, and preventing the invasion of alien species and confusion of close relatives. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 RPA optimal primer specificity comparison electrophoresis analysis chart;

[0019] Figure 2 RPA temperature optimization comparison electrophoresis analysis chart;

[0020] Figure 3 RPA time optimization comparison electrophoresis analysis chart;

[0021] Figure 4 RPA sensitivity detection gel electrophoresis analysis chart;

[0022] Figure 5 Fluorescence detection primer specificity chart;

[0023] Figure 6 Visual fluorescence detection primer specificity chart;

[0024] Figure 7 CRISPR-Cas12a time optimization comparison fluorescence detection chart;

[0025] Figure 8 Fluorescence detection system sensitivity chart;

[0026] Figure 9 Yunnan branchlet bark beetle RPA / CRISPR-Cas12a detection system sensitivity detection chart. DETAILED DESCRIPTION

[0027] In order to make the objects, technical solutions and advantages of the present application clearer, the technical solutions in the present application will be described clearly and completely below. Obviously, the described embodiments are part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative labor fall within the scope of protection of the present application.

[0028] In the test method, the purchased commodities are carried out according to the conventional conditions or the conditions recommended by the manufacturer, and the reagents or instruments used are not marked with the manufacturer, which can be obtained by the conventional products purchased in the market. Unless otherwise defined herein, the scientific and technical terms used in conjunction with the present disclosure should have the meanings generally understood by those of ordinary skill in the art. The following describes exemplary methods and materials, but methods and materials similar or equivalent to those described herein can also be used in the practice and testing of the present disclosure.

[0029] Example 1

[0030] A Yunnan branchlet bark beetle molecular detection method comprises the following steps:

[0031] a) extracting the genomic DNA of the sample to be detected;

[0032] Blood / cell / tissue genomic DNA extraction kit (centrifugal column type)

[0033] b) using RPA amplification primers to amplify the target gene to obtain an amplification product;

[0034] The RPA amplification primer sequence is as follows:

[0035] T.y-F TTATTTTACCATAGGAGGCTTAACGGGAG

[0036] T.y-R TAATCATTCAATAGAAGTAGATAAATTTAAT

[0037] RPA reaction system: Ty-F 1.2 μL; Ty-R 1.2 μL; Primer Free Rehydration buffer 14.75 μL; ddH2O 5.1 μL; DNA 1.5 μL; mgoac 1.25 μL;

[0038] RPA reaction conditions: 37℃, 20min.

[0039] c) A detection system was constructed using RPA amplification products, Cas12a protein, crRNA, and ssDNA. The reaction product was obtained after the reaction. The product was identified by fluorescence detection. The presence of fluorescence indicated that the product was *Bark Beetle of Yunnan*.

[0040] crRNA sequence: UAAUUUCUACUAAGUGUAGAUCUCCUACAAAUAUAGAUAUAA, Cas12a protein is LbCas12a; ssDNA is 5'-FAM-TTATT-BHQ1-3'.

[0041] CRISPR detection reaction system: ddH2O 12.8μL; NE buffer 3.1 (10x) 2μL; Cas12a protein (5μM) 0.8μL; crRNA (10μM) 2μL; FQ-Reporter (5μM) 0.4μL; RPA amplification product 2μL.

[0042] Reaction conditions: 37℃, 15 min.

[0043] Optimization of test reagent and condition design, and verification of test results

[0044] 1 RPA-specific primers

[0045] like Figure 1 As shown in the RPA primer specificity comparison diagram for *Bartholinium yunnanense*, lanes 1-5 contain nucleic acids from *Bartholinium yunnanense*, *Bartholinium hengkeng*, *Bartholinium sparserum*, and two species of *Bartholinium*. M represents DL 2000 Maker, and N represents sterile, enzyme-free water. Agarose gel electrophoresis results show a band in lane 1, while lanes 4-5 and N show no bands, verifying the good specificity of the primers.

[0046] TY-F TTATTTTACCATAGGAGGCTTAACGGGAG

[0047] TY-R TAATCATTCAATAGAAGTAGATAAATTTAAT

[0048] 2RPA Condition Parameter Optimization

[0049] 2.1 RPA temperature parameter optimization

[0050] As shown in Figure 2 , M is DL 2000 Maker, the nucleic acid concentration of Yunnan Ips typographus is 50.0 ng / μL, 1-5 are positive controls with reaction temperatures of 33 ℃, 35 ℃, 37 ℃, 39 ℃ and 41 ℃ respectively, and N is sterile enzyme-free water. The results of agarose gel electrophoresis show that there are bright bands in 1-5, which is convenient for testing, and the subsequent RPA amplification is set to 37 ℃.

[0051] 2.2 RPA time parameter optimization

[0052] As shown in Figure 3 , the nucleic acid concentration of Yunnan Ips typographus is 50.0 ng / μL, 1-5 are positive controls with reaction times of 5 min, 10 min, 15 min, 20 min and 25 min respectively, and N is sterile enzyme-free water. The results of agarose gel electrophoresis show that there are no bands in 1 and N, and there are significant amplification phenomena in 2-5. In order to meet the requirements of rapid detection, 20 min is selected as the RPA amplification time in the subsequent test.

[0053] 3 RPA sensitivity detection

[0054] As shown in Figure 4 , M is DL 2000 Maker, and the nucleic acid concentrations of Yunnan Ips typographus in 1-5 are 1.0×10 2 , 1.0×10 1 , 1.0, 1.0×10 -1 , 1.0×10 -2 , 1.0×10 -3 , respectively, and N is sterile enzyme-free water. The results of agarose gel electrophoresis show that there are bands in 1-3, and there are no bands in 3-6 and N. The minimum sensitivity of this system is 1.0 ng / μL.

[0055] 4 CRISPR detection

[0056] 4.1 RPA / CRISPR-Cas12a detection system detects primer specificity

[0057] As shown in Figure 5 , 6As shown in the CRISPR detection primer specificity results, 1-5 are positive control Yunnan bark beetle and negative controls horizontal pit bark beetle, short hair bark beetle, and two four-eyed bark beetles, and N is sterile enzyme-free water. The fluorescence detection chart results show that tube 1 has fluorescence, tubes 2-5 and tube N have no fluorescence, verifying that the primer has good specificity.

[0058] 4.2 RPA / CRISPR-Cas12a detection system reaction parameter optimization

[0059] As shown in the CRISPR detection primer specificity results, 1-5 are positive control Yunnan bark beetle and negative controls horizontal pit bark beetle, short hair bark beetle, and two four-eyed bark beetles, and N is sterile enzyme-free water. The fluorescence detection chart results show that tube 1 has fluorescence, tubes 2-5 and tube N have no fluorescence, verifying that the primer has good specificity. Figure 7 As shown in the CRISPR detection primer specificity results, 1-5 are positive control Yunnan bark beetle and negative controls horizontal pit bark beetle, short hair bark beetle, and two four-eyed bark beetles, and N is sterile enzyme-free water. The fluorescence detection chart results show that tube 1 has fluorescence, tubes 2-5 and tube N have no fluorescence, verifying that the primer has good specificity.

[0060] 4.3 RPA / CRISPR-Cas12a detection system sensitivity detection

[0061] As shown in the CRISPR detection primer specificity results, 1-5 are positive control Yunnan bark beetle and negative controls horizontal pit bark beetle, short hair bark beetle, and two four-eyed bark beetles, and N is sterile enzyme-free water. The fluorescence detection chart results show that tube 1 has fluorescence, tubes 2-5 and tube N have no fluorescence, verifying that the primer has good specificity. Figure 8 、 9 As shown in the CRISPR detection primer specificity results, 1-5 are positive control Yunnan bark beetle and negative controls horizontal pit bark beetle, short hair bark beetle, and two four-eyed bark beetles, and N is sterile enzyme-free water. The fluorescence detection chart results show that tube 1 has fluorescence, tubes 2-5 and tube N have no fluorescence, verifying that the primer has good specificity. 2 、1.0×10 1 、1.0 、1.0×10 -1 、1.0×10 -2 、1.0×10 -3 ng / µL, and N is sterile enzyme-free water. The fluorescence detection chart results show that tubes 1-4 have fluorescence, tubes 5-6 and tube N have no fluorescence, so the minimum detection limit of the system sensitivity is 1.0 ng / µL.

[0062] Finally, it should be noted that the above examples are only used to illustrate the technical solutions of the present application, and are not intended to limit the scope of protection of the present application. Although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present application can be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present application.

Claims

1. A molecular detection kit of RPA-Cas12a of Hylastes parallelus, characterized in that, The kit contains RPA amplification primers, Cas12a, crRNA and ssDNA, the sequence of the RPA amplification primer is TTATTTTACCATAGGAGGCTTAACGGGAG and TAATCATTCAATAGAAGTAGATAAATTTAAT; The sequence of the crRNA is UAAUUUCUACUAAGUGUAGAUCUCCUACAAAUAUAGAUAUAA, the Cas12a protein is LbCas12a; and the ssDNA is 5'-FAM-TTATT-BHQ1-3'.

2. A molecular detection method of Hylastes parallelus, characterized by, The kit comprises the following steps: (1) extracting genomic DNA of a sample to be detected; (2) amplifying a target gene by using RPA amplification primers; the sequence of the RPA amplification primer is TTATTTTACCATAGGAGGCTTAACGGGAG and TAATCATTCAATAGAAGTAGATAAATTTAAT; (3) constructing a detection system by using the RPA amplification product, Cas12a protein, crRNA and ssDNA, obtaining a reaction product after reaction, and identifying by fluorescence detection method; if fluorescence phenomenon occurs, it is Yunnan pinhole bark beetle; The sequence of the crRNA is UAAUUUCUACUAAGUGUAGAUCUCCUACAAAUAUAGAUAUAA, the Cas12a protein is LbCas12a; and the ssDNA is 5'-FAM-TTATT-BHQ1-3'.

3. The detection method according to claim 2, characterized in that, In step (2), the RPA amplification reaction condition is 37℃, 20min; The detection method according to claim 2, characterized in that, In step (3), the reaction condition is 37℃, 15min.

Images