Application of GUSB Gene SNP Molecular Marker in Evaluation of Reproductive Traits of Young Cows
Genome-wide association analysis of GUSB gene SNP molecular markers identified SNP loci associated with reproductive traits in young heifers, solving the problem of slow progress in genetic improvement of reproductive traits in Holstein young heifers and achieving efficient assessment of reproductive traits and improved economic benefits.
Patent Information
- Application Number
- CN202511612320.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-06
- Publication Date
- 2026-02-03
- Estimated Expiration
- 2045-11-06
AI Technical Summary
In the current technology, the genetic improvement of reproductive traits in Holstein young heifers is slow, traditional breeding methods are inefficient, affecting the efficiency and economic benefits of dairy cattle breeding, and research data is limited, making it difficult to assess early and improve selection accuracy.
Using GUSB gene SNP molecular markers, genome-wide association analysis (GWAS) was used to identify SNP loci associated with reproductive traits in young cows. Genotyping was performed using the GGP Bovine 100K SNP chip, and combined with genotyping methods, the reproductive traits of young cows were evaluated, and individuals with favorable genotypes were selected for breeding.
It improved the efficiency of genetic improvement of reproductive traits in young cows, reduced feeding costs before first calving, optimized reproductive efficiency, and improved lifetime productivity.
Smart Images

Figure CN121065364B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of livestock biobreeding technology, specifically to the application of GUSB gene SNP molecular markers in evaluating reproductive traits in young cows. Background Technology
[0002] Reproductive traits in dairy cows are among the key functional traits affecting farm economics, and their efficiency directly impacts calving intervals, lactation cycles, and lifetime productivity. However, there is a significant genetic antagonism between reproductive traits and productive traits (such as milk yield) (genetic correlation r≈-0.3), making genetic improvement of reproductive traits a major challenge in modern dairy cow breeding. Due to the generally low heritability of reproductive traits (h²≈0.05~0.15), traditional breeding methods have progressed slowly, but their significant impact on farm economics (such as reducing non-pregnant periods and lowering culling rates) and environmental sustainability (such as optimizing feed utilization) makes them a priority target for genomic selection (GS) and molecular breeding.
[0003] Currently, most research on reproductive traits in dairy cattle in my country is based on mixed populations (young cattle + multiparous cattle). However, studies have shown that there are differences in the genetic regulation of reproductive performance between the two groups, and the correlation is only moderate (r≈0.4~0.6). Therefore, in breeding practice, reproductive traits in young cattle (such as age at first mating and conception rate at first mating) can serve as ideal indicators for early selection. On the one hand, this allows for earlier genetic assessment, shortens generation intervals, and accelerates genetic progress; on the other hand, it can improve the accuracy of selection and reduce the interference of environmental factors on multiparous cattle; finally, it can yield better economic returns. Optimizing the reproductive efficiency of young cattle can reduce feeding costs before first calving and improve lifetime production efficiency.
[0004] With the development of molecular biology, genome-wide SNPs (Single-Number Nuclei) molecular markers have been increasingly applied to the selective breeding of Holstein cattle. Genome-wide association studies (GWAS) and genomic selection can be performed using genome-wide SNPs. GWAS involves scanning the entire genome of an experimental population using high-density molecular markers (currently mostly SNPs) selected across the entire genome. Statistical methods are then used to analyze the association between the genotypes of these molecular markers and phenotypic traits, ultimately identifying relevant molecular markers and candidate genes that influence phenotypic traits.
[0005] Currently, there is relatively little research on key reproductive traits and gene screening in young dairy cows, and the available data is very limited. This has affected the genetic basis research on reproductive traits in Holstein young heifers, which is not conducive to rapidly improving the efficiency and economic benefits of dairy cow breeding. Summary of the Invention
[0006] The purpose of this invention is to provide the application of GUSB gene SNP molecular markers in evaluating the reproductive traits of young cows, so as to optimize the reproductive efficiency of young cows, reduce the feeding cost before first calving, and improve lifetime production benefits.
[0007] The technical solution of this invention is described in detail below:
[0008] This invention provides the application of the GUSB gene SNP molecular marker in evaluating the reproductive traits of young cows. The SNP molecular marker is base G at position 267 of the sequence shown in SEQ ID NO:1, or base A at position 267 of the sequence shown in SEQ ID NO:2. Young cows with the SNP molecular marker genotype AA have significantly better reproductive traits than individuals with the genotype GG. The young cows are 18-24 months old cows that have not yet calved.
[0009] The location of the molecular marker in the chromosome is: chr25:g .27914690G>A, GUSB gene reference sequence NCBI Gene ID: 515687.
[0010] Optionally or preferably, the young cow is a Holstein cow.
[0011] Optionally or preferably, the reproductive traits include age at first mating, age at first calving, number of repeated matings, interval between the first and last matings, and ease of calving.
[0012] Secondly, this invention also provides the application of a reagent for detecting the SNP molecular marker of the GUSB gene in assessing the reproductive traits of young cows, wherein the SNP molecular marker is base G at position 267 of the sequence shown in SEQ ID NO:1, or base A at position 267 of the sequence shown in SEQ ID NO:2; young cows with the SNP molecular marker genotype AA have significantly better reproductive traits than individuals with the genotype GG; the young cows are cows aged 18-24 months that have not yet calved.
[0013] Optionally or preferably, the reagent includes primer pairs, the nucleotide sequences of which are shown in SEQ ID NO:3~4.
[0014] Compared with the prior art, the present invention has the following beneficial effects:
[0015] This invention utilizes the GGP Bovine 100K SNP chip to analyze the genome of young heifers, and employs a genotyping method to fill the 100K chip to the whole-genome sequence data level. Subsequently, based on genome-wide association analysis (GWAS), the genetic regulatory mechanisms of key reproductive traits such as age at first mating, age at first calving, gestation length, first-to-last mating interval, number of repeated matings, and return to estrus after first mating were systematically investigated. Ultimately, a SNP locus associated with reproductive traits in young heifers was identified, located on the GUSB gene. By identifying the genotype of this SNP locus in young heifers, their reproductive traits can be assessed, and individuals with favorable genotypes can be selected for breeding. This increases the frequency of the dominant GUSB gene genotype in the dairy herd, reduces farm feed costs, and improves farming efficiency, providing a new method for the genetic improvement of reproductive traits in young heifers. Attached Figure Description
[0016] Figure 1 This shows the distribution of SNP sites on the chromosome in Example 1.
[0017] Figure 2 Manhattan plot and QQ-plot of GWAS results for the first mating age of Holstein young heifers in Example 1.
[0018] Figure 3 Manhattan plot and QQ-plot of GWAS results for the first calving age of Holstein young heifers in Example 1.
[0019] Figure 4 Manhattan plot and QQ-plot of the GWAS results of repeated matings of Holstein young cows in Example 1.
[0020] Figure 5 Manhattan plot and QQ-plot of GWAS results for the first and last mating intervals of Holstein young cows in Example 1.
[0021] Figure 6 Manhattan plot and QQ-plot of GWAS results for conception rate of young Holstein cows in Example 1.
[0022] Figure 7 The images show the Manhattan plot and QQ-plot of the GWAS results for gestation length in Holstein heifers in Example 1.
[0023] Figure 8 Manhattan plot and QQ-plot of GWAS results for calving difficulty in Holstein heifers in Example 1.
[0024] Figure 9 This is an agarose gel electrophoresis image of the DNA amplification product from a young Holstein cow in Example 1.
[0025] Figure 10 This is a peak diagram of the molecular marker position at the chr25:g.27914690G>A site in the first exon region of the GUSB gene in Example 1. Detailed Implementation
[0026] To enable those skilled in the art to better understand the present application, the present application will be clearly and completely described below with reference to embodiments and accompanying drawings. Obviously, the described embodiments are only some embodiments of the present application, and not all embodiments. Based on the embodiments of the present application, all other embodiments obtained by those of ordinary skill in the art without creative effort should fall within the scope of protection of the present application. Unless otherwise specified, the instruments and reagents used in the embodiments are all from commercial channels.
[0027] Example 1: Screening and identification of SNP molecular markers related to reproductive traits in young cows
[0028] 1. Blood samples were collected from 3,172 healthy Holstein heifers (18-24 months old and never calved) from four large-scale ranches in Jiangsu Province for whole-genome SNP variation detection and analysis.
[0029] 2. The collected blood was extracted and its quality was tested using a DNA extraction kit.
[0030] DNA extraction was performed using the Novizan DNA Extraction Kit (FastPure Cell / Tissue DNA Isolation MiniKit, DC102-01). OD values and concentrations were measured according to the instructions, and quality was assessed by electrophoresis. The OD260 / OD280 ratio should be between 1.8 and 2.0; for a sample volume of 2 μl, the sample concentration must be ≥50 ng / μl. All DNA quality test results were satisfactory.
[0031] 3. Resequencing of fragments that have passed quality control.
[0032] After passing the DNA quality control test, the GGP Bovine 100K SNP chip was used for detection. The valid data obtained after deleting SNP sites with no detection results were used for subsequent whole-genome SNP genotype quality control detection.
[0033] 4. SNP genotyping quality control
[0034] The SNP genotyping quality control process deletes individuals or loci that meet the following criteria: loci with a genotyping deletion count >10%, loci with a minimum allele frequency below 0.01, and loci with a Hardy-Weinberg test p-value <0.000001. Data will be deleted if any of the above three conditions are met.
[0035] 5. Genotype filling
[0036] Based on resequencing data from over 3,000 Holstein heifers collected previously, the Hidden Markov Model (HMM) algorithm was used, and the BEAGLE software was employed to sequentially fill the 100K microarray data to the whole genome sequence data level according to chromosomes (see [link to previous section]). Figure 1 ).
[0037] 6. Phenotypic Statistics and Calculations
[0038] Record information such as ear tag, sample number, date of birth, date of mating, inseminator, date of calving, parity, and whether the cow is pregnant for each cow. Calculate reproductive traits such as age at first mating, age at first calving, number of repeated matings, interval between first and last matings, conception rate at first mating, gestation period length, and ease of calving (Table 1).
[0039] Table 1. Statistical analysis of reproductive traits in Holstein heifers
[0040]
[0041] Note: Calving difficulty refers to the difficulty of calving in a cow at a specified parity. The higher the score, the more difficult calving is. The same meaning is given for "calving difficulty" in Tables 2 and 3 below.
[0042] 7. Genome-wide association analysis
[0043] A GWAS analysis was conducted on the relationship between genome-wide SNP genotypes and farrowing phenotypic traits in Holstein heifers, using the GWAS model: y = Xb + SNP. i +Zu+e; where y represents the phenotypic value of reproductive traits in Holstein heifers; X represents the fixed effects matrix, b represents the fixed effects (including pasture, date of birth, date of mating, and inseminator, etc.), and SNP i Let represent the i-th SNP value, u represent the additive genetic effect, and X and Z are the corresponding matrices; e represents the random residual, and both u and e follow a normal distribution.
[0044] 8. Identification of significant SNPs
[0045] The significance level P-value of the differences in the reproductive traits of Holstein heifers was adjusted using the Bonferroni method. When using the Bonferroni method to control multiple tests to adjust the GWAS results, the significance threshold was set at 8 × 10⁻⁶. -8 The results of GWAS revealed key SNP loci that are significantly associated with the genetic effects of reproductive traits in Holstein young heifers.
[0046] Simultaneously, use the CMplot package in R software to draw Manhattan plots and QQ plots (see [link]). Figures 2-8 SNPs above the threshold line on the Manhattan plot are SNPs that are significantly associated with reproductive traits in Holstein heifers. Association analysis results showed that the SNP site chr25:g .27914690G>A located in the first exon of the GUSB gene was significantly associated with multiple traits. The relationship between the genotype of the chr25:g .27914690G>A site and the reproductive traits of heifers in the experimental population is shown in Table 2.
[0047] Table 2. Relationship between genotype and reproductive traits at the chr25:g.27914690G>A locus in the experimental population of young cows.
[0048]
[0049] Genotyping of the GUSB gene SNP locus in Chinese Holstein heifers, and association analysis between this genotype and reproductive traits such as age at first mating, age at first calving, number of repeated matings, first-to-last mating interval, first-to-last conception rate, gestation length, and calving difficulty, showed that individuals with the AA genotype had significantly higher scores on age at first mating, age at first calving, number of repeated matings, and first-to-last mating interval than those with the GG genotype (P<0.05), while calving difficulty was significantly lower. Generally, smaller age at first mating, age at first calving, number of repeated matings, and first-to-last mating interval correlated with better reproductive performance in heifers, while higher calving difficulty scores indicated more difficult calving. The identification of this polymorphic locus provides valuable scientific evidence for marker-assisted selection of reproductive traits in Chinese Holstein dairy cows.
[0050] Example 2: Validation of the association between the GUSB gene chr25:g.27914690G>A site and reproductive traits in Holstein young heifers.
[0051] The SNP locus (chr25:g.27914690G>A) in exon 1 of the GUSB gene was genotyped using Sanger sequencing in a validation cohort of 3439 Holstein heifers.
[0052] 1. Blood sample collection from the tail vein of cattle
[0053] Aseptically collect blood samples from the tail vein of Holstein cattle, place them in vacuum blood collection tubes containing EDTA anticoagulant, and store them at -20°C for later use.
[0054] 2. Genomic DNA extraction
[0055] Take 500 μL of whole blood sample, add an equal volume of STE lysis buffer, then add 50 μL of 10% SDS and 5 μL of proteinase K (20 mg / mL), and lyse at 56°C for 3 h until the solution is clear. Add an equal volume of saturated phenol (250 μL) and chloroform / isoamyl alcohol (24:1, 250 μL), mix gently for 20 min, and centrifuge at 12000 rpm for 10 min; repeat the above steps with the supernatant until no protein residue remains at the interface. Add an equal volume of chloroform / isoamyl alcohol again for extraction, centrifuge at 12000 rpm for 10 min, collect the supernatant, add 1 / 10 volume of 3 M NaAc (pH 5.2) and 2 volumes of pre-chilled anhydrous ethanol, mix well, incubate at -20°C for 20 min, and centrifuge at 12500 rpm for 20 min to collect the DNA precipitate. Discard the supernatant, wash the precipitate with 70% ethanol, air-dry it, dissolve it in 20 μL TE buffer (containing RNase A), incubate at 37°C for 30 min, and store at 4°C. DNA concentration and purity were determined by 1% agarose gel electrophoresis and UV spectrophotometry.
[0056] 3. Primer design and synthesis
[0057] Based on the reference sequence of the GUSB gene (NCBI Gene ID: 515687) in the NCBI database, the following specific amplification primers were designed and synthesized to amplify gene fragments containing target SNP sites.
[0058] Forward primer F: 5′-TGGCAACCCACTCTGGTATTC-3′ (SEQ ID NO:3),
[0059] Reverse primer R: 5′-TCCTCCAGATCCGAGGGAAG-3′ (SEQ ID NO:4).
[0060] 4. PCR amplification and genotyping
[0061] PCR amplification was performed using the extracted genomic DNA as a template. The total reaction volume was 25 μL: 1 μL template DNA, 2.5 μL 10× Buffer (containing 15 mmol / L MgCl2), 2 μL dNTP (2.5 mmol / L), 0.5 μL each of forward and reverse primers (12.5 pmol / μL), 0.5 μL Taq DNA polymerase (2.5 U / μL), and ultrapure water was added to a final volume of 25 μL.
[0062] Amplification program: 95℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 45 s, for a total of 35 cycles; final extension at 72℃ for 10 min. Agarose gel electrophoresis results of the DNA amplification products are shown below.Figure 9 After purification, the amplified products were genotyped using Sanger sequencing. The sequencing results are shown below. Figure 10 .
[0063] The amplified product sequence is as follows:
[0064] TGGCAACCCACTCTGGTATTCTGGCCTGGAGAATCCCATAGATAGAGGAGTCTGATGGGCTACAGTCCATAGGGTCCCAGAGTCAGACATGACTGAGCGACAGCATGCACGCACAGGCTGCCGAACTGGGGGT GCCGCGCAGTGCAGGCAGCGGGCACTCACACCAGCACGATGCCCACCACCAGGGCTCTCGTCGATGACCACGATCCCGTAGCGGTCACAGAGCTGCAGCACCTCCTCTGAATAGGGGTAGTGGCTAGTGCGGAA G GCGTTGACGCCCAGCCAGCGAAGCAGGTTGAAGTCCTTCACCAGCAGCGGCCAGTCAAAGCCCTTCCCTCGGATCTGGAGGA (The nucleotide sequence with an A base at position 267 in the sequence shown in SEQ ID NO:1 is an SNP site. The nucleotide sequence with an A base at position 267 is shown in SEQ ID NO:2).
[0065] The system compared the performance of individuals with different genotypes on multiple reproductive traits, including age at first mating, age at first calving, number of repeated matings, interval between first and last matings, conception rate at first mating, gestation period length, and ease of calving. The results are shown in Table 3.
[0066] Table 3. Relationship between genotype and reproductive traits at the chr25:g.27914690G>A locus in young cows in the validation population.
[0067]
[0068] The test results showed that three genotypes (AA, AG, and GG) existed in the tested Holstein young heifer population. Population analysis indicated that individuals with the AA genotype had significantly higher ages at first mating, ages at first calving, number of repeated matings, interval between first and last matings, and conception rate at first mating than individuals with the GG genotype.
[0069] This article uses specific examples to illustrate the inventive concept in detail. The description of the above embodiments is only for the purpose of helping to understand the core idea of the present invention. It should be noted that any obvious modifications, equivalent substitutions or other improvements made by those skilled in the art without departing from the inventive concept should be included within the protection scope of the present invention.
Claims
1. The application of a reagent for detecting GUSB gene SNP molecular markers in assessing reproductive traits in young cows, characterized in that... The SNP molecular marker is base G at position 267 of the sequence shown in SEQ ID NO:1, or base A at position 267 of the sequence shown in SEQ ID NO:2; the reproductive traits of young cows with the SNP molecular marker genotype AA are significantly better than those of individuals with the genotype GG; the young cows are cows aged 18-24 months that have not yet given birth. The young cow in question is a Holstein cow; The reproductive traits are the age at first mating, the age at first calving, the number of repeated matings, and the interval between the first and last matings.
2. The application according to claim 1, characterized in that, The reagents include primer pairs, the nucleotide sequences of which are shown in SEQ ID NO:3~4.
Citation Information
Patent Citations
SNP molecular marker related to reproductive characters of Chinese Holstein cow and applications of SNP molecular marker
CN107267605A
Application of SNP molecular marker in identification of high-reproductive-performance dairy cows and assisted breeding
CN113684206A