Molecular marker closely linked with soybean plant height QTL qPH6 and application thereof
By identifying and developing QTL sites qPH6 and PARMS markers at positions 15,149,720 of chromosome 6 in soybean, the problems of stability and efficient screening of plant height traits in soybean breeding were solved, thereby increasing soybean yield.
Patent Information
- Application Number
- CN202511228890.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-29
- Publication Date
- 2025-12-05
AI Technical Summary
Existing technologies make it difficult to effectively utilize stable and widely applicable plant height QTL sites in soybean breeding, thus limiting the improvement of soybean yield.
By constructing an associated population and using genome-wide association analysis, the QTL site qPH6 at bases 15,149,720 on chromosome 6 was identified, and a PARMS marker closely linked to it was developed for soybean plant height screening breeding.
We achieved stable interpretation of 3.29%–6.30% of the plant height phenotypic variation under different environments, and developed a simple and low-cost high-throughput screening method to improve the efficiency of soybean plant height breeding.
Smart Images
Figure SMS_1 
Figure HDA0005573341090000011 
Figure HDA0005573341090000012
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of molecular biology and genetic breeding, and particularly relates to a molecular marker closely linked to a soybean plant height QTL qPH6 and application thereof. BACKGROUND
[0002] Soybean (Glycine max L.) is an important food and oil crop, and also provides high-quality plant protein for human food and animal feed. Therefore, it is urgent to increase the yield of soybean. Ideal plant type breeding is an important direction of soybean breeding, and breeding soybean varieties with ideal plant type is beneficial to improve the yield of soybean. As one of the traits of plant type, excessive plant height can cause lodging and other problems, thereby leading to a decrease in the yield of soybean, and appropriate plant height can improve the yield of soybean.
[0003] In recent years, more and more reports on the genetic location of the plant height trait of soybean have been published. Zheng Haiyang et al. constructed a CSSL population by using SN14 and wild soybean resource ZYD00006 as parents, and detected 12 QTL sites related to the plant height of soybean by RSTEP-LRT method. Wang et al. constructed a recombinant inbred line population by using Dongnong L13 and He'nan 60 as parents, and located 33 QTLs of plant height. With the popularization and cost reduction of re-sequencing technology, locating single base polymorphism sites (SNP) significantly related to the plant height of soybean based on genome-wide association analysis (GWAS) and developing practical molecular markers have become a key direction to improve the breeding efficiency of soybean plant height. In addition, researchers have cloned and verified the functions of more than 10 soybean plant height-related genes such as Tof12, GmGBP1, GmAP1b, GmGA2ox2, rin1, GmGA3ox and PH13. However, except for rin1, most of the gene sites have small effects or only show stability in a specific genetic background, and are difficult to be widely applied in molecular marker-assisted selection (MAS). It is of great significance to promote the ideal plant type breeding of soybean to excavate plant height QTL sites with stable genetic background, significant effect value and strong universality and develop matching high-throughput molecular markers.
[0004] Based on the association population constructed by 768 domestic and foreign soybean core germplasm resources, combined with the population genotyping data and the plant height phenotype data at two years and two points, a major QTL site qPH6 for regulating the variation of the plant height of soybean is identified by using genome-wide association analysis, and a PARMS marker closely linked to the QTL site is developed, which can be used for assisting the ideal plant type breeding of soybean. SUMMARY
[0005] The application aims to provide the application of a reagent for detecting the 15th, 149th, 720th base of the 6th chromosome of soybean in the screening breeding of the plant height of soybean.
[0006] Another object of the present application is to provide the use of a reagent for detecting base 15,149,720 of chromosome 6 of soybean in the preparation of a soybean plant height screening kit.
[0007] A final object of the present application is to provide a soybean plant height screening breeding method.
[0008] In order to achieve the above-mentioned objects, the present application adopts the following technical measures:
[0009] Obtaining a molecular marker closely linked to the soybean plant height QTL qPH6:
[0010] (1) Population construction and phenotype identification: 768 soybean materials with extensive genetic diversity from 23 provinces were selected as the core resources, and a soybean association population was constructed therefrom. In 2023, Chongqing Academy of Agricultural Sciences Baishiyi Base (2023CQ) and in 2024, Hefei Experimental Base of Anhui Academy of Agricultural Sciences (2024HF) were planted, and a randomized block design was used in the field test, and three repetitions were set; 2-row zone planting, each family planting one row with 20 plants, row length 2m, row spacing 0.5m. After maturation, 10 plants of each material were harvested for plant height, and the average value of 3 repetitions in each environment was taken as the phenotype value of the material in the environment.
[0011] (2) Genotype analysis: using Huada T7 sequencing platform, whole genome resequencing was performed on 768 materials of the association population, genotyping was performed on 768 materials using resequencing technology, average sequencing depth ~ 20x, filtering SNP sites with deletion rate > 10% and minimum allele frequency < 0.05, finally 6,339,330 high-quality SNPs were retained for whole genome association analysis.
[0012] (3) Whole genome association analysis: mixed linear model (MLM) in GEMMAX software was used for association analysis, and the significance threshold was set as P≤1 / n (n is the number of populations, 768). A stable associated QTL site qPH6 was found on chromosome 6, which was significantly associated in both 2023CQ and 2024HF environments, and could explain 3.29%-6.30% of the phenotypic variation rate. The peak SNP marker was named S06_15149720, located at base 15149720 of chromosome 6 of Glycine max v2.1 reference genome, and the allele was A / T. In 2023CQ and 2024HF environments, the average plant height of materials containing high plant height alleles was 111.01%-152.71% higher than that of materials containing low plant height alleles.
[0013] (4) PARMS marker development: specific primers were designed according to the sequence upstream and downstream of S06_15149720 locus to construct a PARMS detection system. The primer sequences are as follows:
[0014] PARMS6: TTTTAAATTTTAATTCCTATT,
[0015] PARMS6P1: GAAGGTGACCAAGTTCATGCTACTAATTTTTTTTATCTCAA, and PARMS6P2: GAAGGTCGGAGTCAACGGATTACTAATTTTTTTTATCTCAT.
[0016] The protection scope of the present application includes:
[0017] The reagent for detecting the genotype of the 15,149,720th base on chromosome 6 of soybean is applied in the breeding of soybean plant height.
[0018] The reagent for detecting the 15,149,720th base on chromosome 6 of soybean is applied in the preparation of a soybean plant height screening kit.
[0019] In the above application, if the 15,149,720th base on chromosome 6 of soybean is A, it is determined that the soybean is a dwarf plant height material.
[0020] In the above application, if the 15,149,720th base on chromosome 6 of soybean is T, it is determined that the soybean is a high plant height material.
[0021] In the above application, the reagent is preferably a primer.
[0022] In the above application, the primer is preferably a PARMS detection primer, and more preferably the primer provided by the present application: PARMS6: TTTTAAATTTTAATTCCTATT, PARMS6P1: GAAGGTGACCAAGTTCATGCTACTAATTTTTTTTATCTCAA, and PARMS6P2: GAAGGTCGGAGTCAACGGATTACTAATTTTTTTTATCTCAT.
[0023] A soybean plant height screening breeding method comprises detecting the 15,149,720th base on chromosome 6 of soybean by using a conventional scheme in the art, which includes but is not limited to: sequencing method, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method or mass spectrometry method.
[0024] The version number of the soybean reference genome used in the present application is Glycine_max_v2.1, and the website is https: / / ensembl.gramene.org / Glycine_max / .
[0025] Compared with the prior art, the present application has the following advantages:
[0026] (1) The QTL qPH6 identified in the present application is stably expressed under two environmental conditions, and can explain 3.29% to 6.30% of the phenotypic variation of plant height, which has high breeding application value.
[0027] (2) The developed PARMS marker is simple in operation, low in cost, clear in typing, and suitable for high-throughput screening of large-scale breeding populations. BRIEF DESCRIPTION OF DRAWINGS
[0028] Figure 1 Figure 8 is a frequency distribution diagram of plant height of 768 soybean materials under two environmental conditions.
[0029] Figure 2 Figure 9 is a Manhattan plot of the results of whole genome association analysis of soybean plant height.
[0030] Figure 3 Figure 10 is a comparison of plant height of different genotypes (A vs T) of qPH6 under two environmental conditions. DETAILED DESCRIPTION
[0031] The technical solutions described in the present application are conventional technologies in the art if not specifically stated; the reagents or materials described are from commercial channels if not specifically stated. The version number of the soybean reference genome used in the present application is Glycine_max_v2.1, and the website is https: / / ensembl.gramene.org / Glycine_max / .
[0032] Example 1:
[0033] SNP molecular markers significantly associated with soybean plant height QTL qPH6:
[0034] Test materials: 768 materials with wide genetic diversity from 23 provinces were used as a soybean association population constructed by a core resource.
[0035] (1) Soybean population plant height identification: In 2023, Chongqing Academy of Agricultural Sciences Baisiji base (2023CQ) and in 2024, Anhui Academy of Agricultural Sciences Hefei test base (2024HF) were planted, and field tests were designed by random block design, and 3 times of repetition were set; 2 rows of planting were used, and 20 plants were planted in each row, with a row length of 2 m and a row spacing of 0.5 m. After maturation, 10 plants of each material were harvested, and the average value of 3 repetitions in each environment was taken as the phenotype value of the material in the environment. Figure 1
[0036] (2) Genotype analysis: The 768 materials of the association population were subjected to whole genome resequencing by using Huada T7 sequencing platform, the 768 materials were genotyped by using resequencing technology, the average sequencing depth was ~ 20x, the SNP sites with a missing rate > 10% and a minimum allele frequency < 0.05 were filtered, and finally 6,339,330 high-quality SNPs were reserved for whole genome association analysis.
[0037] (3) Whole genome association analysis: Combined with population genotype data and phenotype data, the mixed linear model (MLM) in GEMMAX software was used for association analysis, and the significance threshold was set as P≤1 / n (n is the number of population, 768).
[0038] (4) Obtaining qPH6 and its significantly associated SNP marker: The association analysis results show that a stable associated QTL site qPH6 is found on chromosome 6, which is significantly associated in 2 environments, and can explain the phenotypic variation rate of 3.29%-6.30% (Table 1). The peak SNP marker is named S06_15149720, which is located at the 15149720th base of chromosome 6 of the soybean Glycine max_v2.1 reference genome, the allele is A / T, and the flanking sequence is: 5'-GTTTGAGTTCTATTTTACAATAACTAATTTTTTTTATCTCA
A / T
[0039] Table 1 qPH6 and its associated SNP marker
[0040]
[0041] Example 2:
[0042] Development of a PARMS marker closely linked to soybean plant height:
[0043] According to the principle of primer design, the sequence of the detection primer of the PARMS marker is obtained as follows based on the nucleotide sequences of the front and rear positions of the peak SNP marker S06_15149720 significantly associated with qPH6:
[0044] PARMS6: TTTTAAATTTTAATTCCTATT,
[0045] PARMS6P1: ACTAATTTTTTTTATCTCAA, GAAGGTGACCAAGTTCATGCT GAAGGTCG PARMS6P2: ACTAATTTTTTTTATCTCAT. GAGTCAACGGATT The underlined part is a fluorescent linker.
[0046] The method for detecting the genotype of the soybean qPH6 locus of the to-be-tested soybean using the above PARMS primer set is as follows:
[0047] (1) Extract the genomic DNA of the to-be-tested soybean.
[0048] (2) Prepare the reaction system. The reaction system is 5 μL, including 2.5 μL 2xPARMS PCR reaction mix (a product of Wuhan Jingpeibiological Technology Co., Ltd.), primer PARMS6, primer PARMS6P1, primer PARMS6P2 aqueous solution, DNA and water. In the reaction system, the concentrations of the primer PARMS6P1 and the primer PARMS10P2 are both 150 nM, and the concentration of the primer PARMS6 is 400 nM.
[0049] (3) Add 5 μL of paraffin oil (to prevent sample evaporation) to the reaction system, and then perform PCR amplification.
[0050] The reaction program is as follows: 95 ℃ for 15 min; 95 ℃ for 20 s, 65 ℃ for 1 min, with a decrease of 0.8 ℃ for each cycle until 57 ℃, for 10 cycles; 95 ℃ for 20 s, 57 ℃ for 1 min, for 32 cycles.
[0051] (4) After step (3) is completed, perform signal reading on the TECAN Infinite M1000, and then make the following judgments: if blue is displayed, the corresponding soybean is or is suspected to be a dwarf soybean; if green is displayed, the corresponding soybean is or is suspected to be a tall soybean.
[0052] Using the above primer, the sequence amplified in the tall soybean material Hunan Huaminglou Heidou (a Heidou soybean collected from Huaminglou Town, Ningxiang City, Hunan, which is one of the 768 materials in Example 1) is as follows:
[0053]
[0054] ACTAATTTTTTTTATCTCA T ATTTAATTAAAATAGGAATTAAATTTAAAA
[0055] The sequence of the amplification product of the dwarf high material Changjiang Chun 2 is:
[0056] ACTAATTTTTTTTATCTCA A ATTTAATTAAAATAGGAATTAAATTTAAAA.
[0057] Example 3
[0058] Universality of the PARMS marker in the selection of soybean plant height trait
[0059] The PARMS primer set designed in Example 2 was used to detect the genotype and genetic effect of the soybean qPH6 locus. The soybeans to be tested were 83 local soybean varieties collected by the applicant in the Yangtze River Basin. According to the method used in Example 1, field identification was carried out in the experimental base of the Agricultural Science Institute of Gucheng County, Xiangyang City, Hubei Province in 2024, and the plant height was investigated.
[0060] The results showed that among the above 83 soybean local varieties, there were 71 materials with genotype AA, the average plant height was 76.05 cm; 12 materials with genotype TT, the average plant height was 136.57 cm. The difference in plant height between AA and TT genotypes reached a very significant level (P-value = 1.03e-12). The results showed that the genotype of qPH6 locus in 83 soybean local varieties in the Yangtze River Basin was separated, and had a stable and reliable genetic effect.
[0061] The above results show that the prepared PARMS molecular marker qPH6 has a greater genetic effect on the plant height of soybean and has a good screening effect.
Claims
1. Use of a reagent for detecting base 15,149,720 of chromosome 6 of soybean in soybean plant height screening breeding.
2. Use of a reagent for detecting base 15,149,720 of chromosome 6 of soybean in preparation of a soybean plant height screening kit.
3. Use according to claim 1 or 2, characterized in that: If the reagent detects that the base 15,149,720 of chromosome 6 of soybean is A, it is determined that the soybean is a dwarf plant height material.
4. Use according to claim 1 or 2, characterized in that: If the reagent detects that the base 15,149,720 of chromosome 6 of soybean is T, it is determined that the soybean is a high plant height material.
5. Use according to claim 1 or 2, characterized in that: The reagent is a primer.
6. Use according to claim 5, characterized in that: The primer is PARMS6: TTTTAAATTTTAATTCCTATT, PARMS6P1: GAAGGTGACCAAGTTCATGCTACTAATTTTTTTTATCTCAA, and PARMS6P2: GAAGGTCGGAGTCAACGGATTACTAATTTTTTTTATCTCAT.
7. A soybean plant height screening breeding method comprising detecting the genotype of base 15,149,720 of chromosome 6 of soybean, the method comprising sequencing, TaqMan probe, AS-PCR, molecular beacon, high-resolution melting curve, CAPS, SNaPshot, KASP, PARMS, gene chip, or mass spectrometry.