KASP marker primer for detecting wheat drought-resistant gene TaDROT-6B1 and application of KASP marker primer

Abstract

The invention provides a KASP marker primer for detecting a wheat drought-resistant gene TaDROT-6B1 and application of the KASP marker primer, and belongs to the technical field of molecular genetic breeding, a specific complete set of primer Kasp-TaDROT-6B1 is designed, the provided KASP primer is used for detecting the wheat plant height and the drought-resistant gene TaDROT-6B1, the personal error is low, the analysis flux is high, and the KASP marker primer is suitable for detecting a large number of samples. The codominant molecular marker provided by the invention is applied to transformation of the TaDROT-6B1 gene, and has important practical significance in accelerating genetic improvement by utilizing the wheat drought-resistant and plant-height TaDROT-6B1 gene and improving the breeding efficiency.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of molecular genetic breeding, and particularly relates to a drought-resistant gene TaDROT-6B1 Development and application of high-throughput KASP (Kompetitive Allele-Specific PCR) marker for genes. BACKGROUND

[0002] Wheat is the main food crop in the global arid and semi-arid regions, and ensuring the safe and efficient production of wheat plays a crucial role in ensuring food security in China and even the world. However, with global warming, wheat production is increasingly threatened by abiotic stress, with drought stress becoming one of the main abiotic stress factors limiting wheat production.

[0003] With the development of molecular biology techniques, significant breakthroughs have been made in the identification and functional research of wheat drought-resistant genes. Research has mainly focused on the mining and mechanism analysis of related genes such as transcription factors and signal pathway regulators. Transcription factors, as the signal hub of drought response, enhance drought resistance by activating downstream genes. For example, members of the DREB transcription factor family TaDTG6- B 、 TaDREB3 can specifically bind to dehydration response elements under drought stress, regulate the expression of osmoprotectant synthesis genes, and improve cell water retention capacity, thereby enhancing the drought tolerance of wheat (Mei et al., 2022; Niu et al., 2020). Members of the NAC family TaNAC14 、 TaNAC5D-2 、 TaNAC071-A 、 TaNAC69 play an important role in wheat drought response by participating in stomatal closure and root structure remodeling, reducing water loss and enhancing water uptake (Chi et al., 2023; Ma et al., 2022; Mao et al., 2022; Xue et al., 2011). Ethylene response factor TaERF87 can interact with bHLH transcription factor TaAKS1 and synergistically enhance the expression of TaP5CS1 and TaP5CR1 , thereby improving proline biosynthesis and wheat drought tolerance (Du et al., 2022). TaABF2 is an important abscisic acid response factor, TaABF2 can interact with TaSnRK2 and be phosphorylated by it, enhancing the expression of downstream drought-resistant genes to regulate wheat response to drought stress (Du et al., 2024).

[0004] KASP markers have been widely used to detect SNP loci in crops such as wheat, rice and maize (Ertiro et al., 2015; Chandra et al., 2016; Steele et al., 2018), which can realize high-throughput genotyping without electrophoresis. Using single base mutation or SNP chip genotype data of wheat genes for QTL mapping and genome-wide association analysis, the function or trait linked SNP of the gene is converted into a KASP marker (Rasheed et al., 2016, 2017), which can be directly applied to molecular marker-assisted selection breeding.

[0005] Drought is a major environmental constraint for wheat production, and screening and identifying drought-related genes in wheat and developing high-throughput KASP markers are of great significance for accelerating wheat improvement and ensuring wheat production. A drought-resistant gene DROT1 DROUGHT1 Os10g0497700 was cloned in rice, which encodes a COBRA-like protein that regulates cell wall structure by increasing cellulose content and maintaining cellulose crystallinity, thereby improving drought resistance and affecting rice height (Sun et al., 2022). SUMMARY

[0006] To solve the above problems, the purpose of the present application is to detect KASP marker primers of wheat drought-resistant gene TaDROT-6B1 and their application. In this study, sequence analysis of 10 varieties of different drought-resistant types of rice DROT1 homologous gene TaDROT-6B1 TraesCS6B02G418400 was performed, and it was found that there was a base mutation from G to A at 64 bp downstream of the start codon of the first exon, with the physical position of the common wheat variety Chinese Spring genome IWGSC_RefSeq_v1.0 sequence (https: / / urgi.versailles.inra.fr / jbrowseiwgsc / gmod_jbrowse / ?data=myData / IWGSC_RefSeq_v1.0) as the reference genome 690561750 bp, resulting in a mutation from alanine to threonine, which was converted into a KASP marker, and the height effect was verified in a natural population, which can be used for molecular marker-assisted breeding.

[0007] In a first aspect, the present application provides KASP marker primers for detecting wheat drought-resistant gene TaDROT-6B1 , the KASP marker primers are a complete set of primers consisting of primer 1, primer 2 and primer 3; The primer 1 is a single-stranded DNA with a nucleotide sequence as shown in SEQ ID NO: 1; ​​​Primer 2 is a single-stranded DNA with a nucleotide sequence as shown in SEQ ID NO: 2; Primer 3 is a single-stranded DNA with a nucleotide sequence as shown in SEQ ID NO: 3.

[0008] Secondly, this invention provides a method for detecting wheat drought resistance genes. TaDROT-6B1 The kit contains the aforementioned KASP-labeled primers.

[0009] Thirdly, the present invention provides a method for detecting or assisting in the detection of wheat to be tested. TaDROT-6B1 The genotyping method includes the following steps: Step 1: Extract genomic DNA from the wheat to be tested; Step 2: Using the wheat genomic DNA to be tested as a template, perform PCR amplification using the KASP marker primers described in claim 1 to obtain the amplification product; Step 3: The amplification products obtained in Step 2 are subjected to fluorescence signal scanning. The scanning data are analyzed using Kluster Caller software. Based on the analysis results, the wheat species are identified. TaDROT-6B1 genotype.

[0010] As a further optimization of the above method, in step three, the wheat... TaDROT-6B1 The genotyping method is as follows: if the fluorescence signal data of the amplified product of the wheat to be tested shows blue after analysis by Kluster Caller software, then the wheat... TaDROT-6B1 The genotype is GG; if the fluorescence signal data of the amplified product of the wheat being tested shows red when analyzed by KlusterCaller software, then the wheat... TaDROT-6B1 The basal type is AA; if the fluorescence signal data of the amplified product of the wheat to be tested shows green after analysis by Kluster Caller software, then the wheat... TaDROT-6B1 The basic type is AG.

[0011] Fourthly, the present invention provides the application of the above-described KASP-labeled primers, kits, or methods in any of the following (A)-(C): (A): Used for detecting wheat or wheat hybrids TaDROT-6B1 Gene; (B): Used to identify or assist in the identification of drought resistance and plant height traits in wheat; (C): Used for breeding, screening or assisting in the screening of drought-resistant wheat plants, lines, strains or varieties.

[0012] Beneficial effects: the application is based on KASP technology, according to the target key mutation site of the primer, the corresponding SNP is typed by using the special matching of the primer end base. The technology can detect multiple samples with high throughput, greatly improve the detection efficiency, reduce the time and labor cost, and is very beneficial to large-scale screening in the field TaDROT-6B1 The mutation of the gene coding protein shortens the wheat TaDROT-6B1 transformation process, improves the breeding efficiency. The molecular marker can be applied to the assisted selection of drought resistance and plant height of wheat in wheat breeding. BRIEF DESCRIPTION OF DRAWINGS

[0013] Figure 1 To design D1, D2 and D3 primer amplification of Luomai 42, Luomai 47, Zhongmai 30, Zhongmai 895, Zhongmai 175, Luohuan 22, Luohuan No. 2, Luohuan No. 7, Luohuan 28 and Jinmai 47 TaDROT-6B1 The agarose gel detection result figure of the gene; in the figure, A is the amplification result figure of D1 primer, B is the amplification result figure of D2 primer, and C is the amplification result figure of D3 primer.

[0014] Figure 2 For Luomai 42, Luomai 47, Zhongmai 30, Zhongmai 895, Zhongmai 175, Luohuan 22, Luohuan No. 2, Luohuan No. 7, Luohuan 28 and Jinmai 47 amplified by specific primer D1, the sequence information figure of the sequence after comparison near the mutation site.

[0015] Figure 3 KASP marker Kasp-TaDROT-6B1 The genotyping result figure of 154 wheat varieties. DETAILED DESCRIPTION

[0016] The application provides a high-throughput, low-cost and low-error-rate SNP typing method for detecting TaDROT-6B1 The KASP marker primer of the drought-resistant gene can be used for molecular marker assisted selection of drought resistance and plant height in breeding. The KASP marker provided by the application for screening drought resistance and plant height Kasp-TaDROT-6B1 , the sequence of which is shown in the primer sequence table (table 1).

[0017] Table 1 detection of wheat drought resistance and plant height TaDROT-6B1 gene Kasp-TaDROT-6B1 Primer sequence table Marker name Sequence name Sequence Sequence number 1 GAAGGTGACCAAGTTCATGCT GCTGCTCCTCTCCGCGCCGG]]> ​ SEQ ID NO: 1 ]]> ​ 2 GAAGGTCGGAGTCAACGGATT GCTGCTCCTCTCCGCGCCGA ​ SEQ ID NO: 2 ]]> ​ 3 CCATCCACCCACCCACACC SEQ ID NO: 3 ]]> ​ Note: GAAGGTGACCAAGTTCATGCT Label sequence A, GAAGGTCGGAGTCAACGGATT Label sequence B.

[0018] Principle of KASP: three primers are needed for amplification, two forward competitive primers (the 5' end of the primers has a base sequence complementary to the fluorescent group HEX and FAM, and other sequences only differ at the 3' end SNP and InDel) and one reverse common primer; the PCR reaction system contains a universal sequence modified by a fluorescent group and a quenching group (Master Mix is provided by LGC company), so the forward primer can specifically bind to the DNA with the same genotype, and the two forward primers can emit two different colors of light, if the template strand is homozygous at this site, a single fluorescence matching it will be emitted, if it is heterozygous, two kinds of fluorescence can be emitted at the same time. KASP marker PCR amplification system, each 5 μl reaction system as follows: 0.056 μl Primer Mix, 2.5 μl Master Mix, 2.2 μl Template DNA (50 ng / μl), 0.244 μl ddH2O, Master Mix purchased from LGC company, Primer Mix is composed of 12% HEX primer, 12% FAM primer and 30% Common primer, and the primer is synthesized by Shanghai Yingjun Company. Amplification uses 384-well PCR instrument (BIO-RAD, S1000TMThermal Cycler), the program is as follows: 94℃ 15 min; 94℃ 20 s, 63-55℃ 1 min (decrease 1℃ for each cycle), 10 cycles; 94℃ 20 s, 55℃ 60 s, 32 cycles. The PCR amplification product is placed in an automatic focusing fluorescence multifunctional enzyme label instrument (PHERAstarplus SNP, BMG LABTECH) to read the final fluorescence data, and then the data is imported into Klustercaller v3.4 software (LGC, Hoddesdon, UK) for genotyping.

[0019] Through the published Chinese spring TaDROT-6B1 Genome sequence, three pairs of specific primers (Table 2) were designed to amplify the full-length sequence of the TaDROT-6B1 ( TraesCS6B02G418400 ) gene sequence of Luomai 42, Luomai 47, Zhongmai 30, Zhongmai 895, Zhongmai 175, Luohan 22, Luohan No. 2, Luohan No. 7, Luohan No. 28 and Jinmai 47, and sent to Shengwang Gene Company for sequencing. Using DNAMAN software to compare related sequences, it was found that the product sequence amplified by primer D1 was different in 10 varieties TaDROT-6B1 ( TraesCS6B02G418400A mutation from G to A at 64 bp downstream of the start codon of the gene sequence, the physical position of the reference genome IWGSC_RefSeq_v1.0 (https: / / urgi.versailles.inra.fr / jbrowseiwgsc / gmod_jbrowse / ?data=myData / IWGSC_RefSeq_v1.0) of common wheat variety Zhonghuangjun is 690561750 bp, which causes the coding amino acid to mutate from alanine to threonine. The genotypes of medium and non-drought-resistant varieties Luomai 42, Luomai 47, Zhongmai 30, Zhongmai 895, Zhongmai 175 and Luohuan 22 are GG; the genotypes of drought-resistant varieties Luohuan No. 2, Luohuan No. 7, Luohuan No. 28 and Jinmai 47 are AA (Table 3). The sequence information of the three primers is shown in Table 2.

[0020] According to the SNP mutation information characteristics, a specific set of KASP primers (as shown in Table 1) is designed, which is composed of primer 1, primer 2 and primer 3. Primer 1 is composed of tag sequence A and single-stranded DNA of sequence 1 in sequence table from 22 to 41 from 5' end to 3' end. Primer 2 is composed of tag sequence B and single-stranded DNA of sequence 2 in sequence table from 22 to 41 from 5' end to 3' end. Primer 3 is single-stranded DNA with nucleotide sequence as shown in sequence 3.

[0021] Further, the nucleotide sequence of the tag sequence A is 1-21 of sequence 1, and the nucleotide sequence of the tag sequence B is 1-21 of sequence 2.

[0022] More specifically, primer 1 is single-stranded DNA with nucleotide sequence as shown in sequence 1; primer 2 is single-stranded DNA with nucleotide sequence as shown in sequence 2; and primer 3 is single-stranded DNA with nucleotide sequence as shown in sequence 3.

[0023] The kit for detecting drought resistance and plant height TaDROT-6B1 The kit for detecting drought resistance and plant height

[0024] In the present application, the fluorescent reporter group A is FAM, the fluorescent reporter group B is HEX, and the fluorescent quenching group is BHQ.

[0025] In the present application, the fluorescent probe A, the fluorescent probe B, the quenching probe A and the quenching probe B are present in KASP 2xMaster Mix, wherein the KASP 2xMaster Mix is a product of LGC Company in the United Kingdom, and the product catalog number is KBS-1016-002 (applicable to 96 / 384 well plates).

[0026] Detecting or assisting in detecting the wheat to be tested TaDROT-6B1 The method of genotyping of the gene is a routine method: taking the genomic DNA of the wheat to be tested as a template, using the kit (the fluorescent group A is FAM, and the fluorescent group B is HEX) to perform PCR amplification, performing fluorescence signal scanning on the amplified product, using Kluster Caller software to analyze the scanning data, and determining the wheat genotype according to the analysis results as follows. TaDROT-6B1 Genotype: if the fluorescence signal data of the amplified product of the wheat to be tested is analyzed by Kluster Caller software and presents blue, the wheat TaDROT-6B1 Genotype is GG; if the fluorescence signal data of the amplified product of the wheat to be tested is analyzed by Kluster Caller software and presents red, the wheat TaDROT-6B1 Genotype is AA; if the fluorescence signal data of the amplified product of the wheat to be tested is analyzed by Kluster Caller software and presents green, the wheat TaDROT-6B1 Genotype is AG.

[0027] The above KASP marker primer can also be used for detecting the TaDROT-6B1 gene of the wheat hybrid offspring.

[0028] The following examples facilitate better understanding of the present application, but do not limit the present application. In the following examples, the experimental methods are routine methods, unless otherwise specified. The test materials used in the following examples can be purchased from a routine biochemical reagent store, unless otherwise specified.

[0029] Example 1 Wheat drought resistance and plant height TaDROT-6B1 High-throughput KASP marker design with its special primer sequence development.

[0030] Through the published Chinese Spring TaDROT-6B1 gene sequence, three pairs of specific primers (Table 2) are designed to amplify the full-length of the TaDROT-6B1 gene sequence of Lomac 42, Lomac 47, Zhongmai 30, Zhongmai 895, Zhongmai 175, Luohuan 22, Luohuan No. 2, Luohuan No. 7, Luohuan No. 28 and Jinmai 47. TraesCS6B02G418400 TaDROT-6B1 (TraesCS6B02G418400) ​A mutation from G to A at 64 bp downstream of the start codon of the gene sequence, the physical position of the reference genome IWGSC_RefSeq_v1.0 sequence (https: / / urgi.versailles.inra.fr / jbrowseiwgsc / gmod_jbrowse / ?data=myData / IWGSC_RefSeq_v1.0) of the common wheat variety Zhonghuanchun is 690561750 bp, which causes the coding amino acid to mutate from alanine to threonine. The genotypes of the medium and non-drought-resistant varieties Luomai 42, Luomai 47, Zhongmai 30, Zhongmai 895, Zhongmai 175 and Luohuan 22 are GG; the drought-resistant varieties Luohuan No. 2, Luohuan No. 7, Luohuan No. 28 and Jinmai 47 are AA (Table 3).

[0031] Table 2 Amplification TaDROT-6B1 Primer sequence table of the gene Primer Primer name Sequence Fragment size D1 DF1 TGTGCTTACTCCAATGTCACTGC 1484 DR1 CACAGCAAACGCAGTTGACTAAC D2 DF2 CGTGTTAGTCAACTGCGTTTGC 1468 DR2 CGAGAGAGCTACACAGCAGGTC D3 DF3 AGAAGACCCCGACCTGCTGT 1940 DR3 CCTTGTGCAGATAGAGAAGCCTTAC .

[0032] Table 3 Classification of drought resistance of 10 wheat varieties and their genotypes Variety name Drought resistance category Genotype Lumai 42 Non-drought resistant GG Lumai 47 Non-drought resistant GG Zhongmai 30 Non-drought resistant GG Zhongmai 895 Moderately drought resistant GG Zhongmai 175 Moderately drought resistant GG Luohan 22 Moderately drought resistant GG Luohan No. 2 Strongly drought resistant AA Luohan No. 7 Strongly drought resistant AA Luohan 28 Strongly drought resistant AA Jinmai 47 Strong drought resistance AA .

[0033] According to the SNP mutation information characteristics, a specific set of KASP primers is designed, which is composed of primer 1, primer 2 and primer 3. The 3' end of the two upstream primers (primer 1 and primer 2) is the allelic variation base G / A, and the sequence of the downstream primer 3 is selected to ensure that the amplified fragment is 60-120 bp. The 5' end of the upstream primer is connected with a fluorescent tag sequence, wherein the 5' end of primer 1 is connected with a FAM fluorescent tag sequence 5'-GAAGGTGACCAAGTTCATGCT-3', and the 5' end of primer 2 is connected with a HEX fluorescent tag sequence 5'-GAAGGTCGGAGTCAACGGATT-3'.

[0034] The KASP marker and the special primer sequence thereof for developing wheat drought resistance and plant height TaDROT-6B1 The KASP marker and the special primer sequence thereof for developing wheat drought resistance and plant height

[0035] Example 2 Utilization of primer pairs.

[0036] The experimental material is 154 wheat varieties, which are shown in Table 4.

[0037] 1, each experimental material in 2012-2013 and 2013-2014 years in Anyang, Henan, 4 rows, 1.5 m row length, conventional management, at physiological maturity, randomly selected from each plot 10 single plant, respectively, the distance between the root and shoot joint to the top of the main spike (not including awn), take its average as plant height.

[0038] 2, using Kasp-TaDROT-6B1 label detection of all experimental materials.

[0039] Results are shown in table 4 and Figure 3 .154 wheat varieties, 119 varieties show GG genotype, two environment plant height was 82.6 cm and 76.0 cm respectively; 35 varieties show AA genotype, two environment plant height was 88.6 cm and 82.5 cm respectively; statistical test shows Kasp-TaDROT-6B1 the gene effect reaches significant difference (P<0.05). P <0.05).

[0040] Table 4 genotype detection results and plant height of 154 wheat varieties Number Variety name Label 13 AY plant height (cm) 14 AY plant height (cm) 1 GG Jinan 13 91.7 85.8 2 GG Jimai 21 74.0 70.3 3 GG Af 107.3 98.8 4 GG Dorico 83.3 80.8 5 GG Shannong 78-59 86.0 80.6 6 GG Lampo 77.7 73.3 7 GG HK1 / 6 / NVSR3 / 5 / BEZ / TVR / 5 / CFN / BEZ / / SU92 / CI13645 / 3NAI60 79.3 77.7 8 GG Shannmai 509 76.3 68.8 9 GG Zhongyu 5 71.7 68.8 10 GG Xiaoyan 81 84.3 76.5 11 GG Shijiazhuang 15 82.3 74.2 12 GG Zhoumai 32 73.3 64.4 13 GG Heng 7228 81.7 74.2 14 GG Zhongyu 9 80.3 72.8 15 GG Xinong 979-005 73.3 64.0 16 GG Zhoumai 18 75.3 71.1 17 GG Shijiazhuang 8 85.0 78.9 18 GG Yumai 13 83.3 72.4 19 GG Zhengyin 1 104.0 90.1 20 GG An 1331 85.0 83.9 21 GG Shannmai 94 76.7 69.7 22 GG Lumai 9 90.0 79.0 23 GG Lumai 23 87.3 77.2 24 GG Zhoumai 31 80.0 74.2 25 GG Yumai 50 93.3 85.6 26 GG Wenong 5 70.0 70.3 27 GG Zhou 8425B 70.0 67.9 28 GG Yannong 18 91.0 87.4 29 GG Waimai 53 77.3 73.7 30 GG Lumai 14 80.0 74.4 31 GG Zhoumai 23 78.3 75.9 32 GG Xinong 2000-7 73.3 68.4 33 GG PH82-2 90.0 80.2 34 GG Huaimai 20 78.3 74.0 35 GG Zhoumai 28 74.0 73.4 36 GG Shann 354 80.7 72.2 37 GG Yumai 2 90.0 78.6 38 GG Su 0663 75.7 73.1 39 GG Kitanokaori 78.3 80.5 40 GG Genio 90.0 84.4 41 GG Zhongmai 895 70.0 62.3 42 GG Zhoumai 26 75.0 72.2 43 GG Jining 16 78.3 71.1 44 GG Zhongmai 875 73.7 71.1 45 GG Zhoumai 19 78.0 72.6 46 GG Shannong 981 87.7 81.2 47 GG Huapai 5 79.3 72.7 48 GG Linmai 2 83.3 82.0 49 GG Yannong 15 84.0 73.9 50 GG Shannong 20 80.0 72.7 51 GG Sunstate 120.7 112.2 52 GG Kanto 107 97.7 82.5 53 GG Shiyu 17 83.3 77.0 54 GG Barra 81.7 73.0 55 GG Zhoumai 16 68.3 62.9 56 GG Bimei 4 136.7 127.7 57 GG Linmai 4 80.0 70.5 58 GG Abu 123.3 116.5 59 GG Lankao 24 73.3 69.1 60 GG Xiaoyan 54 91.0 83.7 61 GG Lumai 11 90.0 81.4 62 GG Waimai 19 90.0 87.1 63 GG Taishan 1 106.7 92.0 64 GG Luomai 21 83.3 78.2 65 GG Lumai 6 90.0 81.2 66 GG Shixin 733 86.3 78.1 67 GG Huaimai 21 80.7 78.4 68 GG Bainong 64 82.7 80.4 69 GG Liangxing 66 80.0 71.9 70 GG Jimai 19 85.0 73.9 71 GG Yumai 47 80.0 73.8 72 GG Lumai 15 84.3 82.9 73 GG Zhoumai 11 76.7 67.8 74 GG Sunong 6 71.7 64.9 75 GG Jinhe 9123 76.7 75.6 76 GG Shann 512 86.7 78.0 77 GG Shann 150 91.7 89.0 78 GG Lumai 7 76.0 75.2 79 GG Zhoumai 25 76.7 70.0 80 GG Zhoumai 22 72.3 70.9 81 GG Linhan 2 93.3 85.6 82 GG Xinmai 19 75.0 69.9 83 GG Yumai 35 76.0 62.1 84 GG Nidera Baguette 10 88.3 88.1 85 GG Guan 35 75.0 68.9 86 GG Zhong 892 76.3 64.6 87 GG 11 CA40 70.0 59.5 88 GG Huaimai 18 75.7 70.6 89 GG Xiaoyan 22 84.3 74.9 90 GG Aifeng 3 92.3 86.6 91 GG Zimai 12 83.7 78.2 92 GG Hang 6172 80.7 73.7 93 GG Xinong 88 90.0 83.2 94 GG Wenong 14 77.7 73.6 95 GG Jinmai 61 87.3 82.3 96 GG Zhoumai 13 63.3 59.0 97 GG Yumai 49 75.0 70.0 98 GG Yumai 63 81.7 63.8 99 GG Shannyou 225 89.0 79.7 100 GG Shann 253 81.7 64.5 101 GG Xinmai 9 78.3 73.2 102 GG Lankao 906 80.7 74.4 103 GG Wunong 148 85.7 73.6 104 GG Luohan 2 84.0 79.1 105 GG Lumai 8 77.0 69.1 106 GG Libero 75.0 69.7 107 GG Shann 715 87.3 75.0 108 GG Yumai 57 77.3 69.5 109 GG Neixiang 188 75.0 65.3 110 GG Yumai 18 77.3 72.0 111 GG Lin kang 12 95.7 86.2 112 GG Aikang 58 64.3 61.2 113 GG Gaoyou 503 95.0 79.8 114 GG Gaoc 8901 90.0 87.9 115 GG Yumai 34 80.0 66.0 116 GG Waimai 50 80.0 75.9 117 GG Aca 601 80.0 79.6 118 GG Yumai 7 75.0 66.0 119 GG Zhengmai 366 65.0 58.2 120 AA Bimei 1 145.0 134.4 121 AA Taishan 5 90.7 80.9 122 AA Lumai 5 83.7 75.3 123 AA Yanzhan 4110 75.0 75.9 124 AA Waimai 29 84.3 82.6 125 AA Fengchan 3 121.7 110.7 126 AA Norin 61 95.0 85.6 127 AA Shixin 828 84.0 73.5 128 AA Jimai 20 83.3 70.6 129 AA Bainong 3217 83.0 76.8 130 AA Zhengzhou 3 131.7 125.1 131 AA Jishu 02-1 78.0 74.3 132 AA Fu 936 74.3 69.8 133 AA Xinong 291 85.3 82.1 134 AA Mantol 77.7 73.8 135 AA 85zhong 33 82.3 73.7 136 AA Neixiang 5 138.3 135.7 137 AA Zixuan 2 85.7 81.7 138 AA Xinmai 9408 76.7 71.2 139 AA Sagittario 82.3 79.1 140 AA Xiaoyan 6 90.7 89.4 141 AA Xinong 1376 74.3 59.3 142 AA Jinan 17 80.0 75.8 143 AA Yannong 19 81.7 78.6 144 AA Nidera Baguette 20 81.0 75.5 145 AA Shi 4185 83.3 74.8 146 AA Zheng 9023 84.3 73.8 147 AA Ji 22 75.0 66.8 148 AA Lankao 2 75.0 74.4 149 AA Norin 67 91.7 87.6 150 AA Wanmai 52 81.7 80.3 151 AA Wan 23094 84.0 76.2 152 AA Wanmai 38 76.7 74.4 153 AA ProINTA Colibr 1 100.0 94.5 154 AA Liangxing 99 82.3 74.7 .

[0041] The following examples are only to make further detailed description of the present application, but do not constitute any limitation on the present application. Changes, modifications, substitutions, combinations, simplification made by those skilled in the art within the scope of claims, should be equivalent to the replacement way, without departing from the essential and scope of the present application, some non-essential improvement and adjustment of the present application still belongs to the protection scope of the present application.

Claims

1. Detection of drought-resistant genes in wheat TaDROT-6B1 KASP-labeled primers, characterized by: The KASP marker primers are a set of primers consisting of primer 1, primer 2 and primer 3; Primer 1 is a single-stranded DNA with a nucleotide sequence as shown in SEQ ID NO: 1; Primer 2 is a single-stranded DNA with a nucleotide sequence as shown in SEQ ID NO: 2; Primer 3 is a single-stranded DNA with a nucleotide sequence as shown in SEQ ID NO:

3.

2. A method for detecting drought resistance genes in wheat TaDROT-6B1 The reagent kit is characterized by: It contains the KASP-tagged primer as described in claim 1.

3. A method for detecting or assisting in the detection of wheat to be tested. TaDROT-6B1 The genotyping method is characterized by: Includes the following steps: Step 1: Extract genomic DNA from the wheat to be tested; Step 2: Using the wheat genomic DNA to be tested as a template, perform PCR amplification using the KASP marker primers described in claim 1 to obtain the amplification product; Step 3: The amplification products obtained in Step 2 are subjected to fluorescence signal scanning. The scanning data are analyzed using Kluster Caller software. Based on the analysis results, the wheat species are identified. TaDROT-6B1 genotype.

4. The method according to claim 3, characterized in that: In step three, the wheat is determined based on the analysis results. TaDROT- 6B1 The genotyping method is as follows: if the fluorescence signal data of the amplified product of the wheat to be tested shows blue after analysis by Kluster Caller software, then the wheat... TaDROT-6B1 The genotype is GG; if the fluorescence signal data of the amplified product of the wheat being tested shows red when analyzed by Kluster Caller software, then the wheat... TaDROT-6B1 The basal type is AA; if the fluorescence signal data of the amplified product of the wheat to be tested shows green after analysis by Kluster Caller software, then the wheat... TaDROT-6B1 The basic type is AG.

5. The use of the KASP-labeled primer according to claim 1, the kit according to claim 2, or the method according to any one of claims 3-4 in any one of the following (A)-(C): (A): Used for detecting wheat or wheat hybrids TaDROT-6B1 Gene; (B): Used to identify or assist in the identification of drought resistance and plant height traits in wheat; (C): Used for breeding, screening or assisting in the screening of drought-resistant wheat plants, lines, strains or varieties.

Images