SNP (Single Nucleotide Polymorphism) molecular marker for germplasm identification and breeding of armeniaca mume

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker for germplasm identification and breeding of armeniaca mume, and belongs to the technical field of fruit tree molecular marker-assisted breeding. On the basis of re-sequencing and selective clearance analysis of wild plum and armeniaca mume populations, a key gene remarkably related to the armeniaca mume cyanin deletion character is identified, and an SNP variation with a codon terminated in advance exists in a gene coding region; a specific primer is further designed according to the functional SNP variation, a target fragment corresponding to a plum genome is amplified through PCR, and the base type of an SNP site is detected through first-generation sequencing, so that whether the detected plant is the armeniaca mume germplasm or not can be quickly and accurately judged. The SNP molecular marker can be used for early screening of armeniaca mume germplasm, has important application value, and provides an efficient and reliable technical means for molecular marker-assisted breeding.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of molecular marker assisted breeding of fruit trees, and particularly relates to a SNP molecular marker for germplasm identification and breeding of Prunus mume. BACKGROUND

[0002] Prunus mume, commonly known as green plum, is named for its green calyx, white flowers, and greenish small branches. It belongs to the green calyx type of the true plum branch of the plum variety classification system and is the best of the plum varieties. The dried flower buds of Prunus mume play a key role in the field of traditional Chinese medicine and have high medicinal value. According to the ancient book Bencao Gangmu, Prunus mume can "clear the head, benefit the lung, and remove phlegm and stagnation of heat". According to the book Bai Cao Jing, Prunus mume can "open the stomach and dispel stagnation. It can be cooked into porridge to help the clear yang qi rise". According to the book Yin Pian Xin Can, Prunus mume can "regulate the liver and stomach, relieve stomach pain, dizziness, and promote food intake". Volatile oils, liposides, phenolic glycosides, flavonoids, and phenylpropanoids are separated from Prunus mume, among which flavonoids represented by hyperoside and rutin and phenylpropanoids represented by chlorogenic acid have high content in the petals of Prunus mume. These components can regulate human physiological functions and play an important role. As a famous plum variety, Prunus mume carries deep cultural connotations and is a symbol of high and tough qualities, which is deeply loved by people. It has high ornamental value and is widely used in landscape arrangement and other fields, and has important economic value and cultural significance.

[0003] However, the morphological characteristics of Prunus mume are not obvious at the early growth stage, making it difficult to accurately identify it through traditional morphological methods. Especially when Prunus mume does not bloom, it cannot be identified according to its unique white petals and green sepals, which makes it difficult to accurately determine its germplasm at the early stage in actual production and research, seriously affecting the breeding, planting, and development and utilization of related products of Prunus mume.

[0004] Currently, molecular marker assisted selection (MAS) technology provides a new path for fruit tree breeding. The development of conventional markers such as RFLP, RAPD, and SSR relies on genetic linkage analysis, lacks molecular mechanism support at the functional gene level, and has long detection period, high cost, and poor stability. In recent years, with the development of high-throughput technology, the role of SNP molecular markers has become more prominent. SNP molecular markers have the characteristics of high throughput, wide distribution, and easy detection. SNP molecular markers have important application value and broad application prospect in agriculture and plant breeding. Through SNP molecular markers, the relationship between gene variation and traits can be studied, and the molecular mechanism of the formation of specific traits can be revealed, providing a theoretical basis for crop improvement and variety selection. At present, there are few studies on SNP molecular markers in plum, and there are no related SNP molecular markers for Prunus mume variety screening.

[0005] Therefore, it is urgent to find a SNP molecular marker that is co-segregated with the green calyx anthocyanin deletion phenotype and has a functional explanation, to realize early, rapid and accurate identification of green calyx plum germplasm resources, accelerate the breeding process, improve breeding efficiency, and provide strong technical support for the protection and rational use of green calyx plum germplasm resources. SUMMARY

[0006] The present application aims to solve the technical problems of long identification period, low accuracy and lack of functional correlation markers in the prior art, and provides a molecular marker based on SNP variation of key genes and an efficient detection method thereof.

[0007] In order to achieve the above-mentioned purpose, the present application adopts the following technical solutions:

[0008] The present application provides a SNP molecular marker for green calyx plum germplasm identification and breeding, which is located at position 906,369 of plum chromosome 4, and the polymorphic base is T / T.

[0009] The present application analyzes the selective elimination of green calyx plum by resequencing plum populations, and locks the key gene PmGSTF2 that regulates the anthocyanin deletion of green calyx plum; a SNP variation of premature termination codon is identified at position 307 of the coding region of PmGSTF2 gene; the SNP shows a significant co-segregation relationship with the anthocyanin deletion trait of green calyx plum, and is defined as a molecular marker of green calyx plum germplasm.

[0010] The present application also provides a primer pair for detecting the SNP molecular marker, comprising primer PmGSTF2-F1 and primer PmGSTF2-R1, the nucleotide sequence of the primer PmGSTF2-F1 is TCAGGCTATTTGGTAAGAGCCT, and the nucleotide sequence of the primer PmGSTF2-R1 is ACCTTCTCCAGTTTCTCCTCAC.

[0011] The specific primer pair PmGSTF2-F1 / R1 designed in the present application can amplify the target region containing the SNP. The amplification product is sequenced to be T / T at position 307 in green calyx plum germplasm, and G / G or G / T at position 307 in non-green calyx plum germplasm.

[0012] The present application also provides the application of the above-mentioned SNP molecular marker or the above-mentioned primer pair in plum breeding, comprising:

[0013] (a) Green calyx plum germplasm screening of plum germplasm resource library;

[0014] (b) Early molecular marker assisted selection of green calyx plum single plant in hybrid offspring population;

[0015] (c) Green calyx plum variety purity identification.

[0016] The application also provides a method for identifying Prunus mume germplasm, comprising the following steps:

[0017] Step 1, extracting genomic DNA of the Prunus mume plant to be tested by using a DNA extraction kit;

[0018] Step 2, performing PCR amplification by using the primer pair;

[0019] Step 3, detecting the base type at the 307th position of the gene coding region by first-generation sequencing; if the base type at the 307th position is T / T, the plant to be tested is Prunus mume germplasm; if the base type at the 307th position is G / G or G / T, the plant to be tested is non-Prunus mume germplasm.

[0020] Based on resequencing and selective elimination analysis of wild Prunus mume and Prunus mume populations, the application identifies a key gene PmGSTF2 significantly related to the anthocyanin deletion trait of Prunus mume, and a codon-terminating SNP variation exists in the gene coding region. The application designs specific primers based on the functional SNP variation, amplifies the target fragment corresponding to the genome of Prunus mume by PCR, and detects the base type of the SNP site by first-generation sequencing, so that whether the plant to be tested is Prunus mume germplasm can be quickly and accurately determined.

[0021] The application can realize early, rapid and accurate identification, and can effectively shorten the breeding cycle by 4-6 years by determining Prunus mume germplasm at the seedling stage through PCR sequencing detection. In addition, the identification has high accuracy and stability, and is not affected by environmental factors, and has high detection accuracy. At the same time, the operation is simple and low in cost, and the identification only needs conventional PCR and first-generation sequencing instruments. Most importantly, the marker has strong universality: it is suitable for screening of Prunus mume germplasm of all cultivated species and wild relative resources of Prunus mume.

[0022] The SNP molecular marker of the application can be applied to: (1) high-throughput screening of germplasm resource library: rapid identification of Prunus mume germplasm, and construction of a core breeding population; (2) early selection of hybrid offspring: screening of Prunus mume single plants at the seedling stage to reduce field management cost; (3) variety purity identification: distinguishing Prunus mume and non-Prunus mume germplasm to ensure seedling quality.

[0023] The SNP molecular marker of the application can be used for early screening of Prunus mume germplasm, has important application value, and provides an efficient and reliable technical means for molecular marker-assisted breeding. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1The regions and genes identified by selective sweep analysis for green calyx and wild plum populations. Specifically, the distribution of Fst(a) and Pi(b) values of selective sweep analysis, the position of the dashed line represents the top 5% of the selected region; (c) the Venn diagram shows the number of commonly selected genes identified by the two selective sweep analyses; GO(d) and KEGG(e) enrichment analysis of selected genes.

[0025] Figure 2 Analysis of selected genomic regions and genes on chromosome 4. Among them, (a) Manhattan plot showing the results of Fst selective sweep analysis of chromosome 4; (b) peak regions on chromosome 4 and linkage disequilibrium blocks; (c) Fst, Pi, Tajima's D and Hp value distribution of the region around the PmGSTF2 gene (1.08-1.10 Mb) on chromosome 4; (d) structure of PmGSTF2 gene and SNP variation information in the coding region of the gene.

[0026] Figure 3 Verification of SNP variation sites in the coding region of PmGSTF2 gene, determination of anthocyanin content in samples and PmGSTF2 gene expression. Among them, (a) SNP variation site cloning verification, black box represents SNP mutation position. (b) determination of anthocyanin content in samples for verification; (c) determination of PmGSTF2 gene expression in samples for verification. *** indicates a very significant difference. TH3H, YLQ, XYQ and YDM represent non-green calyx samples, LE, LM, XLE and JQLE represent green calyx samples.

[0027] Figure 4 GUS staining and PCR amplification verification of transgenic lines. Among them, (a) GUS staining of Arabidopsis wild type, Arabidopsis mutant, complete PmGSTF2 transgenic line and deleted PmGSTF2 transgenic line; (b) PCR amplification of cDNA of Arabidopsis wild type, Arabidopsis mutant, complete PmGSTF2 transgenic line and deleted PmGSTF2 transgenic line.

[0028] Figure 5 Functional verification of PmGSTF2 gene. Among them, (a) phenotype of Arabidopsis wild type, gst mutant, gst / PmGSTF2-S transgenic line and gst / PmGSTF2-L transgenic line under light treatment; (b) anthocyanin content in Arabidopsis wild type, gst mutant, gst / PmGSTF2-S transgenic line and gst / PmGSTF2-L transgenic line; (c) expression level of PmGSTF2 gene in Arabidopsis wild type, gst mutant, gst / PmGSTF2-S transgenic line and gst / PmGSTF2-L transgenic line.

[0029] Figure 6 For the knockout experiment of PmGSTF2 gene. Among them, (a) PmGSTF2 gene structure and PAM site; (b) CRISPR / Cas9 vector schematic diagram; (c) Transgenic callus under natural light and 365 nanometer ultraviolet irradiation; (d) DNA sequence of mutant PmGSTF2 on target 1 and target 2.

[0030] Figure 7 For the phenotype and quantity of F1 generation seedlings in different hybrid combinations. Among them, (a) the overall phenotype of F1 generation seedlings in T / T hybrid combination of Mei flower green calyx type; (b) the local phenotype difference of F1 generation seedlings in T / T hybrid combination of Mei flower green calyx type; (c) T / T hybrid combination of Mei flower green calyx type and the quantity of different phenotypes of F1 generation; (d) the overall phenotype of F1 generation seedlings in T / T hybrid combination of Mei flower green calyx and Mei Yanglao No. 2 (G / T); (e) the local phenotype difference of F1 generation seedlings in T / T hybrid combination of Mei flower green calyx and Mei Yanglao No. 2 (G / T); (f) T / T hybrid combination of Mei flower green calyx and Mei Yanglao No. 2 (G / T) and the quantity of different phenotypes of F1 generation; (g) the overall phenotype of F1 generation seedlings in G / T hybrid combination of Mei flower green calyx and Mei Gucheng No. 1 (G / T); (h) the local phenotype difference of F1 generation seedlings in G / T hybrid combination of Mei flower green calyx and Mei Gucheng No. 1 (G / T); (i) G / T hybrid combination of Mei flower green calyx and Mei Gucheng No. 1 (G / T) and the quantity of different phenotypes of F1 generation.

[0031] Figure 8 For the peak chart of PmGSTF2 gene sequencing results in F1 generation seedlings of different hybrid combinations. Among them, (a) in the F1 generation seedlings of T / T hybrid combination of Mei flower green calyx type, the SNP mutation site of PmGSTF2 gene in all green phenotype samples presents A base single peak; (b) in the F1 generation seedlings of T / T hybrid combination of Mei flower green calyx and Mei Yanglao No. 2 (G / T), the SNP mutation site of PmGSTF2 gene in all green phenotype samples presents A base single peak, and all red samples present C / A base heterozygous peak; (c) in the F1 generation seedlings of G / T hybrid combination of Mei flower green calyx and Mei Gucheng No. 1 (G / T), the SNP mutation site of PmGSTF2 gene in all green phenotype samples presents A base single peak; part of the SNP mutation site of PmGSTF2 gene in red phenotype samples presents C base single peak, and other sites present C / A base heterozygous peak. The red box represents the SNP mutation site in PmGSTF2 gene. DETAILED DESCRIPTION

[0032] Specific embodiments of the present application are described in detail below with reference to the accompanying drawings. It is to be noted that the embodiments described below are intended to help understand the present application and are not intended to limit the present application. In addition, the technical features involved in each embodiment of the present application can be combined with each other as long as they do not conflict with each other.

[0033] Example 1

[0034] Identification of key regulatory genes of green calyx type of Prunus mume

[0035] In this example, selective sweep analysis was performed on the re-sequencing data of 25 green calyx type of Prunus mume and 48 wild type of Prunus mume to explore potential candidate genes related to the domestication of green calyx type of Prunus mume. Based on F ST st value, selective sweep analysis identified 108 selection regions, which were 19.62 Mb in size and contained 2390 genes Figure 1 (a). Selective sweep analysis by Pi value identified 68 selection regions, which were 14.41 Mb in size and contained 1463 genes Figure 1 (b). A total of 79 candidate genes were identified as potential candidate genes using the two methods Figure 1 (c). Enrichment analysis showed that many genes involved in abiotic stress, including temperature, radiation, salt, osmotic stress, toxins, DNA damage and biological stimuli, were significantly enriched Figure 1 (d). In KEGG metabolic pathways, genes related to secondary metabolite synthesis, glutathione metabolism and glycolysis were significantly enriched Figure 1 (e).

[0036] On chromosome 4, a highly selected and highly linked region LG04-LD1 (1.08-1.10 Mb) was identified Figure 2 (a-c). It was found that there was a glutathione S-transferase gene PmGSTF2 on chromosome 4 of Prunus mume. After further analysis of the variation of PmGSTF2 gene, the inventors found that there was a premature termination codon SNP mutation in the coding region of the gene (i.e. at position 906,369 on chromosome 4), which mainly occurred in the green calyx type of Prunus mume, while no such premature termination codon SNP mutation was identified in the wild type of Prunus mume Figure 2 (d).

[0037] Example 2

[0038] Identification of SNP variation in the coding region of PmGSTF2

[0039] Analysis of 73 re-sequencing data to extract SNPs showed that there was no SNP in all wild type of Prunus mume samples, with a variation site of G / G, and there was SNP in all green calyx type of Prunus mume samples, with a variation site of T / T (Table 1).

[0040] Table 1 SNP variation site base types of PmGSTF2 gene coding region in plum population weight sequencing samples

[0041]

[0042]

[0043] Note: Numbers 1-25 are Prunus mume varieties; numbers 26-74 are wild plums (non-green calyx type) germplasm.

[0044] Randomly selected 5 samples for PCR amplification and sequencing, the results also show that the base at position 307 of PmGSTF2 gene cds in non-green calyx type plum samples is G, and the base at position 307 of PmGSTF2 gene cds in green calyx type plum samples is T Figure 3 a). Further determination of anthocyanin content of selected varieties, the results show that the anthocyanin content of green calyx type plum samples is significantly lower than that of non-green calyx type plum samples Figure 3 b), at the same time, the expression level of PmGSTF2 gene in green calyx type plum samples is also significantly lower than that in non-green calyx type plum samples Figure 3 c).

[0045] Example 3

[0046] Gene function verification of PmGSTF2

[0047] Figure 4 In the middle a). The cDNA of transgenic, wild type and mutant samples were amplified by PCR, the results showed that the gst / PmGSTF2-S transgenic lines appeared 300 bp band, gst / PmGSTF2-L transgenic lines appeared 650 bp band, while wild type and mutant lines did not appear band Figure 4 In the middle b).

[0048] The wild type, mutant, gst / PmGSTF2-S and gst / PmGSTF2-L transgenic lines were sowed in the hole tray at the same time, and the four-week-old seedlings were treated with light. The results showed that the leaves of mutant and gst / PmGSTF2-S transgenic lines did not produce visible red, while the seedling leaves of wild type and gst / PmGSTF2-L transgenic lines produced visible red Figure 5 In the middle a). The results of anthocyanin determination also showed that the anthocyanin content of wild type and gst / PmGSTF2-L transgenic lines samples was significantly higher than that of mutant and gst / PmGSTF2-S transgenic lines Figure 5 In the middle b), the expression amount of PmGSTF2 gene also showed the same results Figure 5 c), which showed that the expression of complete PmGSTF2 gene PmGSTF2-L could promote anthocyanin accumulation, while the PmGSTF2 gene PmGSTF2-S missing a sequence could not promote anthocyanin accumulation.

[0049] At the same time, CRISPR / Cas9 knockout experiment of PmGSTF2 gene was carried out in Prunus mume callus Figure 6 In the middle a-b). Under 365 nm ultraviolet irradiation, yellow-green fluorescence was observed in the callus of #1 and #2 leaf explants Figure 6 In the middle c), which showed that Cas9 had been successfully introduced. Under normal light conditions, the callus of 'Meiren' Prunus mume used was red, while the callus of #1 and #2 explants was green Figure 6 In the middle c), which showed that after knocking out PmGSTF2 gene by CRISPR technology, the accumulation of anthocyanin in callus was inhibited.

[0050] In order to further verify the functional deletion of PmGSTF2 gene, the target region of the gene was amplified, cloned and sequenced Figure 6 In the middle d). The sequencing results showed that in the target region of the designed PAM site, various types of mutations were detected, including single / double nucleotide insertion and deletion, and large fragment insertion and deletion. These mutations caused frame shift and produced premature stop codon, which caused PmGSTF2 gene inactivation.

[0051] Example 4

[0052] Identification of significant cosegregation of SNP variants in the coding region of PmGSTF2 with the phenotype of *Prunus cerasifera*.

[0053] To further investigate whether the PmGSTF2 gene SNP mutation co-segregates with the glycoside deficiency trait in green plum, different hybridization combinations were used for verification. The results showed that using samples with homozygous mutations (T / T) in the PmGSTF2 gene as parents for hybridization... Figure 7 (c) The hybrid offspring of this species are all green ( Figure 7 (ab); a hybridization was performed using a sample with a heterozygous mutation (G / T) in the PmGSTF2 gene as the maternal parent and a sample with a homozygous mutation (T / T) in the PmGSTF2 gene as the paternal parent. Figure 7 In the middle f), the hybrid offspring exhibited a phenotype of half red and half green, with a segregation ratio close to 1:1. Figure 7 (de); samples with heterozygous mutations (G / T) in the PmGSTF2 gene were used as parents for hybridization (de); Figure 7 In the hybrid offspring (i), a small portion of the plants were green, while the majority were red, with a segregation ratio close to 1:3. Figure 7 (zhonggh).

[0054] The SNP mutation sites of the PmGSTF2 gene in the hybrid progeny seedlings were further amplified by PCR using primer pairs (PmGSTF2-F1 and PmGSTF2-R1) with SNP molecular markers. The PCR reaction used a 25 μL system: 12.5 μL I-5TM 2×High-Fidelity Master Mix, 1 μL each of upstream primer PmGSTF2-F1 and downstream primer PmGSTF2-R1, 1 μL DNA, and 9.5 μL ddH2O. The amplification program was: 95℃ for 5 min; 95℃ for 30 s, 58℃ for 30 s, 72℃ for 30 s, for a total of 35 cycles; extension at 72℃ for 5 min. The PCR products were subjected to first-generation sequencing using reverse primers. The results showed that the SNP site in the progeny seedlings of the PmGSTF2 gene homozygous mutation (T / T) was A (with the reverse complementary base being T). Figure 8 (a) The offspring seedlings from a cross between a sample with a heterozygous mutation (G / T) in the PmGSTF2 gene (as the maternal parent) and a sample with a homozygous mutation (T / T) in the PmGSTF2 gene (as the paternal parent) are shown in the following diagrams: Heterozygous peaks at SNP sites of C / A (reverse complementary bases G / T) in the red phenotype seedlings, and single-peaked peaks at SNP sites of A (reverse complementary bases T) in the green phenotype seedlings. Figure 8b); the sample of the hybrid mutation (G / T) of the PmGSTF2 gene as the parent to hybridize the seedlings, the heterozygous peak diagram of the SNP site as C / A base (the reverse complementary base is G / T) in the sample of the seedling with red phenotype, or the single peak diagram of C base (the reverse complementary base is G), the single peak diagram of the SNP site as A base (the reverse complementary base is T) in the sample of the seedling with green phenotype Figure 8 c), the above research results show that the SNP mutation of the PmGSTF2 gene and the green calyx plum trait exist significant co-segregation phenomenon, and the anthocyanin deletion trait of the green calyx plum is a single gene controlled recessive trait. Therefore, the SNP molecular marker of the present application is suitable for efficiently and accurately screening the green calyx plum germplasm resources, and provides a reference basis for the molecular marker assisted breeding of the Prunus crops.

Claims

1. A SNP molecular marker for identifying and breeding Prunus mume var. viridicalyx, located at position 906, 369 of chromosome 4 of Prunus mume, and the polymorphic base is T / T.

2. A primer pair for detecting the SNP molecular marker of claim 1, characterized in that, The primer PmGSTF2-F1 has the nucleotide sequence of TCAGGCTATTTGGTAAGAGCCT, and the primer PmGSTF2-R1 has the nucleotide sequence of ACCTTCTCCAGTTTCTCCTCAC. 3.A kit containing the primer pair of claim 2. 4.The SNP molecular marker of claim 1, the primer pair of claim 2, or the kit of claim 3 is applied in breeding Prunus mume, comprising: (a) screening Prunus mume var. viridicalyx in a Prunus mume germplasm bank; (b) early molecular marker assisted selection of Prunus mume var. viridicalyx in a hybrid progeny population; (c) purity identification of Prunus mume var. viridicalyx.

5. A method of identifying a Prunus domestica L. germplasm, characterized by, comprising the following steps: Step 1, extracting genomic DNA of the Prunus mume plant to be tested by using a DNA extraction kit; Step 2, performing PCR amplification by using the primer pair described above; Step 3, detecting the base type at position 307 of the gene coding region by first-generation sequencing; if the base type at position 307 is T / T, the plant to be tested is Prunus mume var. viridicalyx; if the base type at position 307 is G / G or G / T, the plant to be tested is not Prunus mume var. viridicalyx.

Images