Dual detection self-powered sensor for detecting sugarcane diseases, application and detection method thereof
By designing a dual-detection self-powered sensor and employing nucleic acid amplification technology and multi-mode collaborative detection, the problem of insufficient sensitivity in traditional sugarcane disease detection methods has been solved, achieving efficient, rapid, and accurate sugarcane disease detection, which is suitable for field applications.
Patent Information
- Application Number
- CN202511625810.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-07
- Publication Date
- 2026-02-10
- Estimated Expiration
- 2045-11-07
AI Technical Summary
Traditional sugarcane disease detection methods lack sensitivity, are prone to missed detections, are difficult to conduct in the field in a timely manner, and the test results are easily affected by environmental changes, making it impossible to provide timely guidance for disease prevention and control.
A dual-detection self-powered sensor is designed, employing a bioanode based on nucleic acid amplification product M and a biocathode based on Au@MB, combined with an electrolyte for detection. It utilizes three modes—electrochemical, colorimetric, and photothermal—to work synergistically, achieving efficient and rapid detection of sugarcane top rot and smut.
It improves the sensitivity and accuracy of detection, simplifies the operation process, reduces costs, is suitable for field testing, shortens the testing cycle, reduces the false negative rate, and improves testing efficiency and convenience.
Smart Images

Figure CN121068859B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of biological detection chemical analysis, in particular to a double-detection self-powered sensor for detecting sugarcane diseases, application and detection method thereof. BACKGROUND
[0002] Sugarcane top rot and smut are important diseases that seriously harm the sugarcane industry, widely exist in sugarcane planting areas, cause a substantial decline in sugarcane yield, and significantly worsen the quality, bringing huge economic losses to sugarcane farmers and sugar enterprises. Traditional detection techniques have many drawbacks when dealing with these two diseases, and are difficult to meet the needs of modern sugarcane disease monitoring and prevention and control.
[0003] In terms of single sample detection, traditional detection methods mostly rely on a single biochemical or physical indicator for judgment, such as observing specific enzyme activity or color change to infer disease type. However, these indicators are easily disturbed by non-disease factors such as soil microbial metabolites, changes in weather conditions, and differences in sugarcane varieties, resulting in insufficient specific recognition ability. The incidence of false positive and false negative results is high in actual detection, especially when the early symptoms of the disease have not yet been clearly manifested, misdiagnosis rate seriously interferes with the accuracy of prevention and control decisions. In the context of multiple disease detection, traditional methods usually require different detection processes and reagents for sugarcane top rot and smut. For example, detecting top rot may rely on culture method to observe colony morphology, while detecting smut requires microscopic examination of spore morphological characteristics, the whole process is tedious and lengthy, and it often takes a lot of time to complete a complete double-disease detection, consuming a lot of manpower and time cost, and signal cross interference is likely to occur between different detection steps. In addition, traditional detection methods highly depend on complex and precise laboratory equipment such as PCR instrument, high-performance liquid chromatograph, etc., and technicians with professional training for operation and result analysis, which makes it difficult to carry out detection work on the spot of sugarcane planting, samples usually need to be transported from the field to the laboratory, and environmental changes during transportation may further affect the accuracy of the detection results. The period for issuing a detection report is long, which cannot provide timely and effective guidance for field disease prevention and control, and the practicality is greatly limited. SUMMARY
[0004] The main purpose of the present application is to provide a double-detection self-powered sensor for detecting sugarcane diseases, aiming to solve the problem of insufficient sensitivity of traditional detection methods and easy to miss detection.
[0005] To achieve the above-mentioned purpose, the double-detection self-powered sensor for detecting sugarcane diseases provided by the present application comprises a nucleic acid amplification product M-based biological anode, an Au@MB-based biological cathode and an electrolyte; wherein the electrolyte comprises glucose, methylene blue PBS buffer and photothermal test solution.
[0006] Furthermore, the method for preparing the bioanode is as follows:
[0007] Add 20-60 μL of nucleic acid amplification product M to a 1 cm × 1 cm carbon cloth and incubate at 4 °C for 10-14 h.
[0008] The biological cathode is prepared as follows: 20-60 μL of Au@MB is dropped onto a 1 cm × 1 cm carbon cloth and incubated at 4 °C for 10-14 h.
[0009] Furthermore, the preparation method of the nucleic acid amplification product M is as follows:
[0010] Add 10-30 μL of the test sample to 50-80 μL of AB and incubate at 37°C for 20-80 min. Then add 50-100 μL of WS and incubate at 37°C for 20-80 min. Discard the supernatant and bring the volume to 50-100 μL with sterile, enzyme-free water. Add 60-120 μL of SG and incubate at 37°C for 20-80 min. Aspirate the supernatant to obtain the nucleic acid amplification product M.
[0011] Furthermore, the preparation method of AB is as follows:
[0012] Mix 20-60 μL of A and B and anneal at 95 °C for 5-10 min, then allow to cool naturally to room temperature to obtain AB; wherein A and B are of equal volume.
[0013] Furthermore, the preparation method of the WS is as follows:
[0014] Mix 20-60 μL of Walker1 and Lock1 in equal volumes and 20-60 μL of Walker2 and Lock2 in equal volumes, and incubate both at 37°C for 2-4 h. After mixing the two, add Au@MB and react at 4°C for 6-12 h. Discard the supernatant and make up the volume to 100-150 μL to obtain WS.
[0015] Furthermore, the preparation method of the SG is as follows:
[0016] Mix 20-60 μL of S1 and GOD in equal amounts and incubate at 37°C for 10-12 h. Mix 20-60 μL of S2 and AuCo-MOF in equal amounts and incubate at 4°C for 10-12 h. Mix the two and add Au@MB and react at 4°C for 6-12 h. Discard the supernatant and make up the volume to 100-150 μL to obtain SG.
[0017] Furthermore, the preparation method of the AuCo-MOF is as follows:
[0018] Dissolve 1-5 mmol of 3-amino-5-mercapto-1,2,4-triazole in 30-50 mL of methanol, add 1-5 mmol of CoCl2·6H2O and 1-2 mL of 2% HAuCl4, stir for 30-60 min, add 500-1500 μL of 4% dimethylimidazole solution, and add 0.5-1 mmol of sodium citrate solution, stir for 12-20 h, let stand to precipitate for 12-20 h, centrifuge, wash and dry to obtain AuCo-MOF.
[0019] Furthermore, the preparation method of Au@MB is as follows: In a glass test tube, 1-4 mL of carboxyl-modified Fe3O4 magnetic microspheres are mixed with 1-4 mL of HAuCl4 (1%), and ultrasonically treated for 20-80 min. Then, 1-4 mL of 2% sodium citrate solution is quickly added, and the mixture is gently shaken for about 4-6 h to obtain Au@MB.
[0020] The present invention also provides an application of the above-mentioned dual-detection self-powered sensor for detecting sugarcane diseases, wherein the application is used to detect whether sugarcane carries top rot pathogens and smut pathogens.
[0021] This invention also provides a method for detecting sugarcane top rot pathogens and sugarcane smut pathogens using the aforementioned dual-detection self-powered sensor for detecting sugarcane diseases. The method for detecting sugarcane top rot pathogens and sugarcane smut pathogens is as follows:
[0022] The collected analyte was added to prepare the corresponding nucleic acid amplification product M, and bioanode and biocathode were fabricated. These two components, together with the electrolyte, formed a self-powered sensor. The output current, electrolyte temperature, and electrolyte color change of the sensor were measured. If the electrolyte temperature increased, the output current remained unchanged, and the electrolyte color deepened, it indicated that the analyte carried only sugarcane top rot pathogens. If the output current increased, the electrolyte temperature remained unchanged, and the electrolyte color lightened, it indicated that the analyte carried only sugarcane smut pathogens. If the output current increased, the electrolyte temperature increased, and the electrolyte color significantly deepened, it indicated that the analyte carried both sugarcane smut pathogens and sugarcane top rot pathogens.
[0023] The DNA strand sequences used in this invention are shown in Table 1 (the genes were custom-synthesized by Shanghai Sangon Biotech Co., Ltd.):
[0024] Table 1. List of DNA strand sequences used
[0025]
[0026] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0027] (1) The nucleic acid amplification technology is used to efficiently amplify the nucleic acids of the pathogens of sugarcane smut and top rot, enabling the sensor to detect low concentrations of pathogens and effectively reducing the false negative rate. At the same time, multi-mode synergistic detection (electrochemical, colorimetric, photothermal) further improves the accuracy and specificity of detection, avoids misjudgment caused by signal cross-interference in traditional methods, and ensures the reliability of detection results;
[0028] (2) The detection process of this sensor is simple and quick. It can be completed in a short time from sample processing to result output, which greatly shortens the detection cycle and saves valuable time for timely prevention and control measures.
[0029] (3) It does not require an external power source or complex and sophisticated laboratory equipment, which greatly simplifies the testing process and reduces testing costs. This makes the sensor more suitable for use in field environments such as rural areas, improving the convenience and practicality of testing;
[0030] (4) It can detect sugarcane smut and top rot at the same time, avoiding the tedious operation of traditional methods to detect them one by one, saving manpower, material resources and time costs, and improving detection efficiency.
[0031] (5) The materials and reagents used are relatively environmentally friendly, with low risk of environmental pollution, and meet the requirements of sustainable development. Attached Figure Description
[0032] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention.
[0033] Figure 1 This is a schematic diagram of the preparation process of nucleic acid amplification product M in the dual-detection self-powered sensor for detecting sugarcane diseases of the present invention;
[0034] Figure 2 This is a schematic diagram of the assembly process of the biocathode and bioanode in the dual-detection self-powered sensor for detecting sugarcane diseases of the present invention;
[0035] Figure 3 This is a signal response diagram of the dual-detection self-powered sensor used in this invention for detecting sugarcane diseases, specifically for detecting the presence or absence of top rot. Figure 3 A is a schematic diagram of the sensor's current intensity when the detected substance contains only top rot pathogens. Figure 3 B is a schematic diagram showing the color state of the sensor's electrolyte when the only detectable substance is topspin rot pathogens. Figure 3 C is a schematic diagram showing the temperature change of the sensor's photothermal solution when the only detectable substance is *Tetal rot* pathogen. Figure 3 D is a schematic diagram of the color change of the photothermal solution in the sensor when the only detected substance is the top rot pathogen;
[0036] Figure 4 This is a signal response diagram of the dual-detection self-powered sensor used in this invention for detecting sugarcane diseases, specifically for detecting the presence or absence of smut. Figure 4 A is a schematic diagram of the sensor's current intensity when the only detectable substance is smut fungus. Figure 4 B is a schematic diagram showing the color state of the sensor's electrolyte when the only detectable substance is smut fungus. Figure 4 C is a schematic diagram showing the temperature change of the sensor's photothermal solution when the only detectable substance is smut fungus. Figure 4 D is a schematic diagram of the color change of the photothermal solution in the sensor when the only detectable substance is smut fungus;
[0037] Figure 5 This is a signal response diagram of the dual-detection self-powered sensor for detecting sugarcane diseases, which simultaneously detects smut and top rot. Figure 5 A is a schematic diagram of the sensor's current intensity when the sample simultaneously contains genes for sugarcane top rot and sugarcane smut. Figure 5 B is a schematic diagram showing the color state of the sensor's electrolyte when the analyte simultaneously contains genes for sugarcane top rot and smut. Figure 5 C is a schematic diagram illustrating the temperature change of the sensor's photothermal solution when the analyte simultaneously contains genes for sugarcane top rot and smut. Figure 5 D is a schematic diagram of the color change of the photothermal solution in the sensor when the analyte simultaneously contains genes for sugarcane top rot and smut.
[0038] Figure 6 This is a schematic diagram illustrating the linear relationship between gene concentration and various characterization parameters in the dual-detection self-powered sensor for detecting sugarcane diseases according to the present invention; wherein... Figure 6 A is a schematic diagram of the standard curve of sensor current intensity when the dual-detection self-powered sensor of this invention detects different concentrations of the analyte for detecting sugarcane diseases. Figure 6 B is a schematic diagram of the standard curve of the sensor electrolyte color when the dual-detection self-powered sensor of this invention detects different concentrations of the analyte for sugarcane diseases. Figure 6 C is a schematic diagram of the standard curve of the sensor photothermal solution temperature when the dual-detection self-powered sensor of this invention detects different concentrations of the analyte. Figure 6 D is a schematic diagram of the standard curve of the light absorption capacity of the photothermal solution in the sensor when the dual-detection self-powered sensor for detecting sugarcane diseases detects different concentrations of the analyte. Detailed Implementation
[0039] The specific embodiments of the present invention will be described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments.
[0040] Unless otherwise expressly stated, throughout the specification and claims, the term "comprising" or its variations such as "including" or "comprises" shall be understood to include the stated elements or components without excluding other elements or other components.
[0041] This invention proposes a dual-detection self-powered sensor for detecting sugarcane diseases, comprising a bioanode based on nucleic acid amplification product M, a biocathode based on Au@MB, and an electrolyte; wherein the electrolyte contains glucose, methylene blue PBS buffer, and a photothermal test solution. Further, the photothermal test solution is a mixture of 3,3',5,5'-tetramethylbenzidine (TMB) and hydrogen peroxide (H2O2). The function of the photothermal test solution is: when the nucleic acid amplification product M contains AuCo-MOF, AuCo-MOF acts as a peroxidase-like enzyme to decompose H2O2 and generate reactive oxygen species. Under the action of reactive oxygen species, TMB is oxidized into TMBox, which has a photothermal effect.
[0042] Example 1
[0043] like Figure 1 The amplification process of nucleic acid amplification product M is shown below:
[0044] (1) Mix 20 μL of A and B in equal amounts, anneal at 95 °C for 5 min, and then cool naturally to room temperature to obtain AB;
[0045] (2) Mix 20 μL of Walker1 with 20 μL of Lock1, and mix 20 μL of Walker2 with 20 μL of Lock2. After mixing the two mixtures, incubate at 37 °C for 2 h to form a specific structure recognized by AB. Then add gold nanomagnetic microspheres (i.e., Au@MB) and react at 4 °C for 6 h. Discard the supernatant and make up to 100 μL to obtain WS, which can be used for selective reaction with AB after the reaction.
[0046] (3) Mix 20 μL of S1 and 20 μL of GOD (i.e. glucose oxidase) and incubate at 37°C for 10 h. Mix 20 μL of S2 and 20 μL of AuCo-MOF and incubate at 4°C for 10 h. Mix the two mixtures and add Au@MB and react at 4°C for 6 h. Discard the supernatant and make up to 100 μL to obtain SG.
[0047] (4) Dissolve 1 mmol of 3-amino-5-mercapto-1,2,4-triazole in 30 mL of methanol, add 1 mmol of CoCl2·6H2O and 1 mL of 2% HAuCl4, stir for 30-60 min, add 500 μL of 4% dimethylimidazole solution, and add 1 mmol of sodium citrate solution, stir for 12 h, and let stand to precipitate for 12 h. Centrifuge, wash and dry to obtain AuCo-MOF;
[0048] (4) In a glass test tube, mix 1 mL of 5 mg / mL carboxyl-modified Fe3O4 magnetic microspheres with 1 mL of 1% HAuCl4, sonicate for 20 min, then quickly add 1 mL of 2% sodium citrate solution, and finally gently shake the mixture for about 4 h to obtain Au@MB;
[0049] (5) Add 10 μL of the test sample to 50 μL of AB and incubate at 37°C for 80 min. Then add 50 μL of WS and incubate at 37°C for 80 min. Discard the supernatant, bring the volume to 50 μL with sterile, enzyme-free water, and then add 60 μL of SG. Incubate at 37°C for 80 min, and aspirate the supernatant to obtain the nucleic acid amplification product M. The test sample is the extract obtained using a commercially available kit.
[0050] like Figure 2 The preparation of the bioanode and biocathode is shown in the figure: 20 μL of nucleic acid amplification product M was dropped onto a 1 cm × 1 cm carbon cloth and incubated at 4 °C for 10 h to obtain the bioanode. 20 μL of Au@MB was dropped onto a 1 cm × 1 cm carbon cloth and incubated at 4 °C for 10 h to obtain the biocathode.
[0051] Example 2
[0052] The amplification process of nucleic acid amplification product M is as follows:
[0053] (1) Mix 40 μL of A and B in equal amounts, anneal at 95 °C for 8 min, and then cool naturally to room temperature to obtain AB;
[0054] (2) Mix 40 μL of Walker1 and 40 μL of Lock1, and mix 40 μL of Walker2 and 40 μL of Lock2. After mixing the two mixtures, incubate at 37 °C for 3 h. Then add gold nanomagnetic microspheres (i.e., Au@MB) and react at 4 °C for 9 h. Discard the supernatant and make up to 125 μL to obtain WS.
[0055] (3) Mix 40 μL of S1 and 40 μL of GOD and incubate at 37 °C for 11 h. Mix 40 μL of S2 and 40 μL of AuCo-MOF and incubate at 4 °C for 11 h. Mix the two mixtures and add Au@MB and react at 4 °C for 9 h. Discard the supernatant and make up to 125 μL to obtain SG.
[0056] (4) Dissolve 3 mmol of 3-amino-5-mercapto-1,2,4-triazole in 40 mL of methanol, add 3 mmol of CoCl2·6H2O and 1 mL of 2% HAuCl4, stir for 30-60 min, add 1000 μL of 4% dimethylimidazole solution, and add 1 mmol of sodium citrate solution, stir for 16 h, and let stand to precipitate for 16 h. Centrifuge, wash and dry to obtain AuCo-MOF;
[0057] (4) In a glass test tube, 2 mL of 5 mg / mL carboxyl-modified Fe3O4 magnetic microspheres were mixed with 2 mL of 1% HAuCl4 and sonicated for 50 min. Then, 2 mL of 2% sodium citrate solution was quickly added. Finally, the mixture was gently shaken for about 5 h to obtain Au@MB.
[0058] (5) Drop 20 μL of the test sample into 65 μL of AB and incubate at 37°C for 60 min. Then add 75 μL of WS and incubate at 37°C for 60 min. Discard the supernatant, bring the volume to 80 μL with sterile enzyme-free water, add 90 μL of SG, and incubate at 37°C for 60 min. Absorb the supernatant to obtain the nucleic acid amplification product M.
[0059] like Figure 2 The preparation of the bioanode and biocathode is shown in the figure: 40 μL of nucleic acid amplification product M was dropped onto a 1 cm × 1 cm carbon cloth and incubated at 4 °C for 12 h to obtain the bioanode. 40 μL of Au@MB was dropped onto a 1 cm × 1 cm carbon cloth and incubated at 4 °C for 12 h to obtain the biocathode.
[0060] Example 3
[0061] The amplification process of nucleic acid amplification product M is as follows:
[0062] (1) Mix 60 μL of A and B in equal amounts, anneal at 95 °C for 10 min, and then cool naturally to room temperature to obtain AB;
[0063] (2) Mix 60 μL of Walker1 with 60 μL of Lock1, and mix 60 μL of Walker2 with 60 μL of Lock2. After mixing the two mixtures, incubate at 37 °C for 4 h. Then add Au@MB and react at 4 °C for 12 h. Discard the supernatant and make up to 150 μL to obtain WS.
[0064] (3) Mix 60 μL of S1 and 60 μL of GOD and incubate at 37 °C for 12 h. Mix 60 μL of S2 and 60 μL of AuCo-MOF and incubate at 4 °C for 12 h. Mix the two mixtures and add Au@MB and react at 4 °C for 12 h. Discard the supernatant and make up to 150 μL to obtain SG.
[0065] (4) Dissolve 5 mmol of 3-amino-5-mercapto-1,2,4-triazole in 50 mL of methanol, add 5 mmol of CoCl2·6H2O and 2 mL of 2% HAuCl4, stir for 30-60 min, add 1500 μL of 4% dimethylimidazole solution, and add 0.5 mmol of sodium citrate solution. Stir for 20 h, and let stand to precipitate for 20 h. Centrifuge, wash and dry to obtain AuCo-MOF;
[0066] (4) In a glass test tube, 4 mL of 5 mg / mL carboxyl-modified Fe3O4 magnetic microspheres were mixed with 4 mL of 1% HAuCl4 and sonicated for 80 min. Then, 4 mL of 2% sodium citrate solution was quickly added. Finally, the mixture was gently shaken for about 6 h to obtain Au@MB.
[0067] (5) Drop 30 μL of the test sample into 80 μL of AB and incubate at 37°C for 80 min. Then add 100 μL of WS and incubate at 37°C for 80 min. Discard the supernatant, bring the volume to 100 μL with sterile enzyme-free water, add 120 μL of SG, and incubate at 37°C for 80 min. Absorb the supernatant to obtain the nucleic acid amplification product M.
[0068] like Figure 2 The preparation of the bioanode and biocathode is shown in the figure: 60 μL of nucleic acid amplification product M was dropped onto a 1 cm × 1 cm carbon cloth and incubated at 4 °C for 14 h to obtain the bioanode. 60 μL of Au@MB was dropped onto a 1 cm × 1 cm carbon cloth and incubated at 4 °C for 14 h to obtain the biocathode.
[0069] Example 4
[0070] The preparation process of step (5) in Example 1 is as follows: 10 μL of the detection sample is dropped into 50 μL of AB and incubated at 37°C for 20 min. Then, 50 μL of WS is added and incubated at 37°C for 20 min. The supernatant is discarded, and the volume is adjusted to 50 μL with sterile enzyme-free water. Then, 60 μL of SG is added and incubated at 37°C for 20 min. The supernatant is then aspirated to obtain the nucleic acid amplification product M. The rest is the same as in Example 1.
[0071] The bioanodes and biocathodes obtained in Examples 1 to 4 were used to construct a self-powered sensor with an electrolyte. The output current, electrolyte temperature, and electrolyte color of the sensor were measured and compared with the bare electrode (corresponding to the blank items in Table 1). As shown in Table 2 below, it is evident that the output current, electrolyte temperature, and electrolyte color of the self-powered sensor constructed based on Examples 1 to 4 are significantly different from those of the bare electrode, enabling rapid and efficient identification of the two diseases.
[0072] Table 2. Variations in the construction of a self-powered sensor in Examples 1 to 4 and the blank item.
[0073]
[0074] The present invention also provides an application of a dual-detection self-powered sensor for detecting sugarcane diseases, used to detect whether sugarcane carries top rot pathogens and smut pathogens.
[0075] The self-powered sensor detects smut and top rot on the following principle: Figure 1 As shown, a nucleic acid amplification scheme based on DNA logic hairpin gating was designed. Target sequences specific to Smut or Pokkah smut unfold different stems of the hairpin, initiating an orthogonal amplification cascade reaction. When Smut is present, its complementary region opens stem A, forming a Smut-A double strand. This complex hybridizes with the Lock1 strand on the D-walker scaffold, activating Walker1. In Mg... 2+ In the presence of the target, activated Walker1 cleaves substrate S1 at the rA site, releasing glucose oxidase (GOD). GOD oxidizes glucose, generating an electrochemical current and a visible color change in the electrolyte. In the presence of Pokkah, stem B is opened, producing a Pokkah-B double strand, which docks with Lock1 on the same scaffold and triggers Walker1. Walker1 similarly cleaves S2, releasing AuCo-MOF. This AuCo-MOF exhibits peroxidase-like activity, catalyzing the oxidation of TMB to blue TMBox in TMB-H2O2 medium, accompanied by a strong photothermal response. When both targets are present simultaneously, both walkers are activated, releasing both GOD and AuCo-MOF. The electrochemical signal generated by GOD and the color / photothermal signal generated by TMBox are recorded simultaneously, enabling one-pot differentiation of Smut and Pokkah.
[0076] The performance of this self-powered sensor in detecting shoot rot is characterized as follows:
[0077] like Figure 3 As shown, when the sample only contains the top rot disease gene, such as Figure 3 The sensor current shown in Figure A is less than 1μA, such as Figure 3 The electrolyte shown in B maintains a stable color. When 3,3',5,5'-tetramethylbenzidine (TMB) in the photothermal solution is oxidized to TMBox, the photothermal effect is significantly enhanced, as shown in Figure B. Figure 3 C and Figure 3As shown in Figure D, the photothermal solution exhibits increased light absorption, a rise in temperature, and a deepening of color. The photothermal effect works by the TMBox molecules transitioning from their ground state to an excited state after photon energy is absorbed by the TMBox under 808 nm laser irradiation. Subsequently, the excited molecules release the absorbed energy as heat through a non-radiative relaxation process, leading to an increase in the ambient temperature. This provides a unique photothermal signal identifier that can be acquired by a digital multimeter for the accurate detection of shoot rot. This specific response to a single disease not only demonstrates the sensor's high selectivity but also enhances the reliability and readability of the detection results through multi-dimensional signal output. It helps to accurately identify and quantify shoot rot genes in complex sample contexts, providing strong support for subsequent disease assessment and control decisions.
[0078] The performance of this self-powered sensor in detecting smut is characterized as follows: Figure 4 As shown, when the test sample contains only the smut virus gene, the nucleic acid amplification product M will contain GOD, such as... Figure 4 C and Figure 4 As shown in Figure D, the sensor maintains its original photothermal response and photothermal solution color without significant changes. However, with the increase of the smut gene, the amount of GOD increases accordingly, leading to enhanced anodic oxidation capability of the sensor, such as... Figure 4 A and Figure 4 As shown in Figure B, the sensor's current output exhibits a significant increasing trend, while the electrolyte color gradually lightens due to the reduction of methylene blue by the cathode. This response mode precisely corresponds to the presence of the smut gene, providing a highly specific electrochemical signal and visual identifier for detection. This further verifies the sensor's superior performance and reliability in the independent detection of multiple diseases, ensuring accurate identification and quantitative analysis of smut in complex samples, and providing solid data support for the formulation of subsequent disease control strategies.
[0079] The performance of this self-powered sensor in detecting both smut and top rot is characterized as follows: Figure 5 As shown, when the genes for sugarcane top rot and smut coexist in the test sample, the sensor response exhibits a unique cooperative change pattern. During this process, such as... Figure 5 A and Figure 5 As shown in Figure B, the sensor's current intensity is significantly enhanced, while the electrolyte color changes significantly. Regarding the photothermal response, as... Figure 5 C and Figure 5As shown in Figure D, the sensor also exhibits significant changes in photothermal effects, with a more pronounced deepening of the solution color. This synergistic change in multi-dimensional signals provides a precise and intuitive indication for the simultaneous detection of sugarcane top rot and smut. By comprehensively analyzing the multiple changes in current, electrolyte color, and photothermal effects, rapid and efficient identification of the two diseases can be achieved, ensuring accurate identification of disease type and infection degree in complex sample environments. The degree of infection can be determined by the different signal intensities caused by different concentrations of pathogens, providing a strong basis for timely and targeted control measures.
[0080] The detection method of this self-powered sensor for simultaneously detecting top rot and sugarcane smut is as follows: The collected analyte is added to prepare the corresponding nucleic acid amplification product M, and a bioanode and biocathode are fabricated. These, along with the electrolyte, form a self-powered sensor. The output current, electrolyte temperature, and electrolyte color change of the sensor are measured. If the electrolyte temperature rises, the output current remains unchanged, and the electrolyte color deepens, it indicates that the analyte carries only the sugarcane top rot pathogen. If the output current increases, the electrolyte temperature remains unchanged, and the electrolyte color lightens, it indicates that the analyte carries only the sugarcane smut pathogen. If the output current increases, the electrolyte temperature rises, and the electrolyte color significantly deepens, it indicates that the analyte carries both the sugarcane smut pathogen and the sugarcane top rot pathogen.
[0081] Furthermore, through the experimental process, bioanodes and biocathodes were fabricated using different concentrations of the analyte, and a self-powered sensor was constructed with the electrolyte to measure the corresponding output current, electrolyte temperature, and electrolyte color, thus establishing a linear model. Specifically, when the smut gene (test concentration range of 10) was detected... -12 - 10 -8 When M is present in the sample being detected, the current intensity of the sensor shows a significant increasing trend. Specifically, such as Figure 6 As shown in Figure A, a good linear relationship exists between the current intensity and gene concentration, with the linear equation Current = 2.24 lg C + 43.80 and a high goodness of fit R² = 0.998. Meanwhile, as... Figure 6 The color change of the electrolyte shown in B is also very significant. The linear equation between its RGB blue light value and gene concentration is RGB Blue = 8.65 lg C + 313.26, with a goodness of fit R² = 0.998. Figure 6 C and Figure 6 As shown in D, when the shoot rot gene (test concentration range is also 10) is present... -12 - 10 -8When M is present in the sample, the photothermal solution of the sensor exhibits a significant change in photothermal effect. A clear linear relationship exists between solution temperature and gene concentration, with the linear equation being Temperature = 6.27 lg C + 115.58, and a goodness-of-fit R². 2 = 0.997, at which point the solution color intensifies more significantly. The linear equation between the RGB blue light value and gene concentration is RGB Blue = -12.04 lg C + 91.09, with a goodness of fit R. 2 = 0.993. These results indicate that the sensor has high sensitivity and specificity for the detection of two pathogen genes, and can accurately reflect the presence and concentration level of pathogen genes in the sample through multiple signal output methods such as current intensity, solution temperature, and color change.
[0082] In summary, nucleic acid amplification technology enables efficient amplification of nucleic acids for the pathogens of sugarcane smut and top rot. This process significantly improves detection sensitivity, allowing for accurate identification of pathogens even at extremely low concentrations, effectively solving the problems of insufficient sensitivity and missed detection in traditional methods. Furthermore, this self-powered sensor cleverly integrates electrochemical, colorimetric, and photothermal detection modes. Based on nucleic acid amplification, these three modes work synergistically to form a multi-dimensional detection system. Through the comprehensive application of these three detection modes, the sensor generates signals with distinct distinguishable characteristics, effectively avoiding signal cross-interference problems in traditional methods, ensuring the reliability of detection results, achieving accurate identification of low-concentration pathogens, and its self-powered design makes it suitable for field testing, offering advantages such as ease of operation, low cost, high efficiency, and reliable detection results.
[0083] The above description is merely a preferred embodiment of the present invention and does not limit the patent scope of the present invention. Any equivalent structural transformations made using the contents of the present invention's specification and drawings under the inventive concept of the present invention, or direct / indirect applications in other related technical fields, are included within the patent protection scope of the present invention.
Claims
1. A dual-detection self-powered sensor for detecting sugarcane diseases, characterized in that, include: Bioanode based on nucleic acid product M, biocathode based on gold nanomagnetic microspheres Au@MB, electrolyte and photothermal test solution; The electrolyte is a PBS buffer containing glucose and methylene blue; the photothermal test solution is a mixture of 3,3',5,5'-tetramethylbenzidine (TMB) and hydrogen peroxide (H2O2). The preparation method of the bioanode is as follows: 20-60 μL of nucleic acid product M is dropped onto a 1 cm × 1 cm carbon cloth and incubated at 4 °C for 10-14 h; The preparation method of the biocathode is as follows: 20-60 μL of Au@MB is dropped onto a 1 cm × 1 cm carbon cloth and incubated at 4 °C for 10-14 h; The preparation method of the nucleic acid product M is as follows: Add 10-30 μL of the sample to 50-80 μL of AB and incubate at 37°C for 20-80 min. Then add 50-100 μL of WS and incubate at 37°C for 20-80 min. Discard the supernatant and bring the volume to 50-100 μL with sterile enzyme-free water. Add 60-120 μL of SG and incubate at 37°C for 20-80 min. Aspirate the supernatant to obtain the nucleic acid product M. The preparation method of AB is as follows: Mix 20-60 μL of A and B and anneal at 95 °C for 5-10 min, then allow to cool naturally to room temperature to obtain AB; wherein A and B are of equal volume. The preparation method of the WS is as follows: Mix 20-60 μL of Walker1 and Lock1 in equal amounts and mix 20-60 μL of Walker2 and Lock2 in equal amounts. Incubate both at 37°C for 2-4 h. After mixing the two, add Au@MB and react at 4°C for 6-12 h. Discard the supernatant and make up the volume to 100-150 μL to obtain WS. The preparation method of the SG is as follows: 20-60 μL of S1 and GOD were mixed in equal amounts and incubated at 37°C for 10-12 h. 20-60 μL of S2 and AuCo-MOF were mixed in equal amounts and incubated at 4°C for 10-12 h. Au@MB was then added to the mixture and reacted at 4°C for 6-12 h. The supernatant was discarded and the volume was adjusted to 100-150 μL to obtain SG. AuCo-MOF acts as a peroxidase-like enzyme, decomposing H2O2 to produce reactive oxygen species. Under the action of these reactive oxygen species, TMB is oxidized into oxTMB, which has a photothermal effect. Wherein, the gene sequence of A is: GCTTGGTTCATCAACCAAGACCAGAGCGCGCCGG; the gene sequence of B is: TCATTACCGAGTTTACGATTGCCTCGGTAATGACCGGCGC; the gene sequence of Lock1 is: CCGGCGCGCTCTGGTCTTGGTTGA; the gene sequence of Lock2 is: GCGCCGGTCATTACCGAGGCAATC; and the gene sequence of Walker1 is: TCAACCAAGTCCGAGCCGGTCGAAAGCGCGCCGG(T) 42 -SH; The gene sequence of Walker2 is: GATTGCCTTCCGAGCCGGTCGAAATGACCGGCGC(T) 42 -SH; The gene sequence of S1 is: SH-(T)7CCGGCGCGCT / rA / CTTGGTTGACACCACACCTTT-NH2; The gene sequence of S2 is: SH-(T)7GCGCCGGTCAT / rA / AGGCAATCTTTTTT-NH2.
2. The dual-detection self-powered sensor for detecting sugarcane diseases according to claim 1, characterized in that, The preparation method of the AuCo-MOF is as follows: Dissolve 1-5 mmol of 3-amino-5-mercapto-1,2,4-triazole in 30-50 mL of methanol, add 1-5 mmol of CoCl2·6H2O and 1-2 mL of 2% HAuCl4, stir for 30-60 min, add 500-1500 μL of 4% dimethylimidazole solution, and add 0.5-1 mmol of sodium citrate solution, stir for 12-20 h, let stand to precipitate for 12-20 h, centrifuge, wash and dry to obtain AuCo-MOF.
3. The dual-detection self-powered sensor for detecting sugarcane diseases according to claim 1, characterized in that, The preparation method of Au@MB is as follows: In a glass test tube, 1-4 mL of carboxyl-modified Fe3O4 magnetic microspheres are mixed with 1-4 mL of HAuCl4 and sonicated for 20-80 min. Then, 1-4 mL of 2% sodium citrate solution is added and the mixture is gently shaken for about 4-6 h to obtain Au@MB.
4. An application of the dual-detection self-powered sensor for detecting sugarcane diseases as described in any one of claims 1 to 3, characterized in that, The sugarcane diseases mentioned are top rot pathogens and smut pathogens.
5. A method for detecting sugarcane top rot pathogens and sugarcane smut pathogens using a dual-detection self-powered sensor for detecting sugarcane diseases as described in any one of claims 1 to 3, characterized in that, The methods for detecting the pathogens of sugarcane top rot and sugarcane smut are as follows: The collected analytes are added to prepare the corresponding nucleic acid product M, and bioanodes and biocathodes are fabricated. These two components, along with the electrolyte and photothermal test solution, form a self-powered sensor. The output current, electrolyte color, photothermal test solution temperature, and photothermal test solution color change of the sensor are measured. By comprehensively analyzing the multiple changes in output current, electrolyte color, photothermal test solution temperature, and photothermal test solution color, the two diseases can be identified.
Citation Information
Patent Citations
Preparation method of self-powered biosensor for dual-mode detection of thalassemia gene CD122
CN116448838A
Self-energized sensor for detecting sugarcane smut pathogenic bacteria and preparation method of self-energized sensor
CN119619246A