Compositions and methods for genome editing

Abstract

Disclosed herein are methods and compositions for functional genetic modification at a selected site. Also provided are cell populations comprising targeted integration of one or more exogenous polynucleotides and / or insertion deletions at one or more selected loci.

Description

[0001] Related applications

[0002] This application claims priority and interest in U.S. Provisional Application No. 63 / 486,172, filed February 21, 2023. The contents of that application are incorporated herein by reference in their entirety.

[0003] Reference to electronic sequence listing

[0004] The contents of the electronic sequence list (POTH-079_001WO_SeqListing_ST26.xml; size: 179,192 bytes; and creation date: February 12, 2024) are incorporated herein by reference in their entirety. Technical Field

[0005] This disclosure relates to the fields of gene editing and genome engineering. More particularly, this disclosure relates to compositions and methods for targeted genetic modifications. Background Technology

[0006] Genome editing refers to strategies and techniques for targeted and specific modification of the genetic information (genome) of a living organism. Genome engineering is an active research field due to its wide range of potential applications, particularly in human health, such as correcting genes carrying harmful mutations or exploring gene function. Early techniques developed for inserting transgenes into living cells were often limited by the randomness of the insertion location of the new sequence into the genome. Compared to earlier techniques, common genome editing strategies allow modification of specific regions of DNA, thereby improving the precision of correction or insertion. While these platforms offer greater reproducibility and reduce the level of unintended effects from random insertions and deletions in the genome, limitations remain. There is a need to develop gene editing platforms and fusion proteins with superior efficacy in genome editing. There is also a need to develop safe and effective donor cells to support cell therapy treatments involving diseases related to regenerative medicine and / or immuno-oncology using such gene editing platforms. Summary of the Invention

[0007] This disclosure provides a polypeptide comprising the amino acid sequence of SEQ ID NO:76. This disclosure also provides a polynucleotide encoding the polypeptide, a carrier comprising the polypeptide, and a pharmaceutical composition comprising the carrier and at least one pharmaceutical excipient or diluent.

[0008] The present disclosure also provides a method of modifying a target sequence in a genome of a plurality of cells, the method comprising introducing into a population of unmodified cells a composition comprising: a) a polypeptide comprising the amino acid sequence of SEQ ID NO: 76 or a polynucleotide encoding the polypeptide of SEQ ID NO: 76; and b) at least one guide RNA (gRNA), thereby generating a modification at the target sequence in the genome, and wherein 1.1-fold to 100-fold more of the plurality of cells comprise the modification at the target sequence in the genome as compared to a plurality of modified cells introduced with a composition comprising a polypeptide comprising the amino acid sequence of SEQ ID NO: 10 or a polynucleotide encoding the polypeptide of SEQ ID NO: 10.

[0009] In some aspects, 1.6-fold to 3.2-fold more of the plurality of cells comprise a modification at a target sequence in a genome as compared to a plurality of modified cells introduced with a composition comprising a polypeptide comprising the amino acid sequence of SEQ ID NO: 10 or a polynucleotide encoding the polypeptide of SEQ ID NO: 10. In some aspects, 4-fold to 75-fold more of the plurality of cells comprise a modification at a target sequence in a genome as compared to a plurality of modified cells introduced with a composition comprising a polypeptide comprising the amino acid sequence of SEQ ID NO: 10 or a polynucleotide encoding the polypeptide of SEQ ID NO: 10.

[0010] In some aspects, the modification at a target sequence in a genome is a deletion, an insertion, a substitution, an inversion, and / or a relocation.

[0011] In some aspects, the composition is encapsulated in at least one lipid nanoparticle comprising: about 40.75% of a compound of Formula (I) by molar,

[0012] Formula (I)

[0013]

[0014] about 51.75% of cholesterol by molar, about 5% of DOPC by molar, and about 2.5% of DMG- PEG2000 by molar; wherein the polynucleotide encoding the polypeptide of SEQ ID NO: 76 is an RNA molecule, and wherein the ratio of lipids to RNA molecules in at least one nanoparticle is about 120: 1 (w / w).

[0015] In some aspects, the composition is encapsulated in at least one lipid nanoparticle comprising: about 54% by mole SS-OP, about 35% by mole cholesterol, about 5% by mole DOPC, about 5% by mole DSPC, and about 1% by mole DMG-PEG2000, wherein the polynucleotide encoding the polypeptide of SEQ ID NO: 76 is an RNA molecule, and wherein the ratio of lipids to RNA molecules in the at least one nanoparticle is about 100: 1 (w / w) and the total lipid is 25 nM.

[0016] In some aspects, the plurality of cells comprises: (a) a liver cell, preferably wherein the liver cell is a hepatocyte, a hepatic stellate cell, a Kupffer cell, or a liver sinusoidal endothelial cell; (b) a T cell, preferably wherein the T cell is an activated T cell, a resting T cell, or a stem memory T cell (T SCM cell); or (c) a hematopoietic stem cell (HSC).

[0017] The present disclosure also provides a cell modified according to any of the methods of the present disclosure. The present disclosure also provides a composition comprising a population of cells modified according to any of the methods of the present disclosure.

[0018] The present disclosure also provides a method of treating at least one disease or condition in a subject in need thereof, the method comprising administering to the subject at least one therapeutically effective amount of a composition, a pharmaceutical composition, or a cell described herein. In some aspects, the at least one disease or condition is a liver disease or condition, preferably wherein the liver disease or condition is: (a) a metabolic liver disorder; (b) a urea cycle disorder (UCD), preferably wherein the UCD is N-acetylglutamate synthetase (NAGS) deficiency, carbamoyl phosphate synthetase I deficiency (CPS I deficiency), ornithine transcarbamylase (OTC) deficiency, argininosuccinic acid synthetase deficiency (ASSD) (citrinemia I), citrin deficiency (citrinemia II), argininosuccinic acid lyase deficiency (argininosuccinic aciduria), arginase deficiency (hyperargininemia), ornithine translocase deficiency (HHH syndrome), or any combination thereof. In some aspects, the at least one disease or condition is a cancer. In some aspects, the at least one disease or condition is hemophilia A.

[0019] All documents cited herein, including any cross-referenced or related patents or applications, are hereby incorporated by reference in their entirety as if each had been individually incorporated. The citation of any document is not to be construed as an admission that it is prior art with respect to any application disclosed herein or that it has any relevance to the patentability of any application disclosed herein. To the extent that any meaning or definition of a term in this document conflicts with any meaning or definition of the same term in a document incorporated by reference, the meaning or definition assigned to the term in this document shall prevail. DETAILED DESCRIPTION

[0020] The present disclosure provides a method for genetically modifying a genome to include a polynucleotide insertion, deletion, and / or substitution. In particular, the present disclosure overcomes problems associated with current technologies by providing a method for efficiently genetically modifying a cell genome to include a polynucleotide insertion, deletion, and / or substitution. This is advantageous for modification of genes corresponding to disease phenotypes, which are of significant interest for therapeutic purposes. This is advantageous for providing a higher yield of modified cells compared to current technologies, which in turn facilitates production of cells for therapeutic use.

[0021] The present disclosure is based at least in part on the discovery that genetic modification of cells using compositions comprising Cas-CLOVER mutants results in a higher deletion rate compared to wild-type Cas-CLOVER (NLS-dCas9-Clo051-NLS) or conventional CRISPR / Cas9 systems. Structural modeling and sequence analysis of the Clo051 endonuclease domain of Cas-CLOVER relative to other nuclease domains (e.g., Fokl nuclease domain) revealed several conserved amino acid positions that produce hyperactivity, thereby providing a functional enhancement. Modification of serine to proline at positions within the conserved a-helix loop produces a stabilizing effect because proline alters the turn of the loop and reduces the degrees of freedom at this end of the loop helix. In addition, proline can still interact with the phosphate backbone portion of the bound DNA within acceptable hydrogen bond distances (e.g., about 3 A or less), thereby preserving the potential interaction that has been observed at this position for wild-type Clo051 endonuclease. Use of mutant Cas-CLOVER comprising mutant Clo051 endonuclease or portions thereof results in functional enhancements, such as improved genome editing and knock-in and knock-out efficiency.

[0022] ​Accordingly, the present application provides an efficient, reliable and targeted method for transient or stable integration of one or more exogenous genes and maintenance of high viability and functional responses of the genes in various cell types such as expanded iPSCs as well as differentiated cells derived from modified iPSCs including but not limited to HSCs (hematopoietic stem and progenitor cells), T cell progenitors, NK cell progenitors, T cells, NKT cells, NK cells. These are useful for developing safe and effective universal donor cells to support cell therapy treatments (e.g., of regenerative medicine or immuno-oncology related diseases).

[0023] The present disclosure overcomes problems associated with current technologies by providing compositions comprising genetically engineered fusion molecules (e.g., mutants of Cas-CLOVER) for targeted reduction or elimination of gene products in cells for in vivo gene therapy. Compositions comprising genetically engineered fusion molecules of the present disclosure are useful for treating genetic diseases. Non-limiting examples include liver diseases, diseases associated with hepatocytes, sickle cell disease, or beta thalassemia. Accordingly, also provided are methods of making genetically engineered fusion molecules and pharmaceutical formulations thereof for in vivo delivery (e.g., lipid nanoparticle formulations).

[0024] The present disclosure is based at least in part on the discovery that a modest fold increase in editing activity provided by mutant Cas-CLOVERs of the present disclosure (e.g., in the range of 1.5 to 3 fold) relative to wild-type Cas-CLOVER can have a significant impact on in vivo therapeutic applications. This increase can translate into a difference between a useless therapeutic index of 25% to 50% and a useful therapeutic index of 75%, where most of the diseased (mutant) or disease-associated alleles can be inactivated, including bi-allelic editing. As a non-limiting example, for HBG locus targeting, the improved magnitude provided by mutant Cas-CLOVERs of the present disclosure can span a critical therapeutic threshold to enable full activation of fetal hemoglobin (HbF) expression, which would provide therapeutic efficacy for functional correction of sickle cell disease or beta thalassemia. Alternatively, the increased activity of mutant Cas-CLOVERs can enable a reduction in the dose of the therapeutic product administered, which would be beneficial for tolerability and toxicity.

[0025] Methods for targeted genome editing at selected loci

[0026] Gene editing compositions and methods

[0027] Modified cells can be produced by introducing a transgene into the cell. The introducing step can include delivering a nucleic acid sequence, a transgene, and / or a genome editing construct via a non-transposon delivery system.

[0028] Introducing a nucleic acid sequence, transgene, and / or genome editing construct ex vivo, in vivo, in vitro, or in situ into a cell can include one or more of local delivery, adsorption, absorption, electroporation, spin infection, co-culture, transfection, mechanical delivery, sonic wave delivery, vibrational delivery, magnetofection, or delivery mediated by a nanoparticle. Introducing a nucleic acid sequence, transgene, and / or genome editing construct ex vivo, in vivo, in vitro, or in situ into a cell can include liposome transfection, calcium phosphate transfection, fugene transfection, and dendrimer-mediated transfection. Introducing a nucleic acid sequence, transgene, and / or genome editing construct ex vivo, in vivo, in vitro, or in situ into a cell by mechanical transfection can include cell extrusion, cell bombardment, or biolistics. Introducing a nucleic acid sequence, transgene, and / or genome editing construct ex vivo, in vivo, in vitro, or in situ into a cell by nanoparticle-mediated transfection can include liposome delivery, delivery via micelles, and delivery via polymerosomes.

[0029] Introducing a nucleic acid sequence, transgene, and / or genome editing construct ex vivo, in vivo, in vitro, or in situ into a cell can include a non-viral vector. The non-viral vector can comprise a nucleic acid. The non-viral vector can comprise a plasmid DNA, a linear double-stranded DNA (dsDNA), a linear single-stranded DNA (ssDNA), a DoggyBone DNA, a nanoplasmid, a minicircle DNA, a single-stranded oligodeoxynucleotide (ssODN), a double-stranded oligonucleotide (dsODN), a single-stranded mRNA (ssRNA), and a double-stranded mRNA (dsRNA). The non-viral vector can comprise a transposon as described herein. TM Introducing a nucleic acid sequence, transgene, and / or genome editing construct ex vivo, in vivo, in vitro, or in situ into a cell can include a non-viral vector. The non-viral vector can comprise a nucleic acid. The non-viral vector can comprise a plasmid DNA, a linear double-stranded DNA (dsDNA), a linear single-stranded DNA (ssDNA), a DoggyBone DNA, a nanoplasmid, a minicircle DNA, a single-stranded oligodeoxynucleotide (ssODN), a double-stranded oligonucleotide (dsODN), a single-stranded mRNA (ssRNA), and a double-stranded mRNA (dsRNA). The non-viral vector can comprise a transposon as described herein.

[0030] Introducing a nucleic acid sequence, transgene, and / or genome editing construct ex vivo, in vivo, in vitro, or in situ into a cell can include a viral vector. The viral vector can be a non-integrative non-chromosomal vector. Non-limiting examples of non-integrative non-chromosomal vectors include an adeno-associated virus (AAV), an adenovirus, and a herpes virus. The viral vector can be an integrative chromosomal vector. Non-limiting examples of integrative chromosomal vectors include an adeno-associated vector (AAV), a lentivirus, and a gamma-retrovirus.

[0031] Introducing a nucleic acid sequence, transgene, and / or genome editing construct ex vivo, in vivo, in vitro, or in situ into a cell can include a combination of vectors. Non-limiting examples of vector combinations include a viral vector and a non-viral vector, a plurality of non-viral vectors, or a plurality of viral vectors. Non-limiting examples of vector combinations include a combination of a DNA-derived vector and an RNA-derived vector, a combination of an RNA and a reverse transcriptase, a combination of a transposon and a transposase, a combination of a non-viral vector and an endonuclease, and a combination of a viral vector and an endonuclease.

[0032] Genomic modification can include introducing a nucleic acid sequence, transgene, and / or genome editing construct into a cell ex vivo, in vivo, in vitro, or in situ to stably integrate the nucleic acid sequence, transiently integrate the nucleic acid sequence, produce site-specific integration of the nucleic acid sequence, or produce biased integration of the nucleic acid sequence. The nucleic acid sequence can be a transgene.

[0033] The nucleic acid sequence or transgene can be about 1 kb to about 15 kb in size. The nucleic acid sequence or transgene can be at least 1 kb, at least 2 kb, at least 3 kb, at least 4 kb, at least 5 kb, at least 6 kb, at least 7 kb, at least 8 kb, at least 9 kb, at least 10 kb, at least 11 kb, at least 12 kb, at least 13 kb, at least 14 kb, at least 15 kb in size. The nucleic acid sequence or transgene can be about 1 kb, about 2 kb, about 3 kb, about 4 kb, about 5 kb, about 6 kb, about 7 kb, about 8 kb, about 9 kb, about 10 kb, about 11 kb, about 12 kb, about 13 kb, about 14 kb, or about 15 kb in size.

[0034] Genomic modification can include introducing a nucleic acid sequence, transgene, and / or genome editing construct into a cell ex vivo, in vivo, in vitro, or in situ to stably integrate the nucleic acid sequence. Stable chromosomal integration can be random integration, site-specific integration, or biased integration. Site-specific integration can be non-assisted or assisted. Assisted site-specific integration is co-delivered with a site-directed nuclease. The site-directed nuclease comprises a transgene comprising a percent homology to upstream and downstream regions of a genomic integration site with 5' and 3' nucleotide sequence extensions. The transgene with homologous nucleotide extensions enables genomic integration by homologous recombination, microhomology-mediated end joining, or non-homologous end joining. Site-specific integration can be performed at a safe harbor site. A genomic safe harbor site is capable of accommodating integration of new genetic material in a manner that ensures that the newly inserted genetic element functions reliably (e.g., expresses at a therapeutically effective expression level) and does not cause deleterious alterations to the host genome, thereby posing a risk to the host organism. Non-limiting examples of potential genomic safe harbors include an intronic sequence of the human albumin gene, the adeno-associated virus site 1 (AAVS1), the naturally occurring integration site for the adeno-associated virus on chromosome 19, the site of the chemokine (C-C motif) receptor 5 (CCR5) gene, and the site of the human ortholog of the mouse Rosa26 locus.

[0035] Site-specific transgene integration can occur at a site that disrupts expression of a target gene. Disruption of expression of a target gene can occur by site-specific integration at an intron, exon, promoter, genetic element, enhancer, suppressor, start codon, stop codon, and response element. Non-limiting examples of target genes targeted by site-specific integration include TRAC, TRAB, PDI, any immunosuppression gene, and a gene involved in allograft rejection.

[0036] Site-specific transgene integration can occur at a site that causes enhancement of expression of a target gene. Enhancement of expression of a target gene can occur by site-specific integration at an intron, exon, promoter, genetic element, enhancer, suppressor, start codon, stop codon, and response element.

[0037] Enzymes can be used to create a strand break in a host genome to facilitate delivery or integration of a transgene. Enzymes can create a single strand break or a double strand break. Non-limiting examples of break-inducing enzymes include transposases, integrases, endonucleases, CRISPR / Cas9, transcription activator-like effector nucleases (TALENs), zinc finger nucleases (ZFNs), Cas-CLOVER TM and CPF1. Break-inducing enzymes can be delivered to a cell encoded in DNA, encoded in mRNA, as a protein, or as a ribonucleoprotein complex with a guide RNA (gRNA). Non-limiting examples of break-inducing enzymes are described in PCT / US2016 / 037922, PCT / US2018 / 066941, PCT / US2017 / 054799, each incorporated by reference in its entirety. Exemplary mutant Cas-CLOVER break-inducing enzymes of the present disclosure are also described below.

[0038] Site-specific transgene integration can be controlled by vector-mediated integration site bias.

[0039] Site-specific transgene integration sites can be unstable chromosomal insertions. The integrated transgene can be silenced, removed, excised, or further modified. The genomic modification can be a non-stable integration of a transgene. The non-stable integration can be a transient non-chromosomal integration, a semi-stable non-chromosomal integration, a semi-persistent non-chromosomal insertion, or a non-stable chromosomal insertion. The transient non-chromosomal insertion can be an epichromosomal or cytoplasmic. In an aspect, the transient non-chromosomal insertion of a transgene does not integrate into a chromosome, and the modified genetic material is not replicated during cell division.

[0040] Genomic modification can be semi-stable or persistent non-chromosomal integration of the transgene. The DNA vector encodes a scaffold / matrix attachment region (S-MAR) module that binds to nuclear matrix proteins, which is used for episomal retention of the non-viral vector, allowing autonomous replication in the nucleus of dividing cells.

[0041] Genomic modification can be non-stable chromosomal integration of the transgene. The integrated transgene can be silenced, removed, excised, or further modified.

[0042] Modifications to the genome by transgene insertion can occur via host cell directed double strand break repair (homology directed repair) by homologous recombination (HR), microhomology-mediated end joining (MMEJ), non-homologous end joining (NHEJ), transposase-mediated modification, integrase-mediated modification, endonuclease-mediated modification, or recombinase-mediated modification. Modifications to the genome by transgene insertion can occur via CRISPR / Cas9, TALEN, ZFN, Cas-CLOVER TM and cpf1. Non-limiting examples of break inducing enzymes are described in PCT / US2016 / 037922, PCT / US2018 / 066941, PCT / US2017 / 054799, each incorporated by reference in its entirety. Exemplary mutant Cas-CLOVER break inducing enzymes of the present disclosure are also described herein.

[0043] In gene editing systems involving insertion of new or existing nucleotides / nucleic acids, in addition to a cleavage enzyme (e.g., a nuclease, a recombinase, an integrase, or a transposase), an insertion tool (e.g., a DNA template vector, a transposable element (transposon or retrotransposon)) must also be delivered to the cell. Examples of such insertion tools for recombinases can include DNA vectors. Other gene editing systems require delivery of integrases along with insertion vectors, delivery of transposases along with transposons / retrotransposons, etc. An exemplary recombinase that can be used as a cleavage enzyme is the CRE recombinase. Non-limiting examples of integrases that can be used in insertion tools include virus-based enzymes taken from any of a number of viruses including AAV, gamma retrovirus, and lentivirus. Exemplary transposons / retrotransposons that can be used in insertion tools are described in more detail herein.

[0044] The present disclosure provides a gene editing composition and / or a cell comprising the same. The gene editing composition can comprise a sequence encoding a DNA binding domain and a sequence encoding a nuclease protein or a nuclease domain thereof. The sequence encoding the nuclease protein or the sequence encoding the nuclease domain thereof can comprise a DNA sequence, an RNA sequence, or a combination thereof. The nuclease or the nuclease domain thereof can comprise one or more of a CRISPR / Cas protein, a transcription activator-like effector nuclease (TALEN), a zinc finger nuclease (ZFN), and an endonuclease.

[0045] Exemplary dCas9-Clo051 fusion proteins

[0046] The nuclease or the nuclease domain thereof can comprise a nuclease-inactivated Cas (dCas) protein and an endonuclease. The endonuclease can comprise a Clo051 nuclease or a nuclease domain thereof. The gene editing composition can comprise a fusion protein. The fusion protein can comprise a nuclease-inactivated Cas9 (dCas9) protein and a Clo051 nuclease or a Clo051 nuclease domain. The gene editing composition can further comprise a guide sequence. The guide sequence comprises an RNA sequence.

[0047] The present disclosure provides a composition comprising a small Cas9 (Cas9) operably linked to an effector. The present disclosure provides a fusion protein comprising, consisting essentially of, or consisting of a DNA localization component and an effector molecule, wherein the effector comprises a small Cas9 (Cas9). The small Cas9 construct of the present disclosure can comprise an effector comprising a Type IIS endonuclease. Staphylococcus aureus Cas9 with an active catalytic site comprises the amino acid sequence of SEQ ID NO: 1.

[0048] The present disclosure provides a composition comprising a nuclease-inactivated small Cas9 (dSaCas9) operably linked to an effector. The present disclosure provides a fusion protein comprising, consisting essentially of, or consisting of a DNA localization component and an effector molecule, wherein the effector comprises a nuclease-inactivated small Cas9 (dSaCas9). The small nuclease-inactivated Cas9 (dSaCas9) construct of the present disclosure can comprise an effector comprising a Type IIS endonuclease. The dSaCas9 comprises the amino acid sequence of SEQ ID NO: 2, which includes D10A and N580A mutations that inactivate the catalytic site.

[0049] The present disclosure provides compositions comprising an inactivated Cas9 (dCas9) operably linked to an effector. The present disclosure provides a fusion protein comprising, consisting essentially of, or consisting of a DNA localization component and an effector molecule, wherein the effector comprises an inactivated Cas9 (dCas9). The inactivated Cas9 (dCas9) constructs of the present disclosure can comprise an effector comprising a Type IIS endonuclease.

[0050] The dCas9 can be isolated from or derived from Streptoccocus pyogenes. The dCas9 can comprise a dCas9 having substitutions at amino acid positions 10 and 840, which inactivate the catalytic site. In some aspects, the substitutions are D10A and H840A. The dCas9 can comprise the amino acid sequence of SEQ ID NO: 3 or SEQ ID NO: 4.

[0051] An exemplary Clo051 nuclease domain comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 5. In some aspects, the Clo051 nuclease domain comprises at least one amino acid substitution. In some aspects, the amino acid substitution is in the a-helical loop domain of the Clo051 nuclease. In some aspects, the amino acid substitution is at position 35, 37, 60, 92, 98, 100, or 146 of SEQ ID NO: 5. In some aspects, the amino acid substitution is at position 37 of SEQ ID NO: 5. In some aspects, the amino acid substitution is at positions 37 and 92 of SEQ ID NO: 5.

[0052] An exemplary dCas9-Clo051 fusion protein can comprise, consist essentially of, or consist of the amino acid sequence of SEQ ID NO: 6. An exemplary dCas9-Clo051 fusion protein can be encoded by a polynucleotide comprising, consisting essentially of, or consisting of the nucleic acid sequence of SEQ ID NO: 7. The nucleic acid encoding the dCas9-Clo051 fusion protein can be DNA or RNA.

[0053] An exemplary dCas9-Clo051 fusion protein can comprise, consist essentially of, or consist of the amino acid sequence of SEQ ID NO: 8. An exemplary dCas9-Clo051 fusion protein can be encoded by a polynucleotide comprising, consisting essentially of, or consisting of the nucleic acid sequence of SEQ ID NO: 9. The nucleic acid encoding the dCas9-Clo051 fusion protein can be DNA or RNA.

[0054] Exemplary dCas9-Clo051 fusion proteins of the present disclosure can further comprise at least one nuclear localization sequence (NLS). In some embodiments, a dCas9-Clo051 fusion protein of the present disclosure comprises at least two nuclear localization sequences. In some embodiments, the NLS is on the N' terminus of the dCas9-Clo051 fusion protein (NLS-dCas9-Clo051). In some embodiments, the NLS is on the C terminus of the dCas9-Clo051 fusion protein (dCas9-Clo051-NLS). In some embodiments, the NLS is on the N' terminus and the C' terminus of the dCas9-Clo051 fusion protein ("NLS-dCas9-Clo051-NLS" or "wild type Cas-CLOVER").

[0055] A NLS-dCas9-Clo051-NLS ("wild type Cas-CLOVER") fusion protein can comprise, consist essentially of, or consist of the amino acid sequence of SEQ ID NO: 10.

[0056] NLS-dCas9-Clo051-NLS amino acid sequence (NLS amino acid sequence is bolded and underlined)

[0057]

[0058]

[0059] A nucleic acid encoding a NLS-dCas9-Clo051-NLS ("wild type Cas-CLOVER") fusion protein can be DNA or RNA. In some embodiments, the NLS-dCas9-Clo051-NLS is encoded by an mRNA sequence comprising, consisting essentially of, or consisting of SEQ ID NO: 11.

[0060] NLS-dCas9-Clo051-NLS mRNA sequence (NLS amino acid sequence is bolded and underlined)

[0061]

[0062]

[0063]

[0064] Exemplary mutant Cas-CLOVER fusion proteins

[0065] In some aspects, the NLS-dCas9-Clo051-NLS (“wild-type Cas-CLOVER”) comprises at least one amino acid substitution. In some aspects, the amino acid substitution is in the Clo051 domain of the NLS-dCas9-Clo051-NLS.

[0066] In some aspects, the NLS-dCas9-Clo051-NLS of SEQ ID NO: 10 can comprise at least one substitution at amino acid position 42, 44, 67, 105, 107, or 153. In some aspects, the amino acid substitution is F42E, F42D, S44E, S44P, R67E, I105Q, Q107A, Q107E, Q107H, Q107D, and / or K153D. In some aspects, the amino acid substitution is S44P.

[0067] An exemplary S44P mutant NLS-dCas9-Clo051-NLS (“S44P Cas-CLOVER” or “S44P CC” or “S44P”) fusion protein can comprise, consist essentially of, or consist of the amino acid sequence of SEQ ID NO: 35. The S44P Cas-CLOVER fusion protein can be encoded by a polynucleotide comprising, consisting essentially of, or consisting of the nucleic acid sequence of SEQ ID NO: 36. The nucleic acid encoding the dCas9-Clo051 fusion protein can be DNA or RNA.

[0068] S44P Cas-CLOVER amino acid sequence (SEQ ID NO: 35)

[0069]

[0070] S44P Cas-CLOVER nucleic acid sequence (SEQ ID NO: 36)

[0071]

[0072]

[0073] In some aspects, the NLS-dCas9-Clo051-NLS of SEQ ID NO: 10 can comprise at least one substitution at amino acid position 99. In some aspects, the amino acid substitution is E99K or E99R. In some aspects, the amino acid substitution is E99K. In some aspects, the amino acid substitution is E99R.

[0074] An exemplary E99K mutant NLS-dCas9-Clo051-NLS (“E99K Cas-CLOVER” or “E99K CC” or “E99K”) fusion protein can comprise, consist essentially of, or consist of the amino acid sequence of SEQ ID NO: 78. An E99K Cas-CLOVER fusion protein can be encoded by a polynucleotide comprising, consisting essentially of, or consisting of the nucleic acid sequence of SEQ ID NO: 79. The nucleic acid encoding the dCas9-Clo051 fusion protein can be DNA or RNA.

[0075] E99K Cas-CLOVER amino acid sequence (SEQ ID NO: 78)

[0076]

[0077] E99K Cas-CLOVER nucleic acid sequence (SEQ ID NO: 79)

[0078]

[0079]

[0080]

[0081] An exemplary E99R mutant NLS-dCas9-Clo051-NLS (“E99R Cas-CLOVER” or “E99R CC” or “E99R”) fusion protein can comprise, consist essentially of, or consist of the amino acid sequence of SEQ ID NO: 82. An E99R Cas-CLOVER fusion protein can be encoded by a polynucleotide comprising, consisting essentially of, or consisting of the nucleic acid sequence of SEQ ID NO: 83. The nucleic acid encoding the dCas9-Clo051 fusion protein can be DNA or RNA.

[0082] E99R Cas-CLOVER amino acid sequence (SEQ ID NO: 82)

[0083]

[0084] E99R Cas-CLOVER nucleic acid sequence (SEQ ID NO: 83)

[0085]

[0086]

[0087]

[0088] In some aspects, the NLS-dCas9-Clo051-NLS of SEQ ID NO: 10 can comprise amino acid substitutions at positions 44 and 99. In some aspects, the amino acid substitutions are S44P and E99K or S44P and E99R. In some aspects, the amino acid substitutions are S44P and E99K. In some aspects, the amino acid substitutions are S44P and E99R.

[0089] An exemplary S44P and E99K mutant NLS-dCas9-Clo051-NLS (“S44P and E99K Cas- CLOVER,” “S44P / E99K Cas-CLOVER,” “S44P and E99K CC,” “S44P / E99K CC,” or “S44P / E99K”) fusion protein can comprise, consist essentially of, or consist of the amino acid sequence of SEQ ID NO: 76. The S44P Cas-CLOVER fusion protein can be encoded by a polynucleotide comprising, consisting essentially of, or consisting of the nucleic acid sequence of SEQ ID NO: 77. The nucleic acid encoding the dCas9-Clo051 fusion protein can be DNA or RNA.

[0090] S44P / E99K Cas-CLOVER amino acid sequence (SEQ ID NO: 76)

[0091]

[0092] S44P / E99K Cas-CLOVER nucleic acid sequence (SEQ ID NO: 77)

[0093]

[0094]

[0095]

[0096] An exemplary S44P and E99R mutant NLS-dCas9-Clo051-NLS (“S44P and E99R Cas-CLOVER,” “S44P / E99R Cas-CLOVER,” “S44P and E99R CC,” “S44P / E99R CC,” or “S44P / E99R”) fusion protein can comprise, consist essentially of, or consist of the amino acid sequence of SEQ ID NO: 80. The S44P and E99R Cas-CLOVER fusion protein can be encoded by a polynucleotide comprising, consisting essentially of, or consisting of the nucleic acid sequence of SEQ ID NO: 81. The nucleic acid encoding the dCas9-Clo051 fusion protein can be DNA or RNA.

[0097] S44P / E99R Cas-CLOVER amino acid sequence (SEQ ID NO: 80)

[0098]

[0099]

[0100] S44P / E99R Cas-CLOVER nucleic acid sequence (SEQ ID NO: 81)

[0101]

[0102]

[0103] The following shows an amino acid sequence alignment of the wild-type Cas-CLOVER amino acid sequence (SEQ ID NO: 10), the mutant S44P Cas-CLOVER amino acid sequence (SEQ ID NO: 35), the mutant S44P and E99K Cas-CLOVER amino acid sequence (SEQ ID NO: 76), and the mutant S44P and E99R Cas-CLOVER amino acid sequence (SEQ ID NO: 80).

[0104]

[0105]

[0106]

[0107]

[0108] A cell comprising a gene editing composition can stably or transiently express the gene editing composition.

[0109] The transgene can comprise a sequence encoding a therapeutic agent. The therapeutic agent can be a protein or RNA that provides a therapeutic benefit when administered to a cell or a subject. The therapeutic agent can be a therapeutic protein or a therapeutic RNA. The therapeutic agent can be human beta-globin (HBB), T87Q human beta-globin (HBB T87Q), BAF chromatin-remodeling complex subunit (BCL11A) shRNA, insulin-like growth factor 2 binding protein 1 (IGF2BP1), interleukin 2 receptor gamma (IL2RG), alpha galactosidase A (GLA), alpha-L-iduronidase (IDUA), iduronate 2-sulfatase (IDS), cystinosin lysosomal cystine transporter (CTNS). The transgene can comprise a sequence of Factor VIII or Factor IX. The transgene can comprise a sequence encoding a chimeric antigen receptor (CAR). The transgene can comprise a sequence encoding a non-naturally occurring chimeric stimulatory receptor (CSR) comprising: (a) an extracellular domain comprising an activating component, wherein the activating component is isolated or derived from a first protein; (b) a transmembrane domain; and (c) an intracellular domain comprising at least one signal transduction domain, wherein the at least one signal transduction domain is isolated or derived from a second protein; wherein the first protein and the second protein are not the same. In an aspect, the transgene can comprise a sequence of a CAR and a sequence of a CSR. In an aspect, the transgene comprising a CAR or a CSR specifically binds to BCMA, PSMA, MUC1-C, CD133, c-KIT, CD19, or CD20. The transgene can comprise a sequence encoding an inducible pro-apoptotic polypeptide comprising (a) a ligand binding region, (b) a linker, and (c) a caspase polypeptide, wherein the inducible pro-apoptotic polypeptide does not comprise a non-human sequence. The transgene can be integrated into the genome of the HSC. The integration can be stable or temporary.

[0110] Factor VIII (FVIII) deficiency leads to the development of hemophilia A. Factor IX (FIX) deficiency leads to the development of hemophilia B. Prior to the compositions and methods of the present disclosure, the standard treatment for hemophilia B involves infusing recombinant FIX every 2 to 3 days, costing about $250,000 per year. In stark contrast to this standard treatment regimen, the iPSCs of the present disclosure can be differentiated into any cell type, including HSCs, and maintained in the human body for decades.

[0111] The guide RNA can comprise a sequence that is complementary to a target sequence within a genomic DNA sequence. The target sequence within the genomic DNA sequence can be a target sequence within a safe harbor site of the genomic DNA sequence. Exemplary target sequences include, but are not limited to, HBB, TRAC, B2M, TCRb, GAPDH, or SOX17.

[0112] The guide RNA can comprise a sequence that is complementary to at least one target sequence on the transposon, plasmid, or vector. In some aspects, the complementary sequence of the guide RNA on the transposon, plasmid, or vector is located within the transgene for targeted nucleic acid insertion. In some aspects, the complementary sequence of the guide RNA on the transposon, plasmid, or vector is located within the transgene for targeted nucleic acid insertion. In some aspects, the complementary sequence on the transposon, plasmid, or vector facilitates binding of the gRNA bound to the effector molecule, thereby tethering all components. In some aspects, the effector molecule is a Cas-CLOVER. In some aspects, the Cas-CLOVER further comprises at least one NLS sequence. In some aspects, the NLS sequence of the Cas-CLOVER facilitates localization of the tethered components to the nucleus. This promotes localization of all components (Cas-CLOVER, gRNA, and transposon, plasmid, or vector) required for gene editing to the nucleus, thereby increasing the efficiency of gene editing.

[0113] gRNA

[0114] As used herein, the term "guide sequence" in the context of a Cas-CLOVER system or a CRISPR-Cas9 system comprises any polynucleotide sequence that has sufficient complementarity to a target nucleic acid sequence to hybridize with the target nucleic acid sequence and direct sequence-specific binding of a nucleic acid-targeting complex to the target nucleic acid sequence. The guide sequence can form a duplex with the target sequence. The duplex can be a DNA duplex, an RNA duplex, or an RNA / DNA duplex. The terms "guide molecule" and "guide RNA" and "single guide RNA" are used interchangeably herein to refer to an RNA-based molecule that is capable of forming a complex with a Cas-CLOVER or a CRISPR-Cas protein and comprises a guide sequence that has sufficient complementarity to a target nucleic acid sequence to hybridize with the target nucleic acid sequence and direct sequence-specific binding of the complex to the target nucleic acid sequence. The guide molecule or guide RNA can encompass an RNA-based molecule with one or more chemical modifications (e.g., by chemically linking two ribonucleotides or by replacing one or more ribonucleotides with one or more deoxyribonucleotides), as described herein.

[0115] The terms "target region," "target sequence," or "protospacer" are used interchangeably herein to refer to a region of a target gene targeted by the Cas-CLOVER system or the CRISPR / Cas9-based system. The Cas-CLOVER or CRISPR / Cas9-based system can include at least one gRNA, where the gRNAs target different DNA sequences. The target DNA sequences can overlap. The Cas-CLOVER system can include at least two gRNAs, where the gRNAs target different DNA sequences. The target sequence or protospacer is followed by a PAM sequence at the 3' end of the protospacer. Different Type II systems have different PAM requirements. For example, the S. pyogenes Type II system uses a "NGG" sequence, where "N" can be any nucleotide.

[0116] The guide RNA or guide RNA of the Cas-CLOVER protein or CRISPR-Cas protein can comprise a tracr mate sequence (encompassing "direct repeat" in the context of an endogenous CRISPR system) and a guide sequence (also referred to as a "spacer" in the context of an endogenous CRISPR system). In some embodiments, the Cas-CLOVER or CRISPR-Cas system or complex described herein does not comprise and / or is not dependent on the presence of a tracr sequence. In certain embodiments, the guide molecule can comprise, consist essentially of, or consist of a direct repeat sequence fused or linked to a guide sequence or spacer sequence.

[0117] In certain embodiments, the guide sequence or spacer of the guide molecule is 15 to 50 nucleotides long. In certain embodiments, the spacer of the guide RNA is at least 15 nucleotides long. In certain embodiments, the spacer is 15 to 17 nucleotides long, 17 to 20 nucleotides long, 20 to 24 nucleotides long, 23 to 25 nucleotides long, 24 to 27 nucleotides long, 27 to 30 nucleotides long, 30 to 35 nucleotides long, or greater than 35 nucleotides long.

[0118] In some embodiments, the guide sequence is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 nucleotides long.

[0119] In some embodiments, the sequence of the guide molecule (direct repeat and / or spacer) is selected to reduce the extent of secondary structure within the guide molecule. In some embodiments, about or less than about 75%, 50%, 40%, 30%, 25%, 20%, 15%, 10%, 5%, 1%, or less of the nucleotides of the nucleic acid-targeting guide RNA participate in self-complementary base pairing upon optimal folding. Optimal folding can be determined by any suitable polynucleotide folding algorithm. Some programs are based on calculating the minimum Gibbs free energy. An example of such an algorithm is mFold, as described by Zuker and Stiegler (Nucleic Acids Res. 9 (1981), 133-148). Another example of a folding algorithm is the online web server RNAfold developed at the Institute for Theoretical Chemistry of the University of Vienna, which uses a centroid structure prediction algorithm (see, e.g., A.R. Gruber et al., 2008, Cell 106(1): 23-24; and PA Carr and GM Church, 2009, Nature Biotechnology 27(12): 1151-62).

[0120] As described above, the Cas-CLOVER system and the CRISPR / Cas9 system utilize targeting gRNAs and provide for the targeting of the Cas-CLOVER system and the CRISPR / Cas9-based system. The gRNA can be a fusion of two non-coding RNAs: crRNA and tracrRNA. The sgRNA can target any desired DNA sequence by swapping the sequence encoding the 20 bp protospacer sequence, which confers targeting specificity by base pairing with the complementary bases of the desired DNA target. The gRNA mimics the naturally occurring crRNA:tracrRNA duplex involved in type II effector systems. The duplex can include, for example, a 42 nucleotide crRNA and a 75 nucleotide tracrRNA, which functions as a guide for Cas9 to cleave the target nucleic acid.

[0121] In some embodiments, the gRNA targets a region upstream of the target gene (e.g., HBB, B2M, TRAC, or GAPDH locus), e.g., a region between 0 and 1000 bp upstream of the target gene. In some embodiments, the gRNA targets a region between 0 to 50 bp, 0 to 100 bp, 0 to 150 bp, 0 to 200 bp, 0 to 250 bp, 0 to 300 bp, 0 to 350 bp, 0 to 400 bp, 0 to 450 bp, 0 to 500 bp, 0 to 550 bp, 0 to 600 bp, 0 to 650 bp, 0 to 700 bp, 0 to 750 bp, 0 to 800 bp, 0 to 850 bp, 0 to 900 bp, 0 to 950 bp, or 0 to 1000 bp upstream of the transcription start site of the target gene. In some embodiments, the gRNA targets a region within about 100 bp, about 200 bp, about 300 bp, about 400 bp, about 500 bp, about 600 bp, about 700 bp, about 800 bp, about 900 bp, about 1000 bp, about 1100 bp, about 1200 bp, about 1300 bp, about 1400 bp, or about 1500 bp upstream of the target gene.

[0122] In some embodiments, the gRNA targets a region downstream of the target gene (e.g., HBB, B2M, TRAC, or GAPDH locus), e.g., a region between 0 and 1000 bp downstream of the target gene. In some embodiments, the gRNA targets a region between 0 to 50 bp, 0 to 100 bp, 0 to 150 bp, 0 to 200 bp, 0 to 250 bp, 0 to 300 bp, 0 to 350 bp, 0 to 400 bp, 0 to 450 bp, 0 to 500 bp, 0 to 550 bp, 0 to 600 bp, 0 to 650 bp, 0 to 700 bp, 0 to 750 bp, 0 to 800 bp, 0 to 850 bp, 0 to 900 bp, 0 to 950 bp, or 0 to 1000 bp downstream of the target gene. In some embodiments, the gRNA targets a region within about 100 bp, about 200 bp, about 300 bp, about 400 bp, about 500 bp, about 600 bp, about 700 bp, about 800 bp, about 900 bp, about 1000 bp, about 1100 bp, about 1200 bp, about 1300 bp, about 1400 bp, or about 1500 bp downstream of the target gene.

[0123] The gRNA can be divided into a target-binding region and a Cas9-binding region. The target-binding region hybridizes to a target region in the target gene. Methods for designing such target-binding regions are known in the art, see, e.g., Doench et al., Nat Biotechnol. (2014) 32: 1262-7; and Doench et al., Nat Biotechnol. (2016) 34: 184-91, which are incorporated by reference herein in their entireties. Design tools are available, e.g., at target Finder by the Feng Zhang lab, Target Finder (E-CRISP) by the Michael Boutros lab, RGEN Tools (Cas-OF Finder), CasFinder, and CRISPR Optimal Target Finder. In certain embodiments, the target-binding region can be between about 15 and about 50 nucleotides in length (about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or about 50 nucleotides in length). In certain embodiments, the target-binding region can be between about 19 and about 21 nucleotides in length. In one embodiment, the target-binding region is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length.

[0124] In one embodiment, the target-binding region is complementary, e.g., fully complementary, to a target region in the target gene. In one embodiment, the target-binding region is substantially complementary to a target region in the target gene. In one embodiment, the target-binding region comprises no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides that are not complementary to a target region in the target gene.

[0125] Exemplary sgRNAs of the disclosure include, but are not limited to, sequences for targeting HBB, B2M, TRAC, or GAPDH loci. Exemplary sgRNAs of the disclosure also include, but are not limited to, sequences for targeting hemoglobin, albumin, TTR, APOC3, PCSK9, and KLKB1. Exemplary sgRNAs of the disclosure comprise, consist essentially of, or consist of sequences as shown in Table 1.

[0126] Table 1. Exemplary sgRNAs of the disclosure

[0127] Exemplary sgRNA Sequence SEQ ID NO: HBB L sgRNA CUCAGGAGUCAGAUGCACCA SEQ ID NO: 12 HBB R sgRNA GUGAACGUGGAUGAAGUUGG SEQ ID NO: 13 HBB L2 sgRNA UGCACCAUGGUGUCUGUUUG SEQ ID NO: 14 HBB R2 sgRNA CCUGUGGGGCAAGGUGAACG SEQ ID NO: 15 PCSK9-L gRNA CCTGGGCACCAGCGCCGGTG SEQ ID NO: 59 PCSK9-R gRNA GAUGCUCGCCCUCCCGUCCC SEQ ID NO: 60 Alb4-73406457 gRNA GAGGCCUAGAUAGGCAUAUTG SEQ ID NO: 61 Alb4-73406506 gRNA UGAAUAGGCUUUCUGGAUAA SEQ ID NO: 62 APOC3-9_i3-pair190-R GGCAUUAGCUGGCAUAGCAG SEQ ID NO: 63 APOC3-9_i3-pair190-L GGGGAGAGGAGAGUACUGAU SEQ ID NO: 64 TTR-1_i4-pair60-L CCAGCUCCAUAGUUGAAUGU SEQ ID NO: 65 TTR-1_i4-pair60-R AGUUGCCUAGUGUUUGUUGC SEQ ID NO: 66 HBG1 / 2_HBG-L CAAGGCUAUUGGUCAAGGCA SEQ ID NO: 67 HBG1 / 2_HBG-R UAGUCUUAGAGUAUCCAGUG SEQ ID NO: 68 Human hKLKB1-R CUGCUGCCCACUGCUUUGAU SEQ ID NO: 72 Human hKLKB1-L CUAUGAGUGACCCUCCACAC SEQ ID NO: 73 Mouse mklkb1-R GCUUUGAUGGGUAAGUUUCA SEQ ID NO: 74 Mouse mklkb1-L UACCCAUUGGCGACCAAUGA SEQ ID NO: 75

[0128] Gene editing compositions comprising Cas-CLOVER and methods of gene editing using these compositions are described in detail in PCT Application No. PCT / US2016 / 037922, PCT / US2018 / 066941, PCT / US2017 / 054799, U.S. Patent Publication Nos. 2017 / 0107541, 2017 / 0114149, 2018 / 0187185, and U.S. Patent No. 10,415,024, each of which is incorporated by reference herein in its entirety. Exemplary gene editing compositions comprising mutant Cas-CLOVER and methods of gene editing using these compositions are described herein.

[0129] Gene editing tools can also be delivered to cells using one or more poly(histidine)-based micelles. Poly(histidine) (e.g., poly(L-histidine)) is a pH-sensitive polymer due to the imidazole ring providing a lone pair of electrons on the unsaturated nitrogen. That is, poly(histidine) has amphoteric properties through protonation-deprotonation. In particular, at certain pHs, a triblock copolymer containing poly(histidine) can assemble into micelles with positively charged poly(histidine) units on the surface, thereby enabling complexation with negatively charged gene editing molecules. The use of these nanoparticles to bind and release proteins and / or nucleic acids in a pH-dependent manner can provide an efficient and selective mechanism to make desired genetic modifications. In particular, this micelle-based delivery system provides substantial flexibility with respect to charged materials, as well as large payload capacity and targeted release of nanoparticle payloads. In one example, site-specific cleavage of double-stranded DNA is achieved by delivering a nuclease using poly(histidine)-based micelles. Without wishing to be bound by a particular theory, it is believed that in micelles formed from various triblock copolymers, the hydrophobic block aggregates to form a core, leaving the hydrophilic block and the poly(histidine) block at the ends to form one or more surrounding layers.

[0130] In one aspect, the present disclosure provides a triblock copolymer made from a hydrophilic block, a hydrophobic block, and a charged block. In some aspects, the hydrophilic block can be poly(ethylene oxide) (PEO), and the charged block can be poly(L-histidine). An exemplary triblock copolymer that can be used is PEO-b-PLA-b-PHIS, where the variable number of repeat units in each block varies by design.

[0131] A diblock copolymer that can be used as an intermediate to make the triblock copolymer can have a hydrophilic biocompatible poly(ethylene oxide) (PEO), which is chemically synonymous with PEG, coupled to various hydrophobic aliphatic poly(anhydrides), poly(nucleic acids), poly(esters), poly(orthoesters), poly(peptides), poly(phosphazenes), and poly(saccharides), including but not limited to poly(lactide) (PLA), poly(glycolide) (PLGA), poly(lactic-co-glycolic acid) (PLGA), poly(e-caprolactone) (PCL), and poly(trimethylene carbonate) (PTMC). Polymer micelles composed of 100% pegylated surfaces have improved in vitro chemical stability, enhanced in vivo bioavailability, and prolonged blood circulation half-life.

[0132] Polymeric vesicles, polymeric bodies, and poly(histidine)-based micelles, including those comprising triblock copolymers, and methods of making them, are described in further detail in U.S. Patent Nos. 7,217,427; 7,868,512; 6,835,394; 8,808,748; 10,456,452; U.S. Publication Nos. 2014 / 0363496; 2017 / 0000743; and 2019 / 0255191; and PCT Publication No. WO 2019 / 126589, each of which is incorporated herein by reference in its entirety.

[0133] Gene editing compositions (e.g., mutant Cas-CLOVER) can also be delivered to cells using one or more lipid nanoparticle compositions, and methods of making such compositions are described in PCT Application No. PCT / US2023 / 061005 and PCT Publication No. WO 2022 / 182792, which are incorporated herein by reference in their entirety.

[0134] In some aspects, the composition is encapsulated in at least one lipid nanoparticle comprising: about 40.75% by molar of a terpene lipid compound, about 51.75% by molar of cholesterol, about 5% by molar of DOPC, and about 2.5% by molar of DMG-PEG2000, wherein the polynucleotide encoding the mutant Cas-CLOVER is an RNA molecule, and wherein the ratio of lipids to RNA molecules in the at least one nanoparticle is about 120: 1 (w / w).

[0135] In some aspects, the terpene lipid compound is HMA-404.

[0136]

[0137] Thus, in some aspects, the gene editing composition is encapsulated in at least one lipid nanoparticle comprising: about 40.75% by molar of HMA-404, about 51.75% by molar of cholesterol, about 5% by molar of DOPC, and about 2.5% by molar of DMG-PEG2000, wherein the polynucleotide encoding the mutant Cas-CLOVER is an RNA molecule, and wherein the ratio of lipids to RNA molecules in the at least one nanoparticle is about 120: 1 (w / w).

[0138] In some aspects, the composition is encapsulated in at least one lipid nanoparticle comprising: about 54% SS-OP by mole, about 35% cholesterol by mole, about 5% DOPC by mole, about 5% DSPC by mole, and about 1% DMG-PEG2000 by mole. The ratio of lipid to nucleic acid in the nanoparticle is about 100: 1 (weight / weight), and the total lipid is 25 mM.

[0139] Transposition system

[0140] The present disclosure also provides a composition comprising a transposon. In one preferred aspect, the composition comprising a transposon further comprises a plasmid comprising a nucleotide sequence encoding a transposase. The nucleotide sequence encoding the transposase can be a DNA sequence or an RNA sequence. Preferably, the sequence encoding the transposase is an mRNA sequence.

[0141] The transposon of the present disclosure can be a piggyBac TM (PB) transposon. In some aspects, when the transposon is a PB transposon, the transposase is a piggyBac TM (PB) transposase, a piggyBac-like (PBL) transposase, or a Super piggyBac TM (SPB) transposase. The sequence encoding the SPB transposase is an mRNA sequence.

[0142] The transposon of the present disclosure can be a Footprint-Free™ transposon. In some aspects, the transposase is a PBx transposase. The sequence encoding the PBx transposase is an mRNA sequence. In some aspects, the PBx transposase facilitates Footprint-Free TM removal of the nucleic acid cassette from the transposon, plasmid, or vector.

[0143] Non-limiting examples of PB transposons and PB, PBL, and SPB transposases are described in detail in U.S. Patent No. 6,218,182; U.S. Patent No. 6,962,810; U.S. Patent No. 8,399,643; and PCT Publication Nos. WO 2010 / 099296, WO 2010 / 099301, WO 2013 / 012824, each of which is incorporated herein in its entirety.

[0144] PB, PBL, and SPB transposases recognize transposon-specific inverted terminal repeat sequences (ITRs) at the ends of the transposon and insert the contents between the ITRs at a chromosomal site at a sequence 5'-TTAT-3' (TTAT target sequence) or at a chromosomal site at a sequence 5'-TTAA-3' (TTAA target sequence). The target sequence of a PB or PBL transposon can comprise or consist of 5'-CTAA-3', 5'-TTAG-3', 5'-ATAA-3', 5'-TCAA-3', 5'AGTT-3', 5'-ATTA-3', 5'-GTTA-3', 5'-TTGA-3', 5'-TTTA-3', 5'-TTAC-3', 5'-ACTA-3', 5'-AGGG-3', 5'-CTAG-3', 5'-TGAA-3', 5'-AGGT-3', 5'-ATCA-3', 5'-CTCC-3', 5'-TAAA-3', 5'-TCTC-3', 5'TGAA-3', 5'-AAAT-3', 5'-AATC-3', 5'-ACAA-3', 5'-ACAT-3', 5'-ACTC-3', 5'-AGTG-3', 5'-ATAG-3', 5'-CAAA-3', 5'-CACA-3', 5'-CATA-3', 5'-CCAG-3', 5'-CCCA-3', 5'-CGTA-3', 5'-GTCC-3', 5'-TAAG-3', 5'-TCTA-3', 5'-TGAG-3', 5'-TGTT-3', 5'-TTCA-3' 5'-TTCT-3', and 5'-TTTT-3'. The PB or PBL transposon system has no payload restriction for a gene of interest that can be included between the ITRs.

[0145] Exemplary amino acid sequences of one or more PB, PBL, and SPB transposases are disclosed in U.S. Patent No. 6,218,185; U.S. Patent No. 6,962,810; and U.S. Patent No. 8,399,643.

[0146] As described herein, in certain embodiments, the present application features integration-deficient piggyBac transposons. By integration-deficient is meant a transposon that integrates into a host genome at a lower frequency than the corresponding wild-type transposon. In certain exemplary embodiments, the present transposons integrate by conventional integration mechanisms.

[0147] In certain exemplary embodiments, the integration-deficient piggyBac transposon is derived from the wild-type piggyBac sequence, i.e., SEQ ID NO: 16. In exemplary embodiments, the integration-deficient piggyBac transposon comprises a change in SEQ ID NO: 16 selected from R372A or K375A. In certain preferred embodiments, the integration-deficient piggyBac transposon comprises an amino acid sequence selected from SEQ ID NO: 17, SEQ ID NO: 18, or SEQ ID NO: 19. In certain embodiments, the amino acid change in SEQ ID NO: 16 comprises R372A and corresponds to SEQ ID NO: 17. The integration-deficient variant encoded by SEQ ID NO: 17 corresponds to the nucleotide change CGA to GCA in SEQ ID NO: 20 and corresponds to SEQ ID NO: 21. In other certain embodiments, the amino acid change in SEQ ID NO: 16 comprises K375A and corresponds to SEQ ID NO: 18. The integration-deficient variant encoded by SEQ ID NO: 18 corresponds to the nucleotide change AAA to GCA in SEQ ID NO: 20 and corresponds to SEQ ID NO: 50. In other certain embodiments, the amino acid change in SEQ ID NO: 2 comprises R372A, K375A and corresponds to SEQ ID NO: 19. The integration-deficient variant encoded by SEQ ID NO: 19 corresponds to the nucleotide change CGA to GCA / AAA to GCA in SEQ ID NO: 20 and corresponds to SEQ ID NO: 22.

[0148] In exemplary embodiments, the integration-deficient piggyBac transposase comprises a change in SEQ ID NO: 16 selected from at least R372A or K375A and D450N. In some aspects, the PBx transposase comprises or consists of an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to SEQ ID NO: 23.

[0149] In exemplary embodiments, the integration-deficient piggyBac transposase comprises a change in SEQ ID NO: 16 selected from at least R372A or K375A and D450N. In some aspects, the PBx transposase comprises or consists of an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to SEQ ID NO: 24.

[0150] In some aspects, the PB transposase comprises or consists of an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to SEQ ID NO: 25.

[0151] The PB or PBL transposase can comprise or consist of an amino acid sequence having an amino acid substitution at two or more positions, three or more positions, or each position of positions 30, 165, 282, and / or 538 of the sequence of SEQ ID NO: 25. The transposase can be an SPB transposase comprising or consisting of an amino acid sequence of the sequence of SEQ ID NO: 25, wherein the amino acid substitution at position 30 can be valine (V) substituted with isoleucine (I), the amino acid substitution at position 165 can be serine (S) substituted with glycine (G), the amino acid substitution at position 282 can be valine (V) substituted with methionine (M), and the amino acid substitution at position 538 can be lysine (K) substituted with asparagine (N). In a preferred aspect, the SPB transposase comprises or consists of an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to SEQ ID NO: 26.

[0152] In certain aspects where the transposase comprises the above mutations at positions 30, 165, 282, and / or 538, the PB, PBL, and SPB transposases can further comprise an amino acid substitution at one or more of positions 3, 46, 82, 103, 119, 125, 177, 180, 185, 187, 200, 207, 209, 226, 235, 240, 241, 243, 258, 296, 298, 311, 315, 319, 327, 328, 340, 421, 436, 456, 470, 486, 503, 552, 570, and 591 of the sequence of SEQ ID NO: 25 or SEQ ID NO: 26, as described in more detail in PCT Publication No. WO 2019 / 173636 and PCT / US2019 / 049816.

[0153] PB, PBL, or SPB transposases can be isolated from or derived from insects, vertebrates, crustaceans, or chordates, as described in more detail in PCT Publication No. WO 2019 / 173636 and PCT / US2019 / 049816. In preferred aspects, the PB, PBL, or SPB transposases are isolated from or derived from the insect Trichoplusia ni (GenBank Accession No. AAA87375) or the silkworm Bombyx mori (GenBank Accession No. BAD11135).

[0154] A hyperactive PB or PBL transposase is a transposase that is more active than the naturally occurring variant from which it is derived. In a preferred aspect, the hyperactive PB or PBL transposase is isolated from or derived from the silkworm Bombyx mori or the frog Xenopus tropicalis. Examples of hyperactive PB or PBL transposases are disclosed in U.S. Patent No. 6,218,185; U.S. Patent No. 6,962,810, U.S. Patent No. 8,399,643, and WO 2019 / 173636. Lists of hyperactive amino acid substitutions are disclosed in U.S. Patent No. 10,041,077.

[0155] In some aspects, the PB or PBL transposase is integration-deficient. An integration-deficient PB or PBL transposase is a transposase that can excise its corresponding transposon, but which integrates the excised transposon at a lower frequency than the corresponding wild-type transposase. Examples of integration-deficient PB or PBL transposases are disclosed in U.S. Patent No. 6,218,185; U.S. Patent No. 6,962,810, U.S. Patent No. 8,399,643, and WO 2019 / 173636. Lists of integration-deficient amino acid substitutions are disclosed in U.S. Patent No. 10,041,077.

[0156] In some aspects, the PB or PBL transposase is fused to a nuclear localization signal. Examples of PB or PBL transposases fused to a nuclear localization signal are disclosed in U.S. Patent No. 6,218,185; U.S. Patent No. 6,962,810, U.S. Patent No. 8,399,643, and WO 2019 / 173636.

[0157] A transposon of the present disclosure can be a Sleeping Beauty transposon. In some aspects, when the transposon is a Sleeping Beauty transposon, the transposase is a Sleeping Beauty transposase (e.g., as disclosed in U.S. Patent No. 9,228,180) or a hyperactive Sleeping Beauty (SB100X) transposase. In a preferred aspect, the Sleeping Beauty transposase comprises or consists of an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to SEQ ID NO: 27. In some embodiments, the hyperactive Sleeping Beauty (SB100X) transposase comprises or consists of an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to SEQ ID NO: 28.

[0158] A transposon of the present disclosure can be a Helraiser transposon. An exemplary Helraiser transposon includes Helibatl comprising a nucleic acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to SEQ ID NO: 29, or consists thereof. In some aspects, when the transposon is a Helraiser transposon, the transposase is a Helitron transposase (e.g., as disclosed in WO 2019 / 173636). In a preferred aspect, the Helraiser transposase comprises or consists of an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to SEQ ID NO: 30.

[0159] A transposon of the present disclosure can be a Tol2 transposon. An exemplary Tol2 transposon (including inverted repeat sequences, near terminal sequences, and a Tol2 transposase) comprises or consists of a nucleic acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to SEQ ID NO: 31. In some aspects, when the transposon is a Tol2 transposon, the transposase is a Tol2 transposase (e.g., as disclosed in WO 2019 / 173636). In a preferred aspect, the Tol2 transposase comprises or consists of an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to SEQ ID NO: 32.

[0160] The transposon of the present disclosure can be a TcBuster transposon. In some aspects, when the transposon is a TcBuster transposon, the transposase is a TcBuster transposase or a hyperactive TcBuster transposase (e.g., as disclosed in WO 2019 / 173636). The TcBuster transposase can comprise or consist of a naturally occurring amino acid sequence or a non-naturally occurring amino acid sequence. In a preferred aspect, the TcBuster transposase comprises or consists of an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to SEQ ID NO: 33. The polynucleotide encoding the TcBuster transposase can comprise or consist of a naturally occurring nucleic acid sequence or a non-naturally occurring nucleic acid sequence. In a preferred aspect, the TcBuster transposase is encoded by a polynucleotide comprising or consisting of a nucleic acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to SEQ ID NO: 34.

[0161] In some aspects, the mutant TcBuster transposase comprises one or more sequence variations as compared to a wild-type TcBuster transposase, as described in more detail in PCT Publication No. WO 2019 / 173636 and PCT / US2019 / 049816.

[0162] The transposon can be a nanoscale transposon. The nanoscale transposon can comprise, consist essentially of, or consist of (a) a sequence encoding a transposon insert comprising a sequence encoding a first inverted terminal repeat (ITR), a sequence encoding a second inverted terminal repeat (ITR), and an intra-ITR sequence; (b) a sequence encoding a backbone, wherein the sequence encoding the backbone comprises a sequence encoding an origin of replication having between 1 and 450 (inclusive) nucleotides, and a sequence encoding a selectable marker having between 1 and 200 (inclusive) nucleotides, and (c) an inter-ITR sequence. In some aspects, the inter-ITR sequence of (c) comprises the sequence of (b). In some aspects, the intra-ITR sequence of (a) comprises the sequence of (b).

[0163] The selectable marker having between 1 and 200, inclusive, nucleotides can comprise a sequence encoding a sucrose selectable marker. The sequence encoding a sucrose selectable marker can comprise a sequence encoding an RNA-OUT sequence. The sequence encoding an RNA-OUT sequence can comprise or consist of 137 base pairs (bp). The selectable marker having between 1 and 200, inclusive, nucleotides can comprise a sequence encoding a fluorescent marker. The selectable marker having between 1 and 200, inclusive, nucleotides can comprise a sequence encoding a cell surface marker.

[0164] The sequence encoding a replication origin having between 1 and 450, inclusive, nucleotides can comprise a sequence encoding a mini replication origin. In some aspects, the sequence encoding a replication origin having between 1 and 450, inclusive, nucleotides comprises a sequence encoding an R6K replication origin. The R6K replication origin can comprise an R6K gamma replication origin. The R6K replication origin can comprise an R6K mini replication origin. The R6K replication origin can comprise an R6K gamma mini replication origin. The R6K gamma mini replication origin can comprise or consist of 281 base pairs (bp).

[0165] In some aspects of the nanotranspon, the sequence encoding the backbone does not comprise a recombination site, an excision site, a ligation site, or a combination thereof. In some aspects, neither the nanotranspon nor the sequence encoding the backbone comprises a product of a recombination site, an excision site, a ligation site, or a combination thereof. In some aspects, neither the nanotranspon nor the sequence encoding the backbone is derived from a recombination site, an excision site, a ligation site, or a combination thereof.

[0166] In some aspects of the nanotranspon, the recombination site comprises a sequence resulting from a recombination event. In some aspects, the recombination site comprises a sequence that is a product of a recombination event. In some aspects, the recombination event comprises the activity of a recombinase (e.g., a recombinase site).

[0167] In some aspects of the nanotranspon, the sequence encoding the backbone does not further comprise a sequence encoding foreign DNA.

[0168] In some aspects of the nanotranspon, the inter-ITR sequence does not comprise a recombination site, a excision site, a ligation site, or a combination thereof. In some aspects, the inter-ITR sequence does not comprise a product of a recombination event, a excision event, a ligation event, or a combination thereof. In some aspects, the inter-ITR sequence is not derived from a recombination event, a excision event, a ligation event, or a combination thereof. In some aspects, the inter-ITR sequence comprises a sequence encoding foreign DNA. In some aspects, the intra-ITR sequence comprises at least one sequence encoding an insulator and a sequence encoding a promoter capable of expressing an exogenous sequence in a mammalian cell. The mammalian cell can be a human cell. In some aspects, the intra-ITR sequence comprises a first sequence encoding an insulator, a sequence encoding a promoter capable of expressing an exogenous sequence in a mammalian cell, and a second sequence encoding an insulator. In some aspects, the intra-ITR sequence comprises a first sequence encoding an insulator, a sequence encoding a promoter capable of expressing an exogenous sequence in a mammalian cell, a polyadenylation (poly A) sequence, and a second sequence encoding an insulator. In some aspects, the intra-ITR sequence comprises a first sequence encoding an insulator, a sequence encoding a promoter capable of expressing an exogenous sequence in a mammalian cell, at least one exogenous sequence, a polyadenylation (poly A) sequence, and a second sequence encoding an insulator.

[0169] Nanotransposons are described in more detail in PCT / US2019 / 067758, which is incorporated by reference in its entirety.

[0170] Vector system

[0171] The vectors of the present disclosure can be viral vectors or recombinant vectors. The viral vectors can comprise sequences isolated from or derived from a retrovirus, a lentivirus, an adenovirus, an adeno-associated virus, or any combination thereof. The viral vectors can comprise sequences isolated from or derived from an adeno-associated virus (AAV). The viral vectors can comprise a recombinant AAV (rAAV). Exemplary adeno-associated viruses and recombinant adeno-associated viruses comprise two or more inverted terminal repeat (ITR) sequences positioned in cis immediately adjacent to a sequence encoding a scFv or CAR of the present disclosure. Exemplary adeno-associated viruses and recombinant adeno-associated viruses include, but are not limited to, all serotypes (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, and AAV9). Exemplary adeno-associated viruses and recombinant adeno-associated viruses include, but are not limited to, self-complementary AAVs (scAAVs) and AAV hybrids (e.g., AAV2 / 5, AAV-DJ, and AAV-DJ8) containing a genome of one serotype and a capsid of another serotype. Exemplary adeno-associated viruses and recombinant adeno-associated viruses include, but are not limited to, rAAV-LK03.

[0172] The vectors of the present disclosure can be nanoparticles. Non-limiting examples of nanoparticle vectors include nucleic acids (e.g., RNA, DNA, synthetic nucleotides, modified nucleotides, or any combination thereof), amino acids (L-amino acids, D-amino acids, synthetic amino acids, modified amino acids, or any combination thereof), polymers (e.g., polymeric bodies), micelles, lipids (e.g., liposomes), organic molecules (e.g., carbon atoms, sheets, fibers, tubes), inorganic molecules (e.g., calcium phosphate or gold), or any combination thereof. Nanoparticle vectors can be transported across a cell membrane passively or actively.

[0173] The cell delivery compositions (e.g., transposons, vectors) disclosed herein can comprise nucleic acids encoding a therapeutic protein or therapeutic agent. Examples of therapeutic proteins include those disclosed in PCT Publication No. WO 2019 / 173636 and PCT / US2019 / 049816.

[0174] Nucleic acid molecule

[0175] The nucleic acid molecules of the present disclosure can be in the form of RNA, such as mRNA, hnRNA, tRNA, or any other form, or in the form of DNA, including but not limited to cDNA and genomic DNA obtained by cloning or produced synthetically, or any combination thereof. The DNA can be triple-stranded, double-stranded, or single-stranded, or any combination thereof. Any portion of at least one strand of the DNA or RNA can be a coding strand (also known as the sense strand), or it can be a non-coding strand (also known as the anti-sense strand).

[0176] The isolated nucleic acid molecules of the present disclosure can include nucleic acid molecules comprising an open reading frame (ORF), optionally containing one or more introns, such as, but not limited to, at least one specified portion of at least one scFv; nucleic acid molecules comprising a coding sequence for a protein scaffold or loop region that binds to a target protein; and nucleic acid molecules comprising nucleotide sequences that are substantially different from the above sequences but still encode a protein scaffold described herein and / or known in the art due to the degeneracy of the genetic code. Of course, the genetic code is well known in the art. Thus, it would be routine for one of skill in the art to generate such degenerate nucleic acid variants that encode a particular scFv of the present disclosure. See, e.g., Ausubel et al., supra, and such nucleic acid variants are included in the present disclosure.

[0177] As shown herein, nucleic acid molecules of the present disclosure can include, but are not limited to, those encoding the amino acid sequence of the scFv fragment itself; a coding sequence for the entire protein scaffold or a portion thereof; a coding sequence for the scFv, fragment or portion, and additional sequences, such as a coding sequence for at least one signal leader or fusion peptide, with or without additional coding sequences described above, such as at least one intron, along with additional non-coding sequences, including, but not limited to, non-coding 5' and 3' sequences, such as untranslated sequences of a transcript that play a role in transcription, mRNA processing including splicing and polyadenylation signal (e.g., ribosome binding and stability of mRNA); additional coding sequences that encode additional amino acids, such as those that provide additional functionality. Thus, the sequence encoding the protein scaffold can be fused to a marker sequence, such as a sequence encoding a peptide that facilitates purification of the fusion protein scaffold comprising the protein scaffold fragment or portion.

[0178] Polynucleotides that selectively hybridize to the polynucleotides described herein

[0179] The present disclosure provides isolated nucleic acids that hybridize under selective hybridization conditions to the polynucleotides disclosed herein. Thus, the polynucleotides can be used to isolate, detect, and / or quantify nucleic acids comprising such polynucleotides. For example, the polynucleotides of the present disclosure can be used to identify, isolate, or amplify partial or full-length clones in a cDNA library. The polynucleotides can be genomic or cDNA sequences isolated from a human or mammalian nucleic acid library, or genomic or cDNA sequences otherwise complementary to cDNAs from a human or mammalian nucleic acid library.

[0180] Preferably, the cDNA library comprises at least 80% full-length sequences, preferably, at least 85% or 90% full-length sequences, and more preferably, at least 95% full-length sequences. The cDNA library can be normalized to increase the representation of rare sequences. Typically, but not exclusively, low or medium stringency hybridization conditions are employed for sequences having reduced sequence identity relative to the complementary sequence. For sequences of higher identity, medium and high stringency conditions can optionally be employed. Low stringency conditions allow for selective hybridization of sequences having about 70% sequence identity, and can be used to identify homologous or paralogous sequences.

[0181] Optionally, the polynucleotide will encode at least a portion of a protein scaffold encoded by a polynucleotide described herein. The polynucleotide comprises a nucleic acid sequence that can be used to selectively hybridize to a polynucleotide encoding a protein scaffold of the present disclosure. See, e.g., Ausubel, supra; Colligan, supra, each of which is incorporated herein by reference in its entirety.

[0182] Construction of nucleic acids

[0183] The isolated nucleic acids of the present disclosure can be made using (a) recombinant methods, (b) synthetic techniques, (c) purification techniques, and / or (d) combinations thereof, which are all well known in the art.

[0184] Nucleic acids can conveniently comprise nucleotide sequences other than the polynucleotides of the present disclosure. For example, a polylinker comprising one or more endonuclease restriction sites can be inserted into a nucleic acid to aid in isolation of the polynucleotides. Additionally, a translatable sequence can be inserted to aid in isolation of a post-translation polynucleotide of the present disclosure. For example, a hexahistidine marker sequence provides a convenient means of purifying a protein of the present disclosure. Nucleic acids of the present disclosure (other than coding sequences) are optionally vectors, adaptors, or linkers for cloning and / or expressing the polynucleotides of the present disclosure.

[0185] Additional sequences can be added to such cloning and / or expression sequences to optimize their function in cloning and / or expression, to aid in isolation of the polynucleotides, or to improve introduction of the polynucleotides into a cell. The use of cloning vectors, expression vectors, adaptors, and linkers is well known in the art. (See, e.g., Ausubel, supra; or Sambrook, supra).

[0186] Recombinant methods for constructing nucleic acids

[0187] The isolated nucleic acid compositions of the present disclosure (such as RNA, cDNA, genomic DNA, or any combination thereof) can be obtained from a biological source using any number of cloning methods known to those of skill in the art. In some aspects, oligonucleotide probes that selectively hybridize under stringent conditions to a polynucleotide of the present disclosure are used to identify the desired sequence in a cDNA or genomic DNA library. Isolation of RNA, as well as construction of cDNA and genomic libraries, are well known to those of ordinary skill in the art. (See, e.g., Ausubel, supra; or Sambrook, supra).

[0188] Methods of nucleic acid screening and isolation

[0189] Probes based on the polynucleotide sequences of the present disclosure can be used to screen cDNA or genomic libraries. Probes can be used to hybridize with genomic DNA or cDNA sequences to isolate homologous genes in the same or different organisms. Those skilled in the art will appreciate that various degrees of stringency can be employed in the assay; and the hybridization or wash medium can be stringent. As the hybridization conditions become more stringent, greater degrees of complementarity between the probe and target must exist in order for a duplex to form. Stringency can be controlled by one or more of temperature, ionic strength, pH, and the presence of chaotropic agents such as formamide. For example, the degree of stringency of hybridization can be conveniently varied by changing the polarity of the reactant solution, for example, manipulating the concentration of formamide in the range of 0% to 50%. The degree of complementarity (sequence identity) required for binding to be detected will vary depending on the degree of stringency of the hybridization and / or wash medium. The degree of complementarity will optimally be 100%, or 70% to 100%, or any range or value therein. However, it will be appreciated that minor sequence variations of the probes and primers can be compensated for by reducing the stringency of the hybridization and / or wash medium.

[0190] Methods of amplification of RNA or DNA are well known in the art and, based on the teachings and guidance provided herein, can be used in accordance with the present disclosure without undue experimentation.

[0191] Known methods of DNA or RNA amplification include, but are not limited to, polymerase chain reaction (PCR) and related amplification processes (see, e.g., U.S. Pat. Nos. 4,683,195, 4,683,202, 4,800,159, 4,965,188 to Mullis et al.; U.S. Pat. Nos. 4,795,699 and 4,921,794 to Tabor et al.; U.S. Pat. No. 5,142,033 to Innis; U.S. Pat. No. 5,122,464 to Wilson et al.; U.S. Pat. No. 5,091,310 to Innis; U.S. Pat. No. 5,066,584 to Gyllensten et al.; U.S. Pat. No. 4,889,818 to Gelfand et al.; U.S. Pat. No. 4,994,370 to Silver et al.; U.S. Pat. No. 4,766,067 to Biswas; U.S. Pat. No. 4,656,134 to Ringold) and RNA-mediated amplification, which uses antisense RNA to a target sequence as a template for double-stranded DNA synthesis (U.S. Pat. No. 5,130,238 to Malek et al., trade name NASBA), the entire contents of which are incorporated herein by reference. (See, e.g., Ausubel, supra; or Sambrook, supra.)

[0192] For example, the polynucleotide sequences and related genes of the present disclosure can be amplified directly from genomic DNA or from cDNA libraries using the polymerase chain reaction (PCR) technique. PCR and other in vitro amplification methods can also be used, for example, to clone nucleic acid sequences encoding a protein to be expressed, to make nucleic acids for use as probes for detecting the presence of the desired mRNA in a sample, for nucleic acid sequencing or for other purposes. Examples of techniques sufficient to direct one skilled person in the art by in vitro amplification methods can be found in Berger, supra; Sambrook, supra; and Ausubel, supra; and Mullis et al., U.S. Patent No. 4,683,202 (1987); and Innis et al., eds., PCR Protocols A Guide to Methods and Applications, Academic Press Inc., San Diego, Calif. (1990). Commercially available kits for genomic PCR amplification are known in the art. See, e.g., Advantage-GC Genomic PCR Kit (Clontech). Additionally, for example, T4 gene 32 protein (Boehringer Mannheim) can be used to improve the yield of long PCR products.

[0193] Synthetic methods for constructing nucleic acids

[0194] Isolated nucleic acids of the present disclosure can also be prepared by direct chemical synthesis by known methods (see, e.g., Ausubel et al., supra). Chemical synthesis generally produces single-stranded oligonucleotides, which can be converted to double-stranded DNA by hybridization with a complementary sequence, or by polymerization with a DNA polymerase using the single strand as a template. One of skill will recognize that, although chemical synthesis of DNA can be limited to sequences of about 100 or more bases, longer sequences can be obtained by the ligation of shorter sequences.

[0195] Expression vectors and host cells

[0196] The present disclosure also relates to vectors comprising the isolated nucleic acid molecules of the present disclosure, host cells that are genetically engineered with recombinant vectors, and the production of at least one protein scaffold by recombinant techniques, as is well known in the art. See, e.g., Sambrook et al., supra; Ausubel et al., supra, each incorporated by reference herein in their entireties.

[0197] The polynucleotide can optionally be linked to a vector containing a selectable marker for propagation in a host. Generally, the plasmid vector is introduced into a precipitate, such as a calcium phosphate precipitate, or into a complex comprising a charged lipid. If the vector is a virus, it can be packaged in vitro using an appropriate packaging cell line, and then transduced into a host cell.

[0198] The DNA insert should be operably linked to a suitable promoter. The expression construct will further contain sites for transcription initiation, termination, and, in the transcribed region, a ribosome binding site for translation. The coding portion of the mature transcript expressed by the construct will preferably include translation initiation and termination codons (e.g., UAA, UGA, or UAG) appropriately positioned at the ends of the mRNA to be translated, where UAA and UAG are preferred for mammalian or eukaryotic cell expression.

[0199] The expression vector will preferably, but optionally, include at least one selectable marker. Such markers include, for example, but are not limited to, ampicillin, zeocin (Sh bla gene), puromycin (pac gene), hygromycin B (hygB gene), G418 / geneticin (neo gene), DHFR (encoding dihydrofolate reductase and conferring resistance to methotrexate), mycophenolic acid, or glutamine synthetase (GS, U.S. Patent Nos. 5,122,464; 5,770,359; 5,827,739), blasticidin (bsd gene), resistance genes for eukaryotic cell culture, and ampicillin, zeocin (Sh bla gene), puromycin (pac gene), hygromycin B (hygB gene), G418 / geneticin (neo gene), kanamycin, spectinomycin, streptomycin, carbenicillin, bleomycin, erythromycin, polymyxin B, or tetracycline resistance genes for culturing in E. coli and other bacteria or prokaryotes (the aforementioned patents incorporated by reference in their entirety herein). Suitable media and conditions for the aforementioned host cells are known in the art. Suitable vectors will be apparent to those skilled in the art. The vector construct can be introduced into a host cell by calcium phosphate transfection, DEAE-dextran-mediated transfection, cationic lipid-mediated transfection, electroporation, transduction, infection, or other known methods. Such methods are described in the art, such as Sambrook, supra, Chapters 1-4 and 16-18; Ausubel, supra, Chapters 1, 9, 13, 15, 16.

[0200] The expression vector will preferably, but optionally, include at least one selective cell surface marker for isolating cells modified by the compositions and methods of the disclosure. Selective cell surface markers of the disclosure include surface proteins, glycoproteins, or protein groups that distinguish one cell or subpopulation of cells from another defined subpopulation of cells. Preferably, the selective cell surface marker will distinguish those cells modified by the compositions or methods of the disclosure from those cells not modified by the compositions or methods of the disclosure. Such cell surface markers include, for example, but are not limited to, “designated cluster” or “cluster determining” proteins (often abbreviated as “CD”), such as CD19, CD271, CD34, CD22, CD20, CD33, CD52, or any combination thereof, in truncated or full-length form. Cell surface markers further include the suicide gene marker RQR8 (Philip B, et al. Blood. 2014 Aug 21; 124(8): 1277-87).

[0201] The expression vector will preferably, but optionally, include at least one selective drug resistance marker for isolating cells modified by the compositions and methods of the disclosure. Selective drug resistance markers of the disclosure can include wild-type or mutant Neo, DHFR, TYMS, FRANCF, RAD51C, GCS, MDR1, ALDH1, NKX2.2, or any combination thereof.

[0202] At least one protein scaffold of the disclosure can be expressed in a modified form, such as a fusion protein, and can include not only a secretion signal, but also additional heterologous functional regions. For example, additional regions of amino acids, particularly charged amino acids, can be added to the N-terminus of the protein scaffold to improve stability and persistence in the host cell during purification or during subsequent handling and storage. In addition, peptide moieties can be added to the protein scaffold of the disclosure to facilitate purification. Such regions can be removed prior to final preparation of the protein scaffold or at least one fragment thereof. Such methods are described in many standard laboratory manuals, such as Sambrook, supra, Chapters 17.29-17.42 and 18.1-18.74; Ausubel, supra, Chapters 16, 17, and 18.

[0203] One of ordinary skill in the art appreciates the many expression systems that can be used to express nucleic acids encoding the proteins of the disclosure. Alternatively, the nucleic acids of the disclosure can be expressed in a host cell by turning on (by manipulation) of the endogenous DNA encoding the protein scaffold of the disclosure in the host cell. Such methods are well known in the art, for example, as described in U.S. Patent Nos. 5,580,734, 5,641,670, 5,733,746, and 5,733,761, which are incorporated by reference herein in their entireties.

[0204] Examples of cell cultures that can be used to produce the protein scaffolds, particular portions thereof, or variants are bacteria, yeast, and mammalian cells known in the art. Mammalian cell systems are typically in the form of a cell monolayer, although mammalian cell suspensions or bioreactors can also be used. A number of suitable host cell lines capable of expressing fully glycosylated proteins have been developed in the art and include COS-1 (e.g., ATCC CRL 1650), COS-7 (e.g., ATCC CRL-1651), HEK293, BHK21 (e.g., ATCC CRL-10), CHO (e.g., ATCC CRL 1610), and BSC-1 (e.g., ATCC CRL-26) cell lines, Cos-7 cells, CHO cells, hep G2 cells, P3X63Ag8.653, SP2 / 0-Ag14, 293 cells, HeLa cells, and the like, which are readily available from, for example, the American Type Culture Collection (www.atcc.org) in Manassas, Virginia. Preferred host cells include cells of lymphoid origin, such as myeloma and lymphoma cells. Particularly preferred host cells are P3X63Ag8.653 cells (ATCC Accession No. CRL-1580) and SP2 / 0-Ag14 cells (ATCC Accession No. CRL-1851). In a preferred aspect, the recombinant cell is a P3X63Ab8.653 or SP2 / 0-Ag14 cell.

[0205] Expression vectors for these cells can include one or more of the following expression control sequences, such as but not limited to an origin of replication; a promoter (e.g., a late or early SV40 promoter, a CMV promoter (U.S. Patent Nos. 5,168,062; 5,385,839), a HSV tk promoter, a pgk (phosphoglycerate kinase) promoter, an EF-1 alpha promoter (U.S. Patent No. 5,266,491), at least one human promoter; an enhancer, and / or a processing information site, such as a ribosome binding site, an RNA splice site, a polyadenylation site (e.g., the SV40 large T Ag poly A addition site), and a transcription terminator sequence. See, e.g., Ausubel et al., supra; Sambrook et al., supra. Other cells useful for producing the nucleic acids or proteins of the disclosure are known and / or available, e.g., from the American Type Culture Collection Cell Line and Hybridoma Catalog (www.atcc.org) or other known or commercial sources.

[0206] When using eukaryotic host cells, a polyadenylation or transcription terminator sequence is usually incorporated into the vector. An example of a terminator sequence is the polyadenylation sequence from the bovine growth hormone gene. Sequences for accurate splicing of the transcript can also be included. An example of a splicing sequence is the VP1 intron from SV40 (Sprague et al., J. Virol. 45:773-781 (1983)). In addition, sequences for genes that control replication in the host cell can be incorporated into the vector, as known in the art.

[0207] scFv purification

[0208] The scFv can be recovered and purified from recombinant cell cultures by well-known methods, including but not limited to protein A purification, ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography, and lectin chromatography. High performance liquid chromatography (“HPLC”) can also be used in purification. See, e.g., Colligan, Current Protocols in Immunology, or Current Protocols in Protein Science, John Wiley & Sons, NY, N.Y., (1997-2001), e.g., Chapters 1, 4, 6, 8, 9, 10, each of which is incorporated by reference herein in its entirety.

[0209] The scFv of the present disclosure include purified products, products of chemical synthesis procedures, and products produced by recombinant technology from prokaryotic or eukaryotic hosts including, for example, E. coli, yeast, higher plants, insect, and mammalian cells. Depending on the host used in the recombinant production procedure, the protein scaffolds of the present disclosure can be glycosylated or can be non-glycosylated. Such methods are described in many standard laboratory manuals, such as Sambrook, supra, Sections 17.37-17.42; Ausubel, supra, Chapters 10, 12, 13, 16, 18, and 20, Colligan, Protein Science, supra, Chapters 12-14, all of which are incorporated by reference herein in their entirety.

[0210] Amino acid code

[0211] Amino acids that make up the protein scaffolds of the disclosure are generally abbreviated. Amino acid nomenclature can be indicated by designating the amino acid by its one-letter code, its three-letter code, name, or three nucleotide codon, as is well known in the art (see Alberts, B. et al., Molecular Biology of The Cell, Third Edition, Garland Publishing, Inc., New York, 1994). The protein scaffolds of the disclosure can include one or more amino acid substitutions, deletions, or additions from spontaneous or mutations and / or human manipulation, as specified herein. Amino acids that are critical to a function of the protein scaffolds of the disclosure can be identified according to procedures known in the art, such as site-directed mutagenesis or alanine scanning mutagenesis (e.g., Ausubel, supra, chapters 8, 15; Cunningham and Wells, Science 244: 1081-1085 (1989)). The latter procedure tests the effect on the biological activity of a molecule, such as but not limited to at least one neutralizing activity, of replacing a residue in the molecule with alanine. Sites that are critical to the binding of the protein scaffolds can also be identified by structural analysis, such as crystallization, nuclear magnetic resonance, or photoaffinity labelling (Smith et al., J. Mol. Biol. 224: 899-904 (1992) and de Vos et al., Science 255: 306-312 (1992)).

[0212] As will be appreciated by those skilled in the art, the disclosure includes at least one biologically active protein scaffold of the disclosure. The specific activity of the biologically active protein scaffold is at least 20%, 30%, or 40%, and preferably at least 50%, 60%, or 70%, and most preferably at least 80%, 90%, or 95%-99% or more, of the specific activity of the native (non-synthetic), endogenous, or related and known protein scaffold. Methods of determining and quantitatively measuring enzyme activity and substrate specificity are well known to those skilled in the art.

[0213] In another aspect, the disclosure relates to protein scaffolds and fragments as described herein that are modified by covalent attachment of an organic moiety. Such modifications can result in protein scaffold fragments with improved pharmacokinetic properties, such as increased serum half-life in vivo. The organic moiety can be a straight-chain or branched hydrophilic polymeric group, a fatty acid group, or a fatty acid ester group. In particular aspects, the hydrophilic polymeric group can have a molecular weight of about 800 to about 120,000 Daltons, and can be a polyalkylene glycol (e.g., polyethylene glycol (PEG), polypropylene glycol (PPG)), a carbohydrate polymer, an amino acid polymer, or a polyvinylpyrrolidone, and the fatty acid or fatty acid ester group can comprise about eight to about forty carbon atoms.

[0214] The modified protein scaffolds and fragments of the present disclosure can comprise one or more organic moieties covalently bound directly or indirectly to the antibody. Each organic moiety bound to a protein scaffold or fragment of the present disclosure can independently be a hydrophilic polymer group, a fatty acid group, or a fatty acid ester group. As used herein, the term "fatty acid" encompasses mono- and di-carboxylic acids. As used herein, the term "hydrophilic polymer group" refers to an organic polymer that is more soluble in water than octane. For example, polylysine is more soluble in water than octane. Thus, the present disclosure encompasses protein scaffolds modified by covalent attachment of polylysine. Hydrophilic polymers suitable for modifying the protein scaffolds of the present disclosure can be linear or branched, and include, for example, polyalkylene glycols (e.g., PEG, monomethoxy-polyethylene glycol (mPEG), PPG, etc.), carbohydrates (e.g., dextran, cellulose, oligosaccharides, polysaccharides, etc.), hydrophilic amino acid polymers (e.g., polylysine, polyarginine, polyaspartic acid, etc.), polyalkylene oxides (e.g., polyethylene oxide, polypropylene oxide, etc.), and polyvinylpyrrolidone. Preferably, the hydrophilic polymers that modify the protein scaffolds of the present disclosure have a molecular weight of about 800 to about 150,000 daltons as a separate molecular entity. For example, PEG5000 and PEG20,000 can be used, where the subscript is the average molecular weight in daltons of the polymer. The hydrophilic polymer group can be substituted with one to about six alkyl, fatty acid, or fatty acid ester groups. Hydrophilic polymers substituted with fatty acid or fatty acid ester groups can be prepared by using suitable methods. For example, polymers comprising amine groups can be coupled with the carboxylic acid of a fatty acid or fatty acid ester, and activated carboxylic acids on the fatty acid or fatty acid ester (e.g., activated with N,N-carbonyldiimidazole) can be coupled with hydroxyl groups on the polymer.

[0215] Fatty acids and fatty acid esters suitable for modifying the protein scaffolds of the present disclosure can be saturated or can contain one or more units of unsaturation. Fatty acids suitable for modifying the protein scaffolds of the present disclosure include, for example, n-dodecanoic acid (C12, lauric acid), n-tetradecanoic acid (C14, myristic acid), n-octadecanoic acid (C18, stearic acid), n-eicosanoic acid (C20, arachidic acid), n-docosanoic acid (C22, behenic acid), n-triacontanoic acid (C30), n-tetracontanoic acid (C40), cis-Δ9-octadecanoic acid (C18, oleic acid), all cis-Δ5,8,11,14-eicosatetraenoic acid (C20, arachidonic acid), suberic acid, brassylic acid, octadecanedioic acid, docosanedioic acid, and the like. Suitable fatty acid esters include monoesters of di-carboxylic acids comprising linear or branched lower alkyl groups. The lower alkyl groups can comprise one to about twelve, preferably one to about six, carbon atoms.

[0216] Modified protein scaffolds and fragments can be prepared using suitable methods, such as by reaction with one or more modifying agents. As used herein, the term “modifying agent” refers to a suitable organic group (e.g., hydrophilic polymer, fatty acid, fatty acid ester) comprising an activating group. An “activating group” is a chemical moiety or functional group that can react with a second chemical group under appropriate conditions to form a covalent bond between the modifying agent and the second chemical group. For example, amine-reactive activating groups include electrophilic groups such as tosylate, mesylate, halo (chloro, bromo, fluoro, iodo), N-hydroxysuccinimidyl ester (NHS), and the like. Activating groups that can react with thiols include, for example, maleimide, iodoacetyl, acryloyl, pyridyl disulfide, 5-thiol-2-nitrobenzoic acid thiol (TNB-thiol), and the like. Aldehyde functional groups can couple to amine- or hydrazide-containing molecules, and azide groups can react with trivalent phosphorus groups to form phosphoramidate or phosphorimide linkages. Suitable methods for introducing activating groups into molecules are known in the art (see, e.g., Hermanson, G. T., Bioconjugate Techniques, Academic Press: San Diego, Calif. (1996)). The activating group can be bound directly to the organic group (e.g., hydrophilic polymer, fatty acid, fatty acid ester), or bound to the organic group through a linker moiety, e.g., a divalent C1-C12 group in which one or more carbon atoms can be replaced with a heteroatom (e.g., oxygen, nitrogen, or sulfur). Suitable linker moieties include, for example, tetraethyleneglycol,— (CH2)3—, —NH—(CH2)6—NH—, —(CH2)2—NH—, and —CH2—O—CH2—CH2—O—CH2—CH2—O—CH—NH—. Modifying agents comprising linker moieties can be produced, for example, by reacting a mono-Boc-alkyl diamine (e.g., mono-Boc-ethylenediamine, mono-Boc-diaminohexane) with a fatty acid in the presence of 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) to form an amide bond between the free amine and the fatty acid carboxylate. The Boc protecting group can be removed from the product by treatment with trifluoroacetic acid (TFA) to expose a primary amine, which can be coupled to said another carboxylate, or which can be reacted with maleic anhydride, and the resulting product cyclized to produce an activated maleimide derivative of the fatty acid. (See, e.g., Thompson et al., WO 92 / 16221, the entire teachings of which are incorporated herein by reference.)

[0217] The modified protein scaffolds of the present disclosure can be produced by reacting the protein scaffold or fragment with a modifying agent. For example, an organic moiety can be bound to the protein scaffold in a non-site-specific manner by using an amine-reactive modifying agent, such as the NHS ester of PEG. Modified protein scaffolds and fragments comprising an organic moiety bound to a specific site of the protein scaffolds of the present disclosure can be prepared using suitable methods, such as the methods described in Fisch et al., Bioconjugate Chem., 3: 147-153 (1992); Werlen et al., Bioconjugate Chem., 5: 411-417 (1994); Kumaran et al., Protein Sci. 6(10): 2233-2241 (1997); Itoh et al., Bioorg. Chem., 24(1): 59-68 (1996); Capellas et al., Biotechnol. Bioeng., 56(4): 456-463 (1997), and Hermanson, G. T., Bioconjugate Techniques, Academic Press: San Diego, Calif. (1996).

[0218] Cells and modified cells of the disclosure

[0219] The cells and modified cells of the present disclosure can be mammalian cells. The cells and modified cells are human cells. The cells and modified cells of the present disclosure can be immune cells. The immune cells of the present disclosure can comprise iPSCs, lymphoid progenitor cells, natural killer (NK) cells, T lymphocytes (T cells), stem memory T cells (T SCM cells), central memory T cells (T CM cells), stem cell-like T cells, B lymphocytes (B cells), antigen presenting cells (APCs), cytokine-induced killer (CIK) cells, myeloid progenitor cells, neutrophils, basophils, eosinophils, monocytes, macrophages, platelets, erythrocytes, red blood cells (RBCs), megakaryocytes, or osteoclasts.

[0220] The immune precursor cells can comprise any cell that can differentiate into one or more types of immune cells. The immune precursor cells can include pluripotent stem cells that are capable of self-renewal and development into immune cells. The immune precursor cells can comprise hematopoietic stem cells (HSCs) or progeny thereof. The immune precursor cells can comprise precursor cells that can develop into immune cells. The immune precursor cells can comprise hematopoietic progenitor cells (HPCs).

[0221] Hematopoietic stem cells (HSCs) are multipotent, self-renewing cells. All differentiated blood cells from lymphoid and myeloid lineages are generated from HSCs. HSCs can be found in adult bone marrow, peripheral blood, mobilized peripheral blood, peritoneal dialysis effluent, and umbilical cord blood.

[0222] HSCs can be isolated or derived from primary or cultured stem cells. HSCs can be isolated or derived from embryonic stem cells, pluripotent stem cells, multipotent stem cells, adult stem cells, or induced pluripotent stem cells (iPSCs).

[0223] Immune precursor cells can comprise HSCs or HSC progeny cells. Non-limiting examples of HSC progeny cells include pluripotent stem cells, lymphoid progenitor cells, natural killer (NK) cells, T lymphocytes (T cells), B lymphocytes (B cells), myeloid progenitor cells, neutrophils, basophils, eosinophils, monocytes, and macrophages.

[0224] HSCs generated by the disclosed methods can retain the characteristics of "primitive" stem cells that, while isolated or derived from adult stem cells and while belonging to a single lineage, share the properties of embryonic stem cells. For example, "primitive" HSCs generated by the disclosed methods retain their "stemness" after division and do not differentiate. Thus, as adoptive cell therapies, "primitive" HSCs generated by the disclosed methods not only replenish their numbers, but also expand in vivo. "Primitive" HSCs generated by the disclosed methods can be therapeutically effective when administered as a single dose.

[0225] Primitive HSCs can be CD34+. Primitive HSCs can be CD34+and CD38-. Primitive HSCs can be CD34+, CD38-, and CD90+. Primitive HSCs can be CD34+, CD38-, CD90+, and CD45RA-. Primitive HSCs can be CD34+, CD38-, CD90+, CD45RA-, and CD49f+. Primitive HSCs can be CD34+, CD38-, CD90+, CD45RA-, and CD49f+.

[0226] Primitive HSCs, HSCs, and / or HSC progeny cells can be modified to express an exogenous sequence (e.g., a chimeric antigen receptor or a therapeutic protein) according to the disclosed methods. Modified primitive HSCs, modified HSCs, and / or modified HSC progeny cells can be differentiated forward to produce modified immune cells, including but not limited to modified T cells, modified natural killer cells, and / or modified B cells.

[0227] Modified immune or immune precursor cells can be NK cells. NK cells can be cytotoxic lymphocytes differentiated from lymphoid progenitor cells. Modified NK cells can be derived from modified hematopoietic stem cells and progenitor cells (HSPCs) or modified HSCs. In some respects, inactivated NK cells are derived from CD3-depleted leukapheresis (containing CD14 / CD19 / CD56+ cells).

[0228] Modified immune or immune progenitor cells can be B cells. B cells are a type of lymphocyte that expresses B cell receptors on their cell surface. B cell receptors bind to specific antigens. Modified B cells can be derived from modified hematopoietic stem cells and progenitor cells (HSPCs) or modified HSCs.

[0229] The modified T cells disclosed herein can be derived from modified hematopoietic stem cells and progenitor cells (HSPCs) or modified HSCs. Unlike conventional biologics and chemotherapy agents, the disclosed modified T cells are capable of rapid proliferation upon antigen recognition, potentially avoiding the need for repeated treatment. To achieve this, in some embodiments, the modified T cells not only drive the initial response but also persist in the patient as a stable population of live memory T cells to prevent potential relapse. Alternatively, in some aspects, the modified T cells are not persistently present in the patient when not needed.

[0230] Significant efforts have been focused on the development of antigen receptor molecules that do not cause T cell exhaustion through antigen-independent (tetanic) signaling, and on molecules containing early memory T cells, especially stem cell memory (T cells). SCM The development of modified T cell products from stem cell-like T cells or stem cell-like T cells. The stem cell-like modified T cells disclosed herein exhibit maximum self-renewal capacity and pluripotency to derive central memory (T cells). CM T cells or T cells CM T-like cells, effector memory (T) EM ) and effector T cells (T E This leads to better tumor eradication and long-term transplantation of modified T cells. A linear pathway of differentiation may be responsible for generating these cells: naive T cells (T... N )>T SCM >T CM >T EM >T E >T TE Therefore, T N It directly generates T SCM The parental progenitor cells, which then directly produce T cells. CM The T cell compositions disclosed herein may comprise one or more of each parental T cell subset, wherein T...SCM Cells are most abundant (e.g., T SCM > T CM > T EM > T E > T TE ).

[0231] The immune cell precursor can differentiate into or be capable of differentiating into an early memory T cell, a stem cell-like T cell, a naive T cell (T N ), a T SCM , a T CM , a T EM , a T E , or a T TE . The immune cell precursor can be a primitive HSC, an HSC, or an HSC progeny cell of the disclosure. The immune cell can be an early memory T cell, a stem cell-like T cell, a naive T cell (T N ), a T SCM , a T CM , a T EM , a T E , or a T TE .

[0232] The modified cells of the disclosure

[0233] The methods of the disclosure (e.g., using mutant Cas-CLOVER compositions) can modify and / or generate a population of modified immune cells, wherein at least 0.01%, at least 0.02%, at least 0.03%, at least 0.04%, at least 0.05%, at least 0.06%, at least 0.07%, at least 0.08%, at least 0.09%, at least 0.1%, at least 0.2%, at least 0.3%, at least 0.4%, at least 0.5%, at least 0.6%, at least 0.7%, at least 0.8%, at least 0.9%, at least 1%, at least 1.5%, at least 2%, at least 3%, at least 4%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% of the cells in the population comprise a transgene or a sequence encoding a transgene, and wherein the modified cells have not been subjected to an enrichment protocol. In some embodiments, the modified cells are further enriched using an enrichment protocol.

[0234] The methods of the present disclosure (e.g., using mutant Cas-CLOVER compositions) can modify and / or generate a population of modified cells having a modification at a target sequence at a selected site in a genome. In some embodiments, the methods of the present disclosure can generate about 1.1-fold to about 100-fold more of a population of modified cells having a modification at a target sequence at a selected site in a genome compared to the number of modified cells that have not been generated using the methods of the present disclosure (e.g., using wild-type Cas-CLOVER or using a CRISPR / Cas9 system).

[0235] In some embodiments, the methods of the disclosure can produce a population of modified cells having a modification at a target sequence at a selected site of the genome that is about 1-fold to about 2-fold, about 2-fold to about 3-fold, about 3-fold to about 4-fold, about 4-fold to about 5-fold, about 5-fold to about 6-fold, about 6-fold to about 7-fold, about 7-fold to about 8-fold, about 8-fold to about 9-fold, about 9-fold to about 10-fold, about 10-fold to about 15-fold, about 15-fold to about 20-fold, about 20-fold to about 25-fold, about 25-fold to about 30-fold, about 30-fold to about 35-fold, about 35-fold to about 40-fold, about 40-fold to about 45-fold, about 45-fold to about 50-fold, about 50-fold to about 65-fold, about 65-fold to about 70-fold, about 70-fold to about 75-fold, about 75-fold to about 80-fold, about 80-fold to about 85-fold, about 85-fold to about 90-fold, about 90-fold to about 95-fold, about 95-fold to about 100-fold more than the number of modified cells generated without using the methods of the disclosure (e.g., using wild-type Cas-CLOVER or using a CRISPR / Cas9 system). In some embodiments, the methods of the disclosure (e.g., using a Cas-CLOVER system) can produce a population of modified cells having a modification at a target sequence at a selected site of the genome that is about 1-fold, about 2-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, or about 10-fold more than the population of modified cells (e.g., immune cells or liver cells) generated without using the methods of the disclosure (e.g., using a CRISPR / Cas9 system). In some embodiments, the methods of the disclosure (e.g., using a Cas-CLOVER system) can produce a population of modified cells having a transgene at a selected site of the genome that is about 1-fold, about 1.2-fold, about 1.3-fold, about 1.4-fold, about 1.5-fold, about 1.6-fold, about 1.7-fold, about 1.8-fold, about 1.9-fold, about 2-fold, about 2.1-fold, about 2.2-fold, about 2.3-fold, about 2.4-fold, about 2.5-fold, about 2.6-fold, about 2.7-fold, about 2.8-fold, about 2.9-fold, about 3-fold, about 3.1-fold, about 3.2-fold, about 3.3-fold, about 3.4-fold, about 3.5-fold, about 3.6-fold, about 3.7-fold, about 3.8-fold, about 3.9-fold, about 4-fold, about 4.1-fold, about 4.2-fold, about 4.3-fold, about 4.4-fold, about 4.5-fold, about 4.6-fold, about 4.7-fold, about 4.8-fold, about 4.9-fold, or about 5-fold more than the population of modified cells generated without using the methods of the disclosure (e.g., using a CRISPR / Cas9 system).

[0236] The methods of the disclosure (e.g., using mutant Cas-CLOVER compositions) can modify and / or generate a population of modified cells having a transgene or a sequence encoding a transgene at a selected site in the genome. In some embodiments, the methods of the disclosure can generate about 1-fold to about 2-fold, about 2-fold to about 3-fold, about 3-fold to about 4-fold, about 4-fold to about 5-fold, about 5-fold to about 6-fold, about 6-fold to about 7-fold, about 7-fold to about 8-fold, about 8-fold to about 9-fold, about 9-fold to about 10-fold of a population of modified cells having a transgene at a selected site in the genome compared to the number of modified cells that have not undergone the methods of the disclosure (e.g., using wild-type Cas-CLOVER or using a CRISPR / Cas9 system). In some embodiments, the methods of the disclosure (e.g., using mutant Cas-CLOVER compositions) can generate about 1-fold, about 2-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, or about 10-fold of a population of modified cells having a transgene at a selected site in the genome compared to the population of modified cells that have not undergone the methods of the disclosure (e.g., using wild-type Cas-CLOVER or using a CRISPR / Cas9 system).

[0237] The methods of the disclosure (e.g., using mutant Cas-CLOVER compositions) can modify and / or generate a population of modified cells (e.g., immune cells or hepatocytes) having a transgene or a sequence encoding a transgene at a selected site in the genome. In some embodiments, the methods of the disclosure (e.g., using mutant Cas-CLOVER compositions) can generate about 1-fold to about 2-fold, about 2-fold to about 3-fold, about 3-fold to about 4-fold, about 4-fold to about 5-fold, about 5-fold to about 6-fold, about 6-fold to about 7-fold, about 7-fold to about 8-fold, about 8-fold to about 9-fold, about 9-fold to about 10-fold of modified viable cells compared to the number of modified cells that have not undergone the methods of the disclosure (e.g., using wild-type Cas-CLOVER or using a CRISPR / Cas9 system). In some embodiments, the methods of the disclosure (e.g., using mutant Cas-CLOVER compositions) can generate about 1-fold, about 2-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, or about 10-fold of a population of modified viable cells compared to the population of modified cells that have not undergone the methods of the disclosure (e.g., using wild-type Cas-CLOVER or using a CRISPR / Cas9 system).

[0238] The methods of the present disclosure can modify and / or generate a population of modified cells (e.g., immune cells or hepatocytes), wherein at least 0.01%, at least 0.02%, at least 0.03%, at least 0.04%, at least 0.05%, at least 0.06%, at least 0.07%, at least 0.08%, at least 0.09%, at least 0.1%, at least 0.2%, at least 0.3%, at least 0.4%, at least 0.5%, at least 0.6%, at least 0.7%, at least 0.8%, at least 0.9%, at least 1%, at least 1.5%, at least 2%, at least 3%, at least 4%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% of the cells of the population comprise a transgene or a sequence encoding a transgene, and wherein the modified cells have not been subjected to an enrichment protocol. In some embodiments, the modified cells are further enriched using an enrichment protocol.

[0239] A population of modified cells (e.g., immune cells or hepatocytes) comprising a transgene or a sequence encoding a transgene, wherein at least 0.01%, at least 0.02%, at least 0.03%, at least 0.04%, at least 0.05%, at least 0.06%, at least 0.07%, at least 0.08%, at least 0.09%, at least 0.1%, at least 0.2%, at least 0.3%, at least 0.4%, at least 0.5%, at least 0.6%, at least 0.7%, at least 0.8%, at least 0.9%, at least 1%, at least 1.5%, at least 2%, at least 3%, at least 4%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% of the cells of the population comprise a transgene or a sequence encoding a transgene, and wherein the modified cells have not been subjected to an enrichment protocol. In some embodiments, the modified cells are further enriched using an enrichment protocol.

[0240] Compositions and methods of generating and / or expanding immune cells or immune precursor cells (e.g., the disclosed modified immune cells) and buffers for maintaining or enhancing levels of cell viability and / or stem cell-like phenotype of immune cells or immune precursor cells (e.g., the disclosed modified immune cells) are disclosed elsewhere herein.

[0241] The cells and modified immune cells of the present disclosure can be autologous cells or allogeneic cells. Allogeneic cells are engineered to prevent adverse reactions to the transplant upon administration to a subject. The allogeneic cells can be any type of cell. The allogeneic cells can be stem cells, or can be derived from stem cells. The allogeneic cells can be differentiated somatic cells.

[0242] Methods of expressing chimeric antigen receptors

[0243] The present disclosure provides methods of expressing a CAR on a surface of a cell. The method comprises: (a) obtaining a population of cells; (b) contacting the population of cells with a composition comprising a CAR or a sequence encoding a CAR under conditions sufficient to transfer the CAR across a cell membrane of at least one cell in the population of cells, thereby generating a modified population of cells; (c) culturing the modified population of cells under conditions suitable for integration of the sequence encoding the CAR; and (d) expanding and / or selecting at least one cell from the modified population of cells that expresses the CAR on a surface of a cell.

[0244] In some aspects, the population of cells can comprise leukocytes and / or CD4+ and CD8+ leukocytes. The population of cells can comprise CD4+ and CD8+ leukocytes at an optimized ratio. The optimized ratio of CD4+ to CD8+ leukocytes is not a ratio that occurs naturally in vivo. The population of cells can comprise tumor cells.

[0245] In some aspects, the conditions sufficient to transfer the CAR or the sequence encoding the CAR, the transposon, or the vector across a cell membrane of at least one cell in the population of cells comprise at least one of one or more electric pulses applied at a particular voltage, a buffer, and one or more supplement factors. In some aspects, the conditions suitable for integration of the sequence encoding the CAR comprise at least one of a buffer and one or more supplement factors.

[0246] The buffer can include PBS, HBSS, OptiMEM, BTXpress, Amaxa Nucleofector, human T cell nucleofection buffer, or any combination thereof. The one or more supplemental factors can include (a) a recombinant human cytokine, chemokine, interleukin, or any combination thereof; (b) a salt, mineral, metabolite, or any combination thereof; (c) a cell culture medium; (d) an inhibitor of cell DNA sensing, metabolism, differentiation, signal transduction, one or more apoptotic pathways, or a combination thereof; and (e) an agent that modifies or stabilizes one or more nucleic acids. The recombinant human cytokine, chemokine, interleukin, or any combination thereof can include IL2, IL7, IL12, IL15, IL21, IL1, IL3, IL4, IL5, IL6, IL8, CXCL8, IL9, IL10, IL11, IL13, IL14, IL16, IL17, IL18, IL19, IL20, IL22, IL23, IL25, IL26, IL27, IL28, IL29, IL30, IL31, IL32, IL33, IL35, IL36, GM-CSF, IFN-gamma, IL-lalpha / IL-lF1, IL-lbeta / IL-lF2, IL-12p70, IL-12 / IL-35p35, IL-13, IL-17 / IL-17A, IL-17A / F heterodimer, IL-17F, IL-18 / IL-lF4, IL-23, IL-24, IL-32, IL-32beta, IL-32gamma, IL-33, LAP (TGF-beta1), Lymphotoxin-alpha / TNF-beta, TGF-beta, TNF-alpha, TRANCE / TNFSF11 / RANK L, or any combination thereof. The salt, mineral, metabolite, or any combination thereof can include HEPES, nicotinamide, heparin, sodium pyruvate, L-glutamine, MEM nonessential amino acids solution, ascorbic acid, nucleosides, FBS / FCS, human serum, serum replacement, antibiotics, pH adjusters, Earle's salts, 2-mercaptoethanol, human transferrin, recombinant human insulin, human serum albumin, nucleofection PLUS supplement, KCL, MgCl2, Na2HPO4, NAH2PO4, sodium lactobionate, mannitol, sodium succinate, sodium chloride, CINa, glucose, Ca(NO3)2, Tris / HCl, K2HPO4, KH2PO4, polyethylenimine, polyethylene glycol, poloxamer 188, poloxamer 181, poloxamer 407, polyvinylpyrrolidone, Pop 313, crown ether-5, or any combination thereof.The cell culture medium can include PBS, HBSS, OptiMEM, DMEM, RPMI 1640, AIM-V, X-VIVO 15, CellGro DC Medium, CTSOpTimizer T Cell Expansion SFM, TexMACS Medium, PRIME-XV T Cell Expansion Medium, ImmunoCult-XF T Cell Expansion Medium, or any combination thereof. The inhibitor of cell DNA sensing, metabolism, differentiation, signal transduction, one or more apoptotic pathways, or a combination thereof includes an inhibitor of TLR9, MyD88, IRAK, TRAF6, TRAF3, IRF-7, NF-KB, type 1 interferon, proinflammatory cytokine, cGAS, STING, Sec5, TBK1, IRF-3, RNA pol III, RIG-1, IPS-1, FADD, RIP1, TRAF3, AIM2, ASC, Caspase1, Pro-IL1B, PI3K, Akt, Wnt3A; an inhibitor of glycogen synthase kinase-3beta (GSK-3beta) (e.g., TWS119); or any combination thereof. Examples of such inhibitors can include bafilomycin, chloroquine, quinacrine, AC-YVAD-CMK, Z-VAD-FMK, Z-IETD-FMK, or any combination thereof. The agent that modifies or stabilizes one or more nucleic acids includes a pH modifying agent, a DNA binding protein, a lipid, a phospholipid, CaP04, a net neutral charge DNA binding peptide with or without NLS sequence, a TREX1 enzyme, or any combination thereof.

[0247] The expanding and selecting steps can occur simultaneously or sequentially. The expanding can occur prior to the selecting. The expanding can occur after the selecting, and optionally, a further (i.e., second) selecting can occur after the expanding. Simultaneous expanding and selecting can be performed concurrently. The expanding and / or selecting steps can be performed for a period of 10 to 14 days, inclusive.

[0248] The expanding can include contacting at least one cell of the population of modified cells with an antigen to stimulate the at least one cell through the CAR, thereby generating a population of expanded cells. The antigen can be presented on a surface of a substrate. The substrate can have any form, including but not limited to one or more surfaces, wells, beads, and matrices. The substrate can further include a paramagnetic or magnetic component. The antigen can be presented on a surface of a substrate, wherein the substrate is a magnetic bead, and wherein a magnet can be used to remove or isolate the magnetic bead from the population of modified and expanded cells. The antigen can be presented on a surface of a cell or artificial antigen presenting cell. The artificial antigen presenting cell can include, but is not limited to, a tumor cell and a stem cell.

[0249] In some aspects in which the transposon or vector comprises a selection gene, the selecting step comprises contacting at least one cell of the population of modified cells with a compound to which the selection gene confers resistance, whereby cells expressing the selection gene are identified as surviving the selection, and cells failing to express the selection gene are identified as failing to survive the selection step.

[0250] The present disclosure provides compositions comprising the population of modified, expanded, and selected cells of the methods described herein.

[0251] More detailed descriptions of methods for expressing a CAR on the surface of a cell are disclosed in PCT Publication No. WO 2019 / 049816 and PCT / US2019 / 049816.

[0252] The present disclosure provides a cell or population of cells, wherein the cell comprises a composition comprising (a) an inducible transgenic construct comprising a sequence encoding an inducible promoter and a sequence encoding a transgene, and (b) a receptor construct comprising a sequence encoding a constitutive promoter and a sequence encoding an exogenous receptor, such as a CAR, wherein upon integration of the construct of (a) and the construct of (b) into the genomic sequence of the cell, the exogenous receptor is expressed, and wherein the exogenous receptor, upon binding a ligand or antigen, transduces an intracellular signal that directly or indirectly targets the inducible promoter, thereby modulating expression of the inducible transgene (a), thereby modifying gene expression.

[0253] The composition can modify gene expression by reducing gene expression. The composition can modify gene expression by transiently modifying gene expression (e.g., for the duration of the time a ligand is bound to the exogenous receptor). The composition can modify gene expression for a short period of time (e.g., a ligand reversibly binds to the exogenous receptor). The composition can modify gene expression for a long period of time (e.g., a ligand irreversibly binds to the exogenous receptor).

[0254] The exogenous receptor can comprise an endogenous receptor relative to the genomic sequence of the cell. Exemplary receptors include, but are not limited to, intracellular receptors, cell surface receptors, transmembrane receptors, ligand-gated ion channels, and G protein-coupled receptors.

[0255] The exogenous receptor can comprise a non-naturally occurring receptor. The non- naturally occurring receptor can be a synthetic, modified, recombinant, mutated, or chimeric receptor. The non-naturally occurring receptor can comprise one or more sequences isolated from or derived from a T cell receptor (TCR). The non-naturally occurring receptor can comprise one or more sequences isolated from or derived from a scaffold protein. In some aspects, including those in which the non-naturally occurring receptor does not comprise a transmembrane domain, the non-naturally occurring receptor interacts with a second transmembrane, membrane-bound, and / or intracellular receptor that transduces an intracellular signal upon contact with the non-naturally occurring receptor. The non-naturally occurring receptor can comprise a transmembrane domain. The non-naturally occurring receptor can interact with an intracellular receptor that transduces an intracellular signal. The non-naturally occurring receptor can comprise an intracellular signaling domain. The non-naturally occurring receptor can be a chimeric ligand receptor (CLR). The CLR can be a chimeric antigen receptor (CAR).

[0256] The sequence encoding the inducible promoter comprises a sequence encoding an NFKB promoter, a sequence encoding an interferon (IFN) promoter, or a sequence encoding an interleukin-2 promoter. In some aspects, the IFN promoter is an IFNy promoter. The inducible promoter can be isolated or derived from a promoter of a cytokine or chemokine. The cytokine or chemokine can include IL2, IL3, IL4, IL5, IL6, IL10, IL12, IL13, IL17A / F, IL21, IL22, IL23, transforming growth factor beta (TGFp), granulocyte colony-stimulating factor 2 (GM-CSF), interferon gamma (IFNy), tumor necrosis factor alpha (TNFa), LTa, perforin, granzyme C (Gzmc), granzyme B (Gzmb), C-C motif chemokine ligand 5 (CCL5), C-C motif chemokine ligand 4 (Ccl4), C-C motif chemokine ligand 3 (Ccl3), X-C motif chemokine ligand 1 (Xcll), or LIF interleukin 6 family cytokine (Lif).

[0257] The inducible promoter can be isolated or derived from a promoter of a gene comprising a surface protein involved in cell differentiation, activation, exhaustion, and function. In some aspects, the gene includes CD69, CD71, CTLA4, PD-1, TIGIT, LAG3, TIM-3, GITR, MHCII, COX-2, FASL, or 4-1BB.

[0258] The inducible promoter can be isolated or derived from a promoter of a gene involved in CD metabolism and differentiation. The inducible promoter can be isolated or derived from a promoter of Nr4a1, Nr4a3, Tnfrsf9 (4-1BB), Sema7a, Zfp36l2, Gadd45b, Dusp5, Dusp6, and Neto2.

[0259] In some aspects, the inducible transgenic construct comprises or drives expression of an inhibitory checkpoint signal, a transcription factor, a cytokine or cytokine receptor, a chemokine or chemokine receptor, a cell death or apoptosis receptor / ligand, a metabolic sensor molecule, a protein that confers sensitivity to a cancer therapy, and a signaling component downstream of an oncogene or tumor suppressor gene. Non-limiting examples of which are disclosed in PCT Publication No. WO 2019 / 173636 and PCT Application No. PCT / US2019 / 049816.

[0260] The present disclosure provides a method of producing a population of modified T cells, the method comprising, consisting essentially of, or consisting of introducing a composition comprising a CAR of the present disclosure or a sequence encoding a CAR of the present disclosure into a plurality of primary human T cells to produce a plurality of modified T cells. The present disclosure provides a composition comprising a population of modified T cells produced by the method. In some aspects, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the population expresses a CAR of the present disclosure.

[0261] Transposon and vector compositions

[0262] The present disclosure provides compositions and methods for delivering a therapeutic protein (an antibody (e.g., scFv) or a CAR (e.g., comprising an scFv)) to a cell or a population of cells. Non-limiting examples of compositions for delivering a composition of the present disclosure to a cell or a population of cells include a transposon or a vector. Accordingly, the present disclosure provides a transposon comprising a therapeutic protein (an antibody (e.g., scFv) or a CAR (e.g., comprising an scFv)) or a vector comprising a therapeutic protein (an antibody (e.g., scFv) or a CAR (e.g., comprising an scFv)).

[0263] A transposon comprising a therapeutic protein of the present disclosure or a vector comprising a therapeutic protein of the present disclosure can further comprise a sequence encoding an inducible pro-apoptotic polypeptide. Alternatively or additionally, one transposon or one vector can comprise a therapeutic protein of the present disclosure and a second transposon or a second vector can comprise a sequence encoding an inducible pro-apoptotic polypeptide of the present disclosure. Inducible pro-apoptotic polypeptides are described in greater detail herein.

[0264] A transposon comprising a therapeutic protein of the disclosure or a vector comprising a therapeutic protein of the disclosure can further comprise a sequence encoding a chimeric stimulatory receptor (CSR). Alternatively or additionally, one transposon or one vector can comprise a CAR of the disclosure and a second transposon or a second vector can comprise a sequence encoding a CSR of the disclosure. Chimeric stimulatory receptors are described in more detail herein.

[0265] A transposon comprising a therapeutic protein of the disclosure or a vector comprising a therapeutic protein of the disclosure can further comprise a sequence encoding a recombinant HLA-E polypeptide. Alternatively or additionally, one transposon or one vector can comprise a therapeutic protein of the disclosure and a second transposon or a second vector can comprise a sequence encoding a recombinant HLA-E polypeptide. Recombinant HLA-E polypeptides are described in more detail herein.

[0266] A transposon comprising a therapeutic protein of the disclosure or a vector comprising a therapeutic protein of the disclosure can further comprise a selection gene. A selection gene can encode a gene product that is essential for cell viability and survival. A selection gene can encode a gene product that is essential for cell viability and survival when challenged with a selective cell culture condition. A selective cell culture condition can comprise a compound that is detrimental to cell viability or survival, and wherein the gene product confers resistance to the compound. Non-limiting examples of selection genes include neo (confers resistance to neomycin), DHFR (encodes dihydrofolate reductase and confers resistance to methotrexate), TYMS (encodes thymidylate synthetase), MGMT (encodes O(6)-methylguanine-DNA methyltransferase), a multidrug resistance gene (MDR1), ALDH1 (encodes aldehyde dehydrogenase 1 family member A1), FRANCF, RAD51C (encodes RAD51 Paralog C), GCS (encodes glucosylceramide synthase), NKX2.2 (encodes NK2 Homeobox 2), or any combination thereof.

[0267] In a preferred aspect, the selection gene encodes a DHFR mutanase. The DHFR mutanase comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 37. The DHFR mutanase is encoded by a polynucleotide comprising, consisting essentially of, or consisting of the nucleic acid sequence of SEQ ID NO: 38 or SEQ ID NO: 39. The amino acid sequence of the DHFR mutanase can further comprise a mutation at one or more of positions 80, 113, or 153. The amino acid sequence of the DHFR mutanase can comprise one or both of a substitution of phenylalanine (F) or leucine (L) at position 80, a substitution of leucine (L) or valine (V) at position 113, and a substitution of valine (V) or aspartic acid (D) at position 153.

[0268] The transposon comprising a CAR of the disclosure or the vector comprising a CAR of the disclosure can further comprise at least one self-cleaving peptide. For example, the self-cleaving peptide can be located between the CAR (e.g., comprising an scFv) and the inducible pro-apoptotic polypeptide; or, the self-cleaving peptide can be located between the CAR (e.g., comprising an scFv) and the protein encoded by the selection gene.

[0269] The transposon comprising a CAR of the disclosure or the vector comprising a CAR of the disclosure can further comprise at least two self-cleaving peptides. For example, a first self-cleaving peptide is located upstream of or immediately upstream of the CAR and a second self-cleaving peptide is located downstream of or immediately downstream of the CAR; or, a first self-cleaving peptide and a second self-cleaving peptide flank the CAR. For example, a first self-cleaving peptide is located upstream of or immediately upstream of the inducible pro-apoptotic polypeptide and a second self-cleaving peptide is located downstream of or immediately downstream of the inducible pro-apoptotic polypeptide; or, a first self-cleaving peptide and a second self-cleaving peptide flank the inducible pro-apoptotic polypeptide. For example, a first self-cleaving peptide is located upstream of or immediately upstream of the protein encoded by the selection gene, a second self-cleaving peptide is located downstream of or immediately downstream of the protein encoded by the selection gene; or, a first self-cleaving peptide and a second self-cleaving peptide flank the protein encoded by the selection gene.

[0270] Inducible pro-apoptotic polypeptides

[0271] The inducible pro-apoptotic polypeptides disclosed herein are superior to existing inducible polypeptides because the inducible pro-apoptotic polypeptides of the disclosure are much less immunogenic. The inducible pro-apoptotic polypeptides are recombinant polypeptides, and thus are not naturally occurring. Further, the sequences of the inducible pro-apoptotic polypeptides are recombinant to produce a sequence that does not comprise a non-human sequence that the immune system of a host can recognize as “non-self,” and thus induce an immune response in a subject that receives the inducible pro-apoptotic polypeptide, a cell comprising the inducible pro-apoptotic polypeptide, or a composition comprising the inducible pro-apoptotic polypeptide, or in a cell comprising the inducible pro-apoptotic polypeptide.

[0272] The present disclosure provides inducible pro-apoptotic polypeptides comprising a ligand binding region, a linker, and a pro-apoptotic peptide, wherein the inducible pro-apoptotic polypeptide does not comprise non-human sequences. In certain aspects, the non-human sequences comprise a restriction site. In certain aspects, the ligand binding region can be a multimeric ligand binding region. In certain aspects, the pro-apoptotic peptide is a caspase polypeptide. Non-limiting examples of caspase polypeptides include caspase 1, caspase 2, caspase 3, caspase 4, caspase 5, caspase 6, caspase 7, caspase 8, caspase 9, caspase 10, caspase 11, caspase 12, and caspase 14. Preferably, the caspase polypeptide is a caspase 9 polypeptide. The caspase 9 polypeptide can be a truncated caspase 9 polypeptide. The inducible pro-apoptotic polypeptide can be non-naturally occurring. When the caspase is caspase 9 or a truncated caspase 9, the inducible pro-apoptotic polypeptide can also be referred to as an “iC9 safety switch.”

[0273] The inducible caspase polypeptide can comprise (a) a ligand binding region, (b) a linker, and (c) a caspase polypeptide, wherein the inducible pro-apoptotic polypeptide does not comprise non-human sequences. In certain aspects, the inducible caspase polypeptide comprises (a) a ligand binding region, (b) a linker, and (c) a truncated caspase 9 polypeptide, wherein the inducible pro-apoptotic polypeptide does not comprise non-human sequences.

[0274] The ligand binding region can comprise a FK506 binding protein 12 (FKBP12) polypeptide. The amino acid sequence of the ligand binding region comprising a FK506 binding protein 12 (FKBP12) polypeptide can comprise a modification at position 36 of the sequence. The modification can be a substitution of valine (V) at position 36 with phenylalanine (F) (F36V). The FKBP12 polypeptide can comprise, consist essentially of, or consist of an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to SEQ ID NO: 40. The FKBP12 polypeptide can be encoded by a polynucleotide comprising or consisting of a nucleic acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to SEQ ID NO: 41.

[0275] The linker region can comprise, consist essentially of, or consist of an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to SEQ ID NO: 42, or the linker region can be encoded by a polynucleotide comprising or consisting of a nucleic acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to SEQ ID NO: 43. In some aspects, the nucleic acid sequence encoding the linker does not comprise a restriction site.

[0276] The truncated caspase 9 polypeptide can comprise an amino acid sequence that does not comprise an arginine (R) at sequence position 87. Alternatively or additionally, the truncated caspase 9 polypeptide can comprise an amino acid sequence that does not comprise an alanine (A) at sequence position 282. The truncated caspase 9 polypeptide can comprise, consist essentially of, or consist of an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to SEQ ID NO: 44, or the truncated caspase 9 polypeptide can be encoded by a polynucleotide comprising or consisting of a nucleic acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to SEQ ID NO: 45.

[0277] In certain aspects, when the polypeptide comprises a truncated caspase 9 polypeptide, the inducible pro-apoptotic polypeptide comprises, consists essentially of, or consists of an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to SEQ ID NO: 46, or the inducible pro-apoptotic polypeptide is encoded by a polynucleotide comprising or consisting of a nucleic acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to SEQ ID NO: 47.

[0278] In certain aspects, when the polypeptide comprises a truncated caspase 9 polypeptide, the inducible pro-apoptotic polypeptide comprises, consists essentially of, or consists of an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to SEQ ID NO: 48, or the inducible pro-apoptotic polypeptide is encoded by a polynucleotide comprising or consisting of a nucleic acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to SEQ ID NO: 49.

[0279] The inducible pro-apoptotic polypeptide can be expressed in a cell under the transcriptional regulation of any promoter known in the art that is capable of initiating and / or modulating expression of the inducible pro-apoptotic polypeptide in the cell.

[0280] Activation of the inducible pro-apoptotic polypeptide can be achieved by, for example, chemical-induced dimerization (CID) mediated by an inducer to produce a conditionally controlled protein or polypeptide. The pro-apoptotic polypeptides are not only inducible, but also reversible in their induction due to degradation of the destabilizing dimerizer or administration of a monomer-competitive inhibitor.

[0281] Inducible pro-apoptotic peptides and methods of inducing these peptides are described in detail in U.S. Patent Publication No. WO 2019 / 0225667 and PCT Publication No. WO 2018 / 068022.

[0282] Formulations, dosages, and modes of administration

[0283] The present disclosure provides formulations, dosages, and methods of administration of the compositions described herein.

[0284] The disclosed compositions and pharmaceutical compositions can further comprise at least one of any suitable auxiliary agent, such as, but not limited to, diluents, binders, stabilizers, buffers, salts, lipophilic solvents, preservatives, adjuvants, and the like. Pharmaceutically acceptable auxiliary agents are preferred. Non-limiting examples of such sterile solutions and methods of preparation are well known in the art, such as, but not limited to, Gennaro, ed., Remington's Pharmaceutical Sciences, 18th Ed., Mack Publishing Co. (Easton, Pa.) 1990 and "Physician's Desk Reference", 52ndEd., Medical Economics (Montvale, N.J.) 1998. Pharmaceutically acceptable carriers suitable for the mode of administration, solubility, and / or stability of the protein scaffold, fragment, or variant compositions known in the art or as described herein can be routinely selected.

[0285] Non-limiting examples of pharmaceutical excipients and additives suitable for use include proteins, peptides, amino acids, lipids, and carbohydrates (e.g., sugars, including monosaccharides, disaccharides, trisaccharides, tetrasaccharides, and oligosaccharides; derivatized sugars, such as sugar alcohols, aldonic acids, esterified sugars, and the like; and polysaccharides or sugar polymers), which can be present alone or in combination, alone or in combination comprising 1% to 99.99% by weight or volume. Non-limiting examples of protein excipients include serum albumin, such as human serum albumin (HSA), recombinant human albumin (rHA), gelatin, casein, and the like. Representative amino acid / protein components that can also be used for buffer capacity include alanine, glycine, arginine, betaine, histidine, glutamic acid, aspartic acid, cysteine, lysine, leucine, isoleucine, valine, methionine, phenylalanine, aspartame, and the like. One preferred amino acid is glycine.

[0286] Non-limiting examples of carbohydrate excipients suitable for use include monosaccharides, such as fructose, maltose, galactose, glucose, D-mannose, sorbose, and the like; disaccharides, such as lactose, sucrose, trehalose, cellobiose, and the like; polysaccharides, such as raffinose, melezitose, maltodextrin, dextran, starch, and the like; and sugar alcohols, such as mannitol, xylitol, maltitol, lactitol, xylitol sorbitol (glucitol), inositol, and the like. Preferably, the carbohydrate excipient is mannitol, trehalose, and / or raffinose.

[0287] The composition can also include a buffering agent or pH adjusting agent; typically, the buffering agent is a salt prepared from an organic acid or base. Representative buffering agents include organic acid salts, such as salts of citric acid, ascorbic acid, gluconic acid, carbonic acid, tartaric acid, succinic acid, acetic acid, or phthalic acid; tris-hydroxymethyl aminomethane, tromethamine hydrochloride, or phosphate buffers. Preferred buffering agents are organic acid salts, such as citrate salts.

[0288] Additionally, the disclosed compositions can include polymeric excipients / additives, such as polyvinylpyrrolidone, sucralose (polymeric sugar), dextrates (e.g., cyclodextrins, such as 2-hydroxypropyl- -cyclodextrin), polyethylene glycol, flavoring agents, antimicrobial agents, sweetening agents, antioxidants, antistatic agents, surfactants (e.g., polysorbate, such as “TWEEN 20” and “TWEEN 80”), lipids (e.g., phospholipids, fatty acids), steroids (e.g., cholesterol), and chelating agents (e.g., EDTA).

[0289] A therapeutically effective amount of the compositions or pharmaceutical compositions disclosed herein can be administered using a number of known and developing modalities. Non-limiting examples of modalities include bolus, buccal, infusion, intraarticular, intrabronchial, intraabdominal, intracapsular, intracartilaginous, intracavitary, intracelial, intracerebellar, intracerebroventricular, intracolic, intracervical, intragastric, intrahepatic, intralesional, intramuscular, intramyocardial, intranasal, intraocular, intraosseous, intrapelvic, intraperitoneal, intrapleural, intraprostatic, intrapulmonary, intrarectal, intrarenal, intraretinal, intraspinal, intrasynovial, intrathoracic, intrauterine, intratumoral, intravenous, intravesical, oral, parenteral, rectal, sublingual, subcutaneous, transdermal, or vaginal.

[0290] The compositions of the present disclosure can be prepared for parenteral (subcutaneous, intramuscular, or intravenous) or any other administration, particularly in the form of a liquid solution or suspension; for use in vaginal or rectal administration, particularly in semisolid form, such as but not limited to creams and suppositories; for buccal or sublingual administration, such as but not limited to in the form of tablets or capsules; or intranasal administration, such as but not limited to in the form of powders, nasal drops, or aerosols or certain pharmaceutical agents; or transdermal administration, such as but not limited to gel, ointment, lotion, suspension, or patch delivery systems, in which chemical enhancers such as dimethylsulfoxide are used to modify the structure of the skin or to increase the concentration of the drug in transdermal patches (Junginger et al., in “Drug Permeation Enhancement,” Hsieh, D.S., Ed., pp. 59-90 (Marcel Dekker, Inc. New York 1994)), or oxidizing agents, which enable the application of formulations containing proteins and peptides to the skin (WO 98 / 53847), or the application of an electric field to create a transient transport pathway, such as electroporation, or to increase the mobility of charged drugs through the skin, such as iontophoresis, or the application of ultrasound, such as sonophoresis (U.S. Pat. Nos. 4,309,989 and 4,767,402) (the above publications and patents are incorporated herein by reference in their entirety).

[0291] For parenteral administration, any of the compositions disclosed herein can be formulated with a pharmaceutically acceptable parenteral carrier or used alone. Solutions, suspensions, emulsions, granules, powders or lyophilized powders can be formulated with the compositions disclosed herein either alone or in combination with a pharmaceutically acceptable parenteral carrier. Formulations for parenteral administration can contain as a common excipient sterile water or saline, polyalkylene glycols such as polyethylene glycol, a vegetable source of oil, hydrogenated naphthalenes, and the like. Aqueous or oil solutions for injection can be prepared according to known methods using suitable wetting or emulsifying agents and suspending agents. The injectable form can be a non-toxic, non-oral diluent, such as an aqueous solution, a sterile injection solution or a suspension in a solvent. As a useful carrier or solvent, water, Ringer's solution, isotonic saline and the like can be used; as a general solvent or suspension solvent, sterile non-volatile oil can be used. For these purposes, any kind of non-volatile oil and fatty acid, including natural or synthetic or semi-synthetic fatty oil or fatty acid; natural or synthetic or semi-synthetic monoglyceride or diglyceride or triglyceride can be used. Parenteral administration is known in the art and includes, but is not limited to, conventional injection means, a pneumatic needleless injection device as described in U.S. Patent No. 5,851,198, and a laser perforation device as described in U.S. Patent No. 5,839,446.

[0292] Formulations for oral administration rely on the co-administration of adjuvants (e.g., resorcinols and non-ionic surfactants such as polyoxyethylene oleyl ether and n-hexadecyl polyethylene ether) to artificially increase the permeability of the intestinal wall, and co-administration of enzymatic inhibitors (e.g., pancreatic trypsin inhibitors, diisopropylfluorophosphate (DFF), and trasylol) to inhibit enzymatic degradation. Formulations for delivery of hydrophilic agents, including proteins and protein scaffolds, and combinations of at least two surfactants, are described in U.S. Patent No. 6,309,663, which are contemplated for oral, buccal, mucosal, nasal, pulmonary, vaginal, transmembrane, or rectal administration. Active ingredient compounds in solid dosage forms for oral administration can be mixed with at least one additive, including sucrose, lactose, cellulose, mannitol, trehalose, raffinose, maltitol, dextran, starch, agar, arginine, chitin, chitosan, pectin, gum tragacanth, gum arabic, gelatin, collagen, casein, albumin, synthetic or semi-synthetic polymers, and glycerides. These dosage forms can also contain other types of additives, such as inert diluents, lubricants (such as magnesium stearate, p-hydroxybenzoate), preservatives (such as sorbic acid, ascorbic acid, a-tocopherol), antioxidants (such as cysteine), disintegrants, binders, thickening agents, buffers, sweeteners, flavorings, perfumes, and the like.

[0293] Tablets and pills can be further processed into enteric coated formulations. Liquid formulations for oral administration include emulsions, syrups, elixirs, suspensions, and solutions which can be permitted for medical use. These formulations can contain non-active diluents commonly used in the art, such as water. Liposomes have also been described as drug delivery systems for insulin and heparin (U.S. Patent No. 4,239,754). More recently, artificial polymeric microspheres of mixed amino acids (proteinoids) have been used to deliver drugs (U.S. Patent No. 4,925,673). In addition, carrier compounds described in and used for oral delivery of biologically active agents in U.S. Patent No. 5,879,681 and U.S. Patent No. 5,871,753 are known in the art.

[0294] For pulmonary administration, preferably, the compositions or pharmaceutical compositions described herein are delivered in a particle size effective to reach the lower respiratory tract of the lungs or sinuses. The compositions or pharmaceutical compositions can be delivered by any of a variety of inhalation or nasal devices known in the art for administering therapeutic agents by inhalation. These devices, which are capable of depositing an aerosolized formulation in the sinus cavities or alveoli of a patient, include metered dose inhalers, nebulizers (e.g., jet nebulizers, ultrasonic nebulizers), dry powder generators, sprayers, and the like. All such devices can use formulations appropriate for administration for dispensing the compositions or pharmaceutical compositions described herein in an aerosol. Such aerosols can comprise solutions (both aqueous and non-aqueous) or solid particles. In addition, a spray comprising the compositions or pharmaceutical compositions described herein can be produced by forcing a suspension or solution of at least one protein scaffold under pressure through a nozzle. In a metered dose inhaler (MDI), the propellant, the compositions or pharmaceutical compositions described herein, and any excipients or other additives are contained in a canister as a mixture including a liquefied compressed gas. Actuation of a metering valve releases the mixture as an aerosol, which preferably contains particles in the size range of less than about 10 pm, preferably about 1 pm to about 5 pm, and most preferably about 2 pm to about 3 pm. A more detailed description of pulmonary administration, formulations, and related devices is disclosed in PCT Publication No. WO 2019 / 049816.

[0295] For absorption through mucosal surfaces, the composition includes an emulsion containing a plurality of submicron particles, a mucoadhesive macromolecule, a biologically active peptide, and an aqueous continuous phase, which facilitates absorption through mucosal surfaces by effecting mucoadhesion of the emulsion particles (U.S. Patent No. 5,514,670). Mucosal surfaces suitable for application of the emulsions of the present disclosure can include corneal, conjunctival, buccal, sublingual, nasal, vaginal, pulmonary, gastric, intestinal, and rectal routes of administration. Formulations for vaginal or rectal administration (e.g., suppositories) can contain, for example, polyalkylene glycols, vaseline, cocoa butter, and the like, as excipients. Formulations for intranasal administration can be solid and contain, for example, lactose as an excipient, or can be aqueous or oily solutions of a dropper. For buccal administration, excipients include sugars, calcium stearate, magnesium stearate, pregelatinized starch, and the like (U.S. Patent No. 5,849,695). More detailed descriptions of mucosal administration and formulations are disclosed in PCT Publication No. WO 2019 / 049816.

[0296] For transdermal administration, the compositions or pharmaceutical compositions disclosed herein are encapsulated in a delivery device, such as a liposome or a polymeric nanoparticle, microparticle, microcapsule, or microsphere (collectively referred to as microparticles unless otherwise specified). Numerous suitable devices are known, including microparticles made from synthetic polymers, such as polyhydroxy acids, such as polylactic acid, polyglycolic acid, and copolymers thereof, polyorthoesters, polyanhydrides, and polyphosphazenes, as well as natural polymers, such as collagen, polyamino acids, albumin and other proteins, alginate and other polysaccharides, and combinations thereof (U.S. Patent No. 5,814,599). More detailed descriptions of transdermal administration, formulations, and suitable devices are disclosed in PCT Publication No. WO 2019 / 049816.

[0297] It can be desirable to deliver the disclosed compounds to a subject over an extended period of time (e.g., by a single administration lasting a period of one week to one year). Various slow release, depot, or implant dosage forms can be utilized. For example, the dosage form can contain a pharmaceutically innocuous, non-toxic salt of the compound having low solubility in body fluids, for example, (a) an acid addition salt with a polyprotic acid such as phosphoric, sulfuric, citric, tartaric, tannic, pamoic, alginic, polyglutamic, naphthalene monosulfonic or disulfonic acids, polygalacturic acid, etc.; (b) a salt with a polyvalent metal cation such as zinc, calcium, bismuth, barium, magnesium, aluminum, copper, cobalt, nickel, cadmium, etc., or with an organic cation formed, e.g., from N,N'-dibenzyl-ethylenediamine or ethylenediamine; or (c) a combination of (a) and (b), such as a zinc tannate salt. In addition, the disclosed compounds or preferably relatively insoluble salts, such as those just described, can be formulated in a gel suitable for injection, e.g., an aluminum monostearate gel with, e.g., sesame oil. Particularly preferred salts are zinc salts, zinc tannate salts, embonate salts, etc. Another type of slow release, depot formulation for injection will contain the compound or salt dispersed for encapsulation in a slowly degrading, non-toxic, non-antigenic polymer, e.g., a polylactic acid / polyglycolic acid polymer as described in U.S. Pat. No. 3,773,919. The compound or preferably relatively insoluble salts, such as those described above, can also be formulated in a cholesteryl matrix silicone rubber pellet, particularly for use in animals. Additional slow release, depot, or implant formulations, e.g., gaseous or liquid liposomes, are known in the literature (U.S. Pat. No. 5,770,222 and "Sustained and Controlled Release Drug Delivery Systems", J. R. Robinson, Ed., Marcel Dekker, Inc., N.Y., 1978).

[0298] Such dosage forms are well known in the art. See, e.g., Wells et al., eds., Pharmacotherapy Handbook, 2ndEdition, Appleton and Lange, Stamford, Conn. (2000); PDR Pharmacopoeia, Tarascon Pocket Pharmacopoeia 2000, Deluxe Edition, Tarascon Publishing, Loma Linda, Calif. (2000); Nursing 2001 Handbook of Drugs, 21stEdition, Springhouse Corp., Springhouse, Pa., 2001; Health Professional's Drug Guide 2001, eds. Shannon, Wilson, Stang, Prentice-Hall, Inc, Upper Saddle River, N.J. Preferred dosages can optionally include about 0.1 to 99 mg / kg per administration and / or 100 to 500 mg / kg per administration, or any range, value or fraction thereof, or to achieve about 0.1 to 5000 pg / ml serum concentrations, or any range, value or fraction thereof, per single or multiple administration. Preferred dosage ranges for the compositions or pharmaceutical compositions disclosed herein are about 1 mg / kg of the subject's body weight, up to about 3 mg / kg of the subject's body weight, about 6 mg / kg of the subject's body weight, or about 12 mg / kg of the subject's body weight.

[0299] Alternatively, the dosage administered can vary depending upon known factors such as the pharmacodynamic characteristics of the particular agent and its mode and route of administration; the age, health, and weight of the recipient; the nature and extent of the symptoms; the kind of concurrent treatment, the frequency of treatment, and the effects desired. Usually, the dose of the active ingredient can be about 0.1 to 100 milligram per kilogram of body weight. Typically 0.1 to 50 and preferably 0.1 to 10 milligram / kilogram / administration or sustained release form is effective to obtain the desired results.

[0300] As non-limiting examples, treatment of a human or animal can be provided using a single, infusion, or repeated doses, as a one-time or periodic dose (about 0.1 to 100 mg / kg or any range, value or fraction thereof per day) of the compositions or pharmaceutical compositions disclosed herein on at least one day in days 1 to 40, or alternatively or additionally on at least one day in weeks 1 to 52, or alternatively or additionally on at least one year in years 1 to 20, or any combination thereof.

[0301] Dosage forms suitable for internal administration typically contain from about 0.001 milligram to about 500 milligrams of active ingredient per unit or container. In these pharmaceutical compositions, the active ingredient will ordinarily be present in an amount of from about 0.5% to about 99.999% by weight based on the total weight of the composition.

[0302] An effective amount can comprise an amount of from about 0.001 mg / kg to about 500 mg / kg per single (e.g., bolus), multiple or continuous administration, or to achieve a serum concentration of from 0.01 pg / ml to 5000 pg / ml serum concentration per single, multiple or continuous administration, or any effective range or value therein, as accomplished and determined using known methods, as described herein or known in the relevant art.

[0303] In aspects where the composition to be administered to a subject in need thereof is a modified cell as disclosed herein, the cells can be administered at about 1 x 105 3 cells; about 1 x 105 15 cells; about 1 x 105 4 cells; about 1 x 105 12 cells; about 1 x 105 5 cells; about 1 x 105 10 cells; about 1 x 105 6 cells; about 1 x 105 9 cells; about 1 x 105 6 cells; about 1 x 105 8 cells; about 1 x 105 6 cells; about 1 x 105 7 cells; or about 1 x 105 6 about 25 x 105 6 cells. In one aspect, the cells are administered at about 5 x 105 6 cells and 25 x 105 6 cells.

[0304] More detailed descriptions of the pharmaceutical excipients, formulations, dosages, and methods of administration of the disclosed compositions and pharmaceutical compositions are disclosed in PCT Publication No. WO 2019 / 049816.

[0305] Methods of using the compositions of the disclosure

[0306] The present disclosure provides uses of the disclosed compositions or pharmaceutical compositions for treating a disease or condition in a cell, tissue, organ, animal, or subject, as known in the art or as described herein, using the disclosed compositions and pharmaceutical compositions, e.g., administering or contacting a therapeutically effective amount of the composition or pharmaceutical composition to the cell, tissue, organ, animal, or subject. In one aspect, the subject is a mammal. Preferably, the subject is a human. The terms “subject” and “patient” are used interchangeably herein.

[0307] The present disclosure provides a method for modulating or treating at least one malignant disease or condition in a cell, tissue, organ, animal, or subject. Preferably, the malignant disease is cancer. Non-limiting examples of malignant diseases or conditions include leukemia, acute leukemia, acute lymphoblastic leukemia (ALL), acute lymphocytic leukemia, B-cell, T-cell, or FAB ALL, acute myeloid leukemia (AML), acute myelogenous leukemia, chronic myelocytic leukemia (CML), chronic lymphocytic leukemia (CLL), hairy cell leukemia, myelodysplastic syndrome (MDS), lymphoma, Hodgkin's disease, malignant lymphoma, non-Hodgkin's lymphoma, Burkitt's lymphoma, multiple myeloma, Kaposi's sarcoma, colorectal cancer, pancreatic cancer, nasopharyngeal carcinoma, malignant histiocytosis, paraneoplastic syndrome / hypercalcemia of malignancy, solid tumor, bladder cancer, breast cancer, colorectal cancer, endometrial cancer, head cancer, neck cancer, hereditary nonpolyposis cancer, Hodgkin's lymphoma, liver cancer, lung cancer, non-small cell lung cancer, ovarian cancer, pancreatic cancer, prostate cancer, renal cell cancer, testicular cancer, adenocarcinoma, sarcoma, malignant melanoma, hemangioma, metastatic disease, cancer-related bone resorption, cancer-related bone pain, and the like.

[0308] The compositions of the present disclosure can be used to treat diseases or conditions including, but not limited to, osteopetrosis, Parkinson's disease, Hunter syndrome, sickle cell disease, severe combined immunodeficiency, alpha-mannosidosis, sideroblastic anemia, autosomal recessive hyper-IgE syndrome, primary myelofibrosis, cutaneous vasculitis, X-linked protoporphyria, fucosidosis, Lambert-Eaton syndrome, WAS-related conditions, chronic granulomatous disease, thalassemia major, hereditary angioedema, hereditary lymphedema, hyper-IgM syndrome, Friedreich's ataxia, Charcot-Marie-Tooth disease, phenylketonuria, methylmalonic acidemia, adrenoleukodystrophy, Kugelberg-Welander syndrome, retinitis pigmentosa, hydrocephalus, hereditary sensory and autonomic neuropathy type IV, mucopolysaccharidosis type III, corneal dystrophy, erythropoietic protoporphyria, Fabry disease, Werdnig-Hoffman disease, hypophosphatasia, Coats' disease, Fanconi anemia, Niemann-Pick disease, Crigler-Najjar syndrome, hemophilia A, hemophilia B, leukodystrophy, Sandhoff disease, Usher syndrome, Wolman disease, Dupuytren's contracture, Wolfram syndrome, X-linked myotubular myopathy, Canavan disease, Ehlers-Danlos syndrome, epidermolysis bullosa, osteogenesis imperfecta, short bowel syndrome, giant axonal neuropathy, paroxysmal nocturnal hemoglobinuria, Feer-Hagemidt syndrome, retinoschisis, beta-thalassemia, hypophosphatasia, propionic acidemia, cholesterosis, cystinosis, glycogen storage disease type II Pompe disease, mucopolysaccharidosis (MPS I H-SHurler-Scheie), mucopolysaccharidosis (type II (Hunter syndrome)), and mucopolysaccharidosis (type IV (Morquio)).

[0309] The compositions of the present disclosure can be used to treat a disease or condition by using a therapeutic transgene encoding an exogenous nucleic acid sequence or an exogenous amino acid sequence. For certain diseases or conditions, the therapeutic transgene can include [Disease (therapeutic transgene): beta-thalassemia (HBB T87Q, BCL11A shRNA, IGF2BP1), sickle cell disease (HBB T87Q, BCL11A shRNA, IGF2BP1), hemophilia A (Factor VIII), hemophilia B (Factor IX), X-linked severe combined immunodeficiency (Interleukin 2 Receptor Gamma (IL2RG)), hypophosphatasia (Tissue Non-Specific Alkaline Phosphatase (TNAP)), osteopetrosis (TCIRG1), Pompe disease (Glycogen Accumulation Type II) (alpha-glucosidase (GAA)), Fabry disease (alpha-galactosidase A deficiency) (alpha-galactosidase A (GLA)), Mucopolysaccharidosis Type I (MPS I) (alpha-L-iduronosidase) (IDUA)), Mucopolysaccharidosis Type II (MPS II) (iduronate 2-sulfatase (IDS)), Mucopolysaccharidosis Type IIIA (MPS IIIA) (sulfamidoglycosuronidase (SGSH)), Mucopolysaccharidosis Type IIIB (MPS IIIB) (N-acetylglucosaminidase (NAGLU)), Mucopolysaccharidosis Type IVA (MPS IVA) (Morquio) (N-acetylgalactosamine-6-sulfate sulfatase (GALNS)), Mucopolysaccharidosis Type IVB (MPS IVB) beta-galactosidase (GLB1 (beta-galactosidase (GLB1)), Cholesterol Ester Storage Disease (CESD) (lysosomal acid lipase (LIPA)), cystinosis (cystine transporter lysosomal cystine transporter (CTNS)), X-linked chronic granulomatous disease (X-CGD) (CYBB), Wiskott-Aldrich Syndrome (WAS) (WAS), X-linked adrenoleukodystrophy (X-ALD) (ABCD1), Metachromatic Leukodystrophy (MLD) (ARSA), phenylketonuria (PAH), methylmalonic acidemia (MMUT), propionic acidemia (PCCA, PCCB), retinitis pigmentosa (RPE65), Usher Syndrome (MYO7A), and Gaucher disease (GBA)].

[0310] In preferred aspects, the treatment of a malignant disease or condition comprises adoptive cell therapy. For example, in one aspect, the disclosure provides a modified cell expressing at least one disclosed antibody (e.g., scFv) and / or a CAR comprising an antibody (e.g., scFv) that has been selected and / or expanded for administration to a subject in need thereof. The modified cell can be formulated for storage at any temperature, including room temperature and body temperature. The modified cell can be formulated for cryopreservation and subsequent thawing. The modified cell can be formulated in a pharmaceutical carrier for administration directly to a subject from a sterile package. The modified cell can be formulated in a pharmaceutical carrier with an indicator of cell viability and / or CAR expression level to ensure a minimum level of cell function and CAR expression. The modified cell can be formulated in a pharmaceutical carrier with one or more agents at a prescribed density to inhibit further expansion and / or prevent cell death.

[0311] Any of the methods can comprise administering an effective amount of any of the compositions or pharmaceutical compositions disclosed herein to a cell, tissue, organ, animal, or subject in need of such modulation, treatment, or therapy. Such methods can optionally comprise co-administration or combination therapy for the treatment of such disease or condition, wherein administration of any of the compositions or pharmaceutical compositions disclosed herein further comprises administration prior to, concurrently with, and / or after at least one chemotherapeutic agent (e.g., alkylating agent, mitotic inhibitor, radiopharmaceutical).

[0312] In some aspects, the subject does not develop graft versus host (GvH) and / or host versus graft (HvG) following administration. In one aspect, the administration is systemic. Systemic administration can be any means known in the art and described in detail herein. Preferably, the systemic administration is by intravenous injection or intravenous infusion. In one aspect, the administration is local. Local administration can be any means known in the art and described in detail herein. Preferably, the local administration is by intratumoral injection or infusion, intraspinal injection or infusion, intracerebroventricular injection or infusion, intraocular injection or infusion, or intraosseous injection or infusion.

[0313] In some aspects, the therapeutically effective dose is a single dose. In some aspects, the single dose is one of at least 2, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 doses or any number of doses therebetween manufactured at the same time. In some aspects, wherein the composition is autologous cells or allogeneic cells, the dose is an amount sufficient for the cells to engraft and / or persist for a sufficient time to treat the disease or condition.

[0314] In one embodiment, the present disclosure provides a method of treating a cancer in a subject in need thereof, the method comprising administering to the subject a composition comprising an antibody (e.g., scFv) or a CAR comprising an antibody (e.g., scFv) that specifically binds an antigen on a tumor cell. In aspects where the composition comprises a modified cell or population of cells, the cell or population of cells can be autologous or allogeneic.

[0315] In some aspects of the methods of treatment described herein, treatment can be modified or terminated. Specifically, in aspects where the composition used for treatment comprises an inducible pro-apoptotic polypeptide, apoptosis of the cells can be selectively induced by contacting the cells with an inducer. For example, treatment can be modified or terminated in response to signs of recovery or reduced severity / progression of disease, signs of disease regression / halt, and / or occurrence of adverse events. In some aspects, the methods comprise the step of administering an inhibitor of the inducer to inhibit the modified cell therapy, thereby restoring the functionality and / or effectiveness of the cell therapy (e.g., when signs or symptoms of disease reappear or increase in severity and / or adverse events resolve).

[0316] Definitions

[0317] As used throughout this disclosure, the singular forms "a," "and," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a method" includes a plurality of such methods, and reference to "a dose" includes reference to one or more doses and equivalents thereof known to those skilled in the art, and so forth.

[0318] The term "about" or "approximately" means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, e.g., the limitations of the measurement system. For example, "about" can mean within 1 or more than 1 standard deviation, per se. Alternatively, "about" can mean ranges within 20% or, more preferably, 10%, or more preferably, 5%, or more preferably, 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, preferably within 5-fold and more preferably within 2-fold, of a certain value. Where particular values described in the application and claims depend on measurements, unless otherwise stated, the term "about" should not be considered to take away from the claimed value.

[0319] The present disclosure provides isolated or substantially purified polynucleotide or protein compositions. An "isolated" or "purified" polynucleotide or protein, or biologically active portion thereof, is substantially or essentially free of components of the environment as can be found in nature. Thus, when produced by recombinant techniques, an isolated or purified polynucleotide or protein is substantially free of cellular material or culture medium, or when produced by chemical synthesis, is substantially free of chemical precursors or other chemicals. Optimally, an "isolated" polynucleotide is free of sequences (optimally protein encoding sequences) that naturally flank the polynucleotide in the genomic DNA of the organism from which the polynucleotide is derived (i.e., sequences located at the 5' and 3' ends of the polynucleotide). For example, in various aspects, an isolated polynucleotide can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb of nucleotide sequence that naturally flank the polynucleotide in genomic DNA of the cell from which the polynucleotide is derived. Proteins that are substantially free of cellular material include preparations of protein having less than about 30%, 20%, 10%, 5%, or 1% (by dry weight) of contaminating protein. When a protein of the disclosure, or biologically active portion thereof, is produced recombinantly, optimally, the culture medium represents less than about 30%, 20%, 10%, 5%, or 1% (by dry weight) of chemical precursors or chemical species other than the protein of interest.

[0320] The present disclosure provides fragments and variants of the disclosed DNA sequences and proteins encoded by these DNA sequences. As used throughout the present disclosure, the term "fragment" refers to a portion of a DNA sequence or a portion of an amino acid sequence, and thus to a portion of a protein encoded thereby. A fragment of a DNA sequence comprising a coding sequence can encode a protein fragment that retains the biological activity of the native protein, and thus retains DNA recognition or binding activity for a target DNA sequence as described herein. Alternatively, a fragment of a DNA sequence useful as a hybridization probe generally does not encode a protein that retains biological activity or does not retain promoter activity. Thus, a fragment of a DNA sequence can range from at least about 20 nucleotides, about 50 nucleotides, about 100 nucleotides, and up to the full length polynucleotide of the present disclosure.

[0321] Nucleic acids or proteins of the present disclosure can be constructed by a modular approach that includes pre-assembly of monomeric units and / or repeat units in a target vector, which can then be assembled into the final target vector. Polypeptides of the present disclosure can comprise repeat monomers of the present disclosure, and can be constructed by a modular approach by pre-assembly of repeat units in a target vector, which can then be assembled into the final target vector. The present disclosure provides polypeptides produced by this approach, as well as nucleic acid sequences encoding these polypeptides. The present disclosure provides host organisms and cells comprising nucleic acid sequences encoding polypeptides produced by this modular approach.

[0322] The term "binding" refers to a sequence-specific noncovalent interaction between macromolecules (e.g., between a protein and a nucleic acid). Not all components of a binding interaction need be sequence-specific (e.g., contact with a phosphate residue in the DNA backbone), so long as the overall interaction is sequence-specific.

[0323] The term "comprising" is intended to mean that the compositions and methods include the recited elements, but not excluding others. "Consisting essentially of" when used to define compositions and methods, shall mean excluding other elements of any essential significance to the composition and method. Thus, a composition consisting essentially of the elements as defined herein, does not exclude trace contaminants or inert carriers. "Consisting of" shall mean excluding more than trace elements of other ingredients. Each of these transitions terms is meant in its broadest context unless otherwise specified.

[0324] The term "epitope" refers to an antigenic determinant on a polypeptide. The epitope can comprise three amino acids in a spatial conformation that is unique to the epitope. Typically, an epitope consists of at least 4, 5, 6, or 7 such amino acids, and more typically, at least 8, 9, or 10 such amino acids. Methods of determining the spatial conformation of amino acids are known in the art and include, for example, X-ray crystallography and two-dimensional nuclear magnetic resonance.

[0325] As used herein, "expression" refers to the process by which a polynucleotide is transcribed into mRNA and / or the process by which the transcribed mRNA is subsequently translated into a peptide, polypeptide, or protein. If the polynucleotide is derived from genomic DNA, expression can include splicing of the mRNA in a eukaryotic cell.

[0326] "Gene expression" refers to the conversion of the information contained in a gene into a gene product. A gene product can be the direct transcriptional product of a gene (e.g., mRNA, tRNA, rRNA, antisense RNA, ribozyme, shRNA, microRNA, structural RNA, or any other type of RNA) or a protein produced by translation of mRNA. Gene products also include RNA as modified by processes such as capping, polyadenylation, methylation, and editing, and proteins modified by processes, for example, methylation, acetylation, phosphorylation, ubiquitination, ADP- ribosylation, myristoylation, and glycosylation.

[0327] "Modulation" or "modulation" of gene expression refers to a change in the gene's activity. Modulation of expression can include, but is not limited to, gene activation and gene repression.

[0328] "Operably linked" or its equivalent (e.g., "operably linked") means that two or more molecules are positioned relative to one another such that they are able to interact to affect the function of one or both molecules or a combination thereof.

[0329] Disclosed are non-covalently linked components and methods of making and using non-covalently linked components. Various components can take various different forms as described herein. For example, non-covalently linked (i.e., operably linked) proteins can be used to achieve transient interactions to avoid one or more problems in the art. The ability of non-covalently linked components, such as proteins, to associate and dissociate allows for functional association only or primarily where such association is needed to achieve a desired activity. This bonding can be sustained for a sufficient period of time to achieve a desired effect.

[0330] Disclosed is a method of directing a protein to a specific locus in a genome of an organism. The method can include the steps of providing a DNA localization component and providing an effector molecule, wherein the DNA localization component and the effector molecule are capable of being operably linked via a non-covalent bond.

[0331] A "target site" or "target sequence" is a nucleic acid sequence defining a portion of a nucleic acid to which a binding molecule will bind, provided that sufficient binding conditions are present.

[0332] The term "nucleic acid" or "oligonucleotide" or "polynucleotide" refers to at least two nucleotides covalently linked together. Depiction of a single strand also defines the sequence of the complementary strand. Thus, a nucleic acid can also encompass the complementary strand of a depicted single strand. Nucleic acids of the present disclosure also encompass substantially identical nucleic acids that retain the same structure or encode the same protein and their complements.

[0333] A probe of the present disclosure can comprise a single-stranded nucleic acid capable of hybridizing to a target sequence under stringent hybridization conditions. Thus, a nucleic acid of the present disclosure can refer to a probe that hybridizes under stringent hybridization conditions.

[0334] A nucleic acid of the present disclosure can be single-stranded or double-stranded. A nucleic acid of the present disclosure can contain double-stranded sequences even if the majority of the molecule is single-stranded. A nucleic acid of the present disclosure can contain single-stranded sequences even if the majority of the molecule is double-stranded. A nucleic acid of the present disclosure can include genomic DNA, cDNA, RNA, or hybrids thereof. A nucleic acid of the present disclosure can contain a combination of deoxyribonucleotides and ribonucleotides. A nucleic acid of the present disclosure can contain a combination of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine, hypoxanthine, isocytosine, and isoguanine. A nucleic acid of the present disclosure can be synthesized to contain non-natural amino acid modifications. A nucleic acid of the present disclosure can be obtained by chemical synthesis methods or by recombinant methods.

[0335] The nucleic acids of the disclosure, whether the entire sequence thereof or any portion thereof, can be non-naturally occurring. The nucleic acids of the disclosure can contain one or more non-naturally occurring mutations, substitutions, deletions, or insertions, such that the entire nucleic acid sequence is non-naturally occurring. The nucleic acids of the disclosure can contain one or more repeated, inverted, or repeated sequences, the resulting sequence of which is not naturally occurring, such that the entire nucleic acid sequence is non-naturally occurring. The nucleic acids of the disclosure can contain non-naturally occurring modified, artificial, or synthetic nucleotides, such that the entire nucleic acid sequence is non-naturally occurring.

[0336] Due to the redundancy of the genetic code, multiple nucleotide sequences can encode any particular protein. All such nucleotide sequences are contemplated herein.

[0337] As used throughout this disclosure, the term "operably linked" means that the expression of a gene is under the control of a promoter spatially connected thereto. The promoter can be positioned 5' (upstream) or 3' (downstream) of the gene under its control. The distance between the promoter and the gene can be approximately the same as the distance between that promoter and the gene from which it was derived (the gene that the promoter controls). Variations in the distance between the promoter and the gene can be accommodated without loss of promoter function.

[0338] As used throughout this disclosure, the term "promoter" means a synthetic or naturally-occurring molecule capable of conferring, activating, or enhancing the expression of a nucleic acid in a cell. The promoter can comprise one or more specific transcriptional regulatory sequences to further enhance expression and / or alter its spatial expression and / or temporal expression. The promoter can also comprise a distal enhancer or suppressor element, which can be located thousands of base pairs from the transcriptional start site. The promoter can be derived from sources including viruses, bacteria, fungi, plants, insects, and animals. The promoter can constitutively or differentially regulate expression of the genomic component in terms of the cell, tissue, or organ in which expression occurs, or in terms of the developmental stage at which expression occurs, or in response to external stimuli such as physiological stress, pathogens, metal ions, or inducers. Representative examples of promoters include the bacteriophage T7 promoter, the bacteriophage T3 promoter, the SP6 promoter, the lac operator promoter, the tac promoter, the SV40 late promoter, the SV40 early promoter, the RSV-LTR promoter, the CMV IE promoter, the EF-1 alpha promoter, the CAG promoter, the SV40 early promoter, or the SV40 late promoter, and the CMV IE promoter.

[0339] As used throughout this disclosure, the term "substantially complementary" means that a first sequence is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identical to the complement of a second sequence over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 180, 270, 360, 450, 540, or more nucleotides or amino acids, or that the two sequences hybridize under stringent hybridization conditions.

[0340] As used throughout this disclosure, the term "substantially identical" means that a first sequence and a second sequence are at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identical over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 180, 270, 360, 450, 540, or more nucleotides or amino acids (or in the case of nucleic acids) if the first sequence is substantially complementary to the complement of the second sequence.

[0341] As used throughout this disclosure, the term "variant" when used to describe a nucleic acid means (i) a portion or fragment of a reference nucleotide sequence; (ii) a complement of a reference nucleotide sequence or portion thereof; (iii) a nucleic acid that is substantially identical to a reference nucleic acid or complement thereof; or (iv) a nucleic acid that hybridizes under stringent conditions to a reference nucleic acid, complement thereof, or to a sequence substantially identical thereto.

[0342] As used throughout this disclosure, the term "vector" means a nucleic acid sequence that contains an origin of replication. The vector can be a viral vector, a bacteriophage, a bacterial artificial chromosome, or a yeast artificial chromosome. The vector can be a DNA or RNA vector. The vector can be a self-replicating extrachromosomal vector, and is preferably a DNA plasmid. The vector can comprise a combination of amino acids with DNA sequences, RNA sequences, or both DNA and RNA sequences.

[0343] As used throughout this disclosure, the term "variant" when used to describe a peptide or polypeptide means a peptide or polypeptide that differs in amino acid sequence by virtue of an insertion, deletion, or conservative substitution of amino acids, but which retains at least one biological activity. Variant can also mean a protein having an amino acid sequence substantially identical to a reference protein, wherein the amino acid sequence of the reference protein retains at least one biological activity.

[0344] Conservative substitutions of amino acids, i.e., substitutions that do not generate significantly different properties for the molecule, are recognized in the art as typically involving minor changes. These minor changes can be identified, in part, based on the hydropathic index of amino acids, as understood in the art. Kyte et al., J. Mol. Biol. 157: 105-132 (1982). The hydropathic index of an amino acid is based on the hydrophobicity and charge of the amino acid. Amino acids of similar hydropathic index can be substituted and still retain the biological function of the protein. In one aspect, amino acids having hydropathic indices of ±2 are substituted. The hydrophilicity of amino acids can also be used to reveal substitutions that will result in proteins retaining biological function. A peptide's maximal local average hydrophilicity has been reported to correlate well with antigenicity and immunogenicity, as understood in the art. U.S. Patent No. 4,554,101, which is incorporated herein by reference in its entirety.

[0345] Substitution of amino acids with similar hydrophilicity values can result in peptides retaining biological activity, for example, immunogenicity. Substitutions can be made with amino acids having hydropathic values within ±2 of each other. Both the hydrophobic index and the hydrophilicity value of an amino acid are influenced by the particular side chain of the amino acid. Consistent with this observation, amino acid substitutions that are compatible with biological function are understood to depend on the relative similarity of the amino acids, and in particular the side chains of those amino acids, as revealed by, among others, hydrophobicity, hydrophilicity, charge, size, and other properties.

[0346] As used herein, a "conservative" amino acid substitution can be defined as shown in Table A, B, or C below. In some aspects, the fusion polypeptides and / or nucleic acids encoding such fusion polypeptides include conservative substitutions that have been introduced by modifying the polynucleotide encoding the polypeptides of the disclosure. Amino acids can be categorized according to physical properties and contributions to secondary and tertiary protein structure. A conservative substitution is the replacement of one amino acid with another having similar properties. Exemplary conservative substitutions are listed in Table A.

[0347] Table A - Conservative Substitutions I

[0348]

[0349] Alternatively, conservative amino acids can be as described by Lehninger (Biochemistry, Second Edition; Worth Publishers, Inc. NY, N.Y. (1975), pp. 71-77), as shown in Table B.

[0350] Table B - Conservative Substitutions II

[0351]

[0352] Alternatively, exemplary conservative substitutions are listed in Table C.

[0353] Table C - Conservative Substitutions III

[0354]

[0355]

[0356] It is understood that the polypeptides of the present disclosure are intended to include polypeptides that carry an insertion, deletion, or substitution of one or more amino acid residues, or any combination thereof, as well as modifications other than an insertion, deletion, or substitution of an amino acid residue. The polypeptides or nucleic acids of the present disclosure can contain one or more conservative substitutions.

[0357] As used throughout the present disclosure, the term "more than one" of the above amino acid substitutions means 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more of the amino acid substitutions. The term "more than one" can mean 2, 3, 4, or 5 of the amino acid substitutions.

[0358] The polypeptides and proteins of the present disclosure, whether it is the entire sequence or any portion thereof, can be non-naturally occurring. The polypeptides and proteins of the present disclosure can contain one or more non-naturally occurring mutations, substitutions, deletions, or insertions such that the entire amino acid sequence is non-naturally occurring. The polypeptides and proteins of the present disclosure can contain one or more repeated, inverted, or repeated sequences such that the resulting sequence is not naturally occurring, such that the entire amino acid sequence is non-naturally occurring. The polypeptides and proteins of the present disclosure can contain non-naturally occurring modified, artificial, or synthetic amino acids such that the entire amino acid sequence is non-naturally occurring.

[0359] As used throughout this disclosure, "sequence identity" can be determined by using the standalone executable BLAST engine program (bl2seq) for blast of two sequences using default parameters, which is available from the National Center for Biotechnology Information (NCBI) ftp site (Tatusova and Madden, FEMS Microbiol Lett., 1999, 174, 247-250; incorporated by reference herein in its entirety). When the terms "identical" or "identity" are used in the context of two or more nucleic acids or polypeptide sequences, it is recognized that the sequences are not necessarily identical for the entire length of the reference sequences. Instead, the designated percentage of sequence identity refers to the percentage of a specified region of the reference sequence that has identity with the test sequence. The percentage of sequence identity is calculated by comparing two sequences over the specified region that can have up to addition of 1% of total positions, wherein the portion that does not add to the total number of positions is disregarded from the comparison. Optimal alignment of sequences for comparison can be conducted using any algorithm or program known in the art, including but not limited to the alignment algorithm XBLAST (version 2.0) or BLAST 2.0, using default parameters. Where sequences differ, the test sequence can contain substitutions, additions, or deletions relative to the reference sequence. When comparing DNA and RNA, thymine (T) and uracil (U) can be considered equivalent. Sequence identity can be determined manually or using a computer sequence algorithm, such as BLAST or BLAST 2.0.

[0360] As used throughout this disclosure, the term "endogenous" refers to a nucleic acid or protein sequence that is naturally associated with a target gene or host cell into which the target gene is introduced.

[0361] As used throughout this disclosure, the term "exogenous" refers to a nucleic acid or protein sequence that is not naturally associated with a target gene or host cell into which the target gene is introduced, including non-naturally occurring multiple copies of a naturally occurring nucleic acid, e.g., a DNA sequence, or a naturally occurring nucleic acid sequence located at a non-naturally occurring genomic location.

[0362] The present disclosure provides methods of introducing a polynucleotide construct comprising a DNA sequence into a host cell. By "introducing" is intended to present the polynucleotide construct to the cell in a manner that the construct is able to enter the interior of a host cell. The methods of the present disclosure do not depend on the particular method used to introduce the polynucleotide construct into the host cell, so long as the polynucleotide construct is able to enter the interior of one of the cells of the host. Methods for introducing polynucleotide constructs into bacteria, plants, fungi, and animals are known in the art, including but not limited to stable transformation methods, transient transformation methods, and virus-mediated methods.

[0363] As used herein, the term“about” or“approximately” means a quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length that varies by no more than 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or 1% to a reference quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length. In one embodiment, the term“about” or“approximately” means a range of quantities, levels, values, numbers, frequencies, percentages, dimensions, sizes, amounts, weights or lengths that are ±15%, ±10%, ±9%, ±8%, ±7%, ±6%, ±5%, ±4%, ±3%, ±2% or ±1% of a reference quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length.

[0364] As used herein, the term“substantially” or“essentially” means a quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length that is about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or more of a reference quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length. In one embodiment, the term“substantially the same” or“essentially the same” means that a range of quantities, levels, values, numbers, frequencies, percentages, dimensions, sizes, amounts, weights or lengths is approximately the same as a reference quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length.

[0365] As used herein, the terms“substantially free” and“essentially free” are used interchangeably and, when used in reference to a composition such as a cell population or a culture medium, mean a composition that is free of a specified material or source thereof, such as 95% free, 96% free, 97% free, 98% free, 99% free of the specified material or source thereof, or is not detectable by routine methods of measurement. The terms“free of” or“essentially free of” a certain ingredient or material in a composition also mean that such ingredient or material is not included in the composition (1) at any concentration, or (2) at a concentration that is functionally inert but low. Similar meanings can apply to the term“absence” in reference to the absence of a particular material or source thereof in a composition.

[0366] Throughout this specification, unless the context requires otherwise, the words“comprise,”“comprises” and“comprising” will be understood to imply the inclusion of a stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements. In particular embodiments, the terms“comprises,”“has,”“contains” and“including” are synonymous with each other.

[0367] “consisting of’ means including, and limited to, whatever follows the phrase “consisting of.” Thus, the phrase “consisting of’ indicates that the listed elements are essential, or required, and that no other elements can be present. In some embodiments, the term “consisting of’ means including, and limited to, whatever follows the phrase “consisting of’ and does not allow for the presence of other elements.

[0368] “consisting essentially of’ means including, and limited to, any elements of the phrase “consisting essentially of’ and excludes other elements of any kind. Thus, the phrase “consisting essentially of’ indicates that the listed elements are essential, or required, but that other elements are optional and can or can not be present depending upon whether or not they affect the activity or action of the listed elements.

[0369] References to “one embodiment,” “an embodiment,” “certain embodiments,” “some embodiments,” “other embodiments,” or “further embodiments” or combinations thereof, throughout the specification, or like documents based on this specification, mean that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment of the application. Thus, appearances of the above phrases or combinations thereof in various places throughout the specification are not necessarily all referring to the same embodiment. Furthermore, particular features, structures, or characteristics can be combined in any suitable manner in one or more embodiments.

[0370] The term “ex vivo” generally refers to activities that occur outside of a living organism, such as experiments or measurements performed in or on living tissue in an artificial environment outside of a living organism, preferably with minimal changes to natural conditions. In particular embodiments, “ex vivo” procedures involve living cells or tissue that are taken from a living organism and cultured in a laboratory setting, typically under sterile conditions, and typically for a few hours or up to about 24 hours, but including up to 48 or 72 hours or more, depending on the circumstances. In certain embodiments, such tissue or cells can be collected and frozen, and then thawed for ex vivo processing. Tissue culture experiments or procedures that use living cells or tissue that last longer than a few days are generally considered to be “in vitro,” although in certain embodiments the term can be used interchangeably with ex vivo.

[0371] The term “in vivo” generally refers to activities that occur within a living organism.

[0372] As used herein, the term “reprogramming” or “de-differentiation” or “increasing cell potency” or “increasing developmental potency” refers to a method of increasing cell potency or de-differentiating a cell to a less differentiated state. For example, a cell with increased cell potency has more developmental plasticity (i.e., can differentiate into more cell types) than the same cell in a non-reprogrammed state. In other words, a reprogrammed cell is a cell in a less differentiated state than the same cell in a non-reprogrammed state.

[0373] As used herein, the term "induced pluripotent stem cell" or iPSC means a stem cell produced from a differentiated adult, neonatal, or fetal cell that has been induced or altered, i.e., reprogrammed, to be a cell capable of differentiating into tissues of all three germ layers or dermal layers: mesoderm, endoderm, and ectoderm. The resulting iPSC is not a cell found in nature.

[0374] As used herein, the term "subject" refers to any animal, preferably a human patient, livestock, or other domesticated animal.

[0375] A "pluripotency factor" or "reprogramming factor" refers to an agent that is capable of increasing the developmental capacity of a cell, alone or in combination with other agents. Pluripotency factors include, but are not limited to, polynucleotides, polypeptides, and small molecules that are capable of increasing the developmental capacity of a cell. Exemplary pluripotency factors include, for example, transcription factors and small molecule reprogramming agents.

[0376] "Culturing" or "cell culturing" refers to the maintenance, growth, and / or differentiation of cells in an in vitro environment. "Cell culture medium," "medium" (singular "medium" in each case), "supplement," and "medium supplement" refer to a nutritional composition that cultures a cell culture.

[0377] "Culturing" or "maintaining" refers to the sustaining, propagating (growing), and / or differentiating of cells outside of a tissue or body, e.g., in a sterile plastic (or coated plastic) cell culture dish or flask. "Culturing" or "maintaining" can utilize a medium as a source of nutrients, hormones, and / or other factors that aid in the propagation and / or maintenance of cells.

[0378] The terms "hematopoietic stem and progenitor cells," "hematopoietic stem cells," "hematopoietic progenitor cells," or "hematopoietic precursor cells" refer to cells committed to the hematopoietic lineage but capable of further hematopoietic differentiation and include multipotent hematopoietic stem cells (hemocytoblasts), myeloid progenitor cells, megakaryocyte progenitor cells, erythroid progenitor cells, and lymphoid progenitor cells. Hematopoietic stem and progenitor cells (HSCs) are multipotent stem cells that give rise to all blood cell types, including myeloid (monocytes and macrophages, neutrophils, basophils, eosinophils, erythrocytes, megakaryocytes / platelets, dendritic cells) and lymphoid lineages (T cells, B cells, NK cells). As used herein, the term "definitive hematopoietic stem cells" refers to CD34+ hematopoietic cells that are capable of producing both mature myeloid cells and lymphocytes of both types, including T cells, NK cells, and B cells. Hematopoietic cells also include various primitive hematopoietic cell subsets that give rise to primitive red blood cells, macrocytes, and macrophages.

[0379] As used herein, the terms "T lymphocyte" and "T cell" are used interchangeably and refer to a major type of white blood cell that matures in the thymus and has various roles in the immune system, including the identification of particular foreign antigens in the body and the activation and inactivation of other immune cells. T cells can be any T cell, such as a cultured T cell, e.g., a primary T cell, or a T cell from a cultured T cell line, e.g., Jurkat, SupTl, etc., or a T cell obtained from a mammal. T cells can be CD3+ cells. T cells can be any type of T cell and can be at any stage of development, including but not limited to CD4+ / CD8+ double positive T cells, CD4+ helper T cells (e.g., Thl and Th2 cells), CD8+ T cells (e.g., cytotoxic T cells), peripheral blood mononuclear cells (PBMCs), peripheral blood leukocytes (PBLs), tumor infiltrating lymphocytes (TILs), memory T cells, naive T cells, regulatory T cells, gamma delta T cells (gd T cells), etc. Other types of helper T cells include cells such as Th3 (Treg), Thl 7, Th9, or Tfh cells. Other types of memory T cells include cells of central memory T cells (Tcm cells), effector memory T cells (Tem cells and TEMRA cells). T cells can also refer to genetically engineered T cells, such as T cells modified to express a T cell receptor (TCR) or a chimeric antigen receptor (CAR). T cells can also be differentiated from stem cells or progenitor cells.

[0380] As used herein, the term "NK cell" or "natural killer cell" refers to a subset of peripheral blood lymphocytes defined by expression of CD56 or CD 16 and lack of T cell receptor (CD3). As used herein, the terms "adaptive NK cell" and "memory NK cell" are interchangeable and refer to a subset of NK cells that are phenotypically CD3- and CD56+, express NKG2C and CD57, and optionally express CD 16, but lack expression of one or more of the following: PLZF, SYK, FceRy, and EAT-2. In some embodiments, the isolated subset of CD56+ NK cells includes expression of CD 16, NKG2C, CD57, NKG2D, NCR ligand, NKp30, NKp40, NKp46, activating and inhibitory KIRs, NKG2A, and DNAM-1. Expression of CD56+ can be weak or strong.

[0381] As used herein, the term "NKT cell" or "natural killer T cell" refers to a CD1d-restricted T cell that expresses a T cell receptor (TCR). Unlike conventional T cells, which detect peptide antigens presented by conventional major histocompatibility (MHC) molecules, NKT cells recognize lipid antigens presented by the nonclassical MHC molecule CD1d. Two types of NKT cells are currently recognized. Invariant or Type I NKT cells express a very limited TCR repertoire - a canonical alpha chain (Va24-Ja18 in humans) associated with a limited repertoire of beta chains (Vb11 in humans). A second population of NKT cells, termed nonclassical or non-invariant Type II NKT cells, show more heterogeneous TCRaP usage. Type I NKT cells are currently considered suitable for immunotherapy. Adaptive or invariant (Type I) NKT cells can be identified by expressing at least one or more of the following markers: TCR Va24-Ja18, Vb11, CD1d, CD3, CD4, CD8, aGalCer, CD161, and CD56.

[0382] As used herein, the term "isolated" and the like refer to a cell or population of cells that has been separated from its original environment, i.e., the environment of an "unisolated" reference cell is substantially free of at least one component found in the environment in which the reference cell exists. The term includes cells removed from some or all components when the cell is found in its natural environment (e.g., tissue, biopsy). The term also includes cells removed from at least one, some, or all components when the cell is found in an environment that does not occur in nature (e.g., culture, cell suspension). Thus, an isolated cell is partially or completely separated from at least one component, including other substances, cells, or populations of cells, when the cell is found in nature or is grown, stored, or otherwise present in an environment that does not occur in nature. Particular examples of isolated cells include partially purified cells, substantially purified cells, and cells cultured in a non-naturally occurring medium. An isolated cell can be obtained by separating the desired cell or population thereof from other substances or cells in the environment, or removing one or more other cell populations or subpopulations from the environment. As used herein, the term "purified" and the like refer to an increase in purity. For example, the purity can be increased to at least 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100%.

[0383] As used herein, the term "encode" refers to the inherent property of a specific sequence of nucleotides in a polynucleotide, such as a gene, cDNA, or mRNA, to act as a template for the synthesis of other polymers and macromolecules having defined sequences of nucleotides (i.e., rRNA, tRNA, and mRNA) or defined sequences of amino acids, and the biological properties resulting therefrom. Thus, if the transcription and translation of mRNA corresponding to a gene produces a protein, the gene is said to encode the protein. Both the coding strand, whose sequence is identical to that of the mRNA, and the non-coding strand, whose sequence is the complementary (i.e., "reverse complementary") to that of the mRNA, can be referred to as encoding the protein or other product of the gene or cDNA, whose transcription is being described.

[0384] A "construct" refers to a macromolecule or molecular complex comprising a polynucleotide to be delivered to a host cell in vitro or in vivo. As used herein, a "vector" refers to any nucleic acid construct capable of delivering or transferring foreign genetic material to a target cell, which can replicate and / or be expressed in the target cell. As used herein, the term "vector" includes a construct to be delivered. A vector can be linear or circular molecule. A vector can be integrative or non-integrative. Major types of vectors include, but are not limited to, plasmids, episomes, viral vectors, cosmids, and artificial chromosomes. Viral vectors include, but are not limited to, adenoviral vectors, adeno-associated viral vectors, retroviral vectors, lentiviral vectors, Sendai virus vectors, and the like.

[0385] "Integration" means the stable insertion of one or more nucleotides of a construct into the genome of a cell, i.e., covalent linkage to nucleic acid sequences within the chromosomal DNA of the cell. "Targeted integration" means the insertion of nucleotides of a construct into a preselected site or "integration site" within the chromosomal or mitochondrial DNA of a cell. As used herein, the term "integration" further refers to the process involving the insertion of one or more exogenous sequences or nucleotides of a construct, with or without the deletion of endogenous sequences or nucleotides at the integration site. In cases where a deletion is present at the site of insertion, "integration" can further include the replacement of the endogenous sequence or deleted nucleotides with the one or more inserted nucleotides.

[0386] As used herein, the term "exogenous" means the introduction of a reference molecule or reference activity into a host cell. For example, a molecule can be introduced by introducing an encoding nucleic acid into the host genetic material, such as by integration into a host chromosome or as non-chromosomal genetic material such as a plasmid. Thus, when the term is used to refer to the expression of an encoding nucleic acid, it refers to the introduction of the encoding nucleic acid in expressible form into the cell. The term "endogenous" refers to a reference molecule or activity present in a host cell. Similarly, when the term is used to refer to the expression of an encoding nucleic acid, it refers to the expression of the encoding nucleic acid contained within the cell and not introduced exogenously.

[0387] As used herein, a "gene of interest" or "polynucleotide of interest" is a DNA sequence that, when placed under the control of appropriate regulatory sequences, is capable of being transcribed into RNA and, in some cases, translated into a polypeptide in vivo. Genes of interest or polynucleotides can include, but are not limited to, prokaryotic sequences, cDNA from eukaryotic mRNA, genomic DNA sequences from eukaryotic (e.g., mammalian) DNA, and synthetic DNA sequences. For example, a gene of interest can encode a miRNA, shRNA, a natural polypeptide (i.e., a polypeptide found in nature) or fragment thereof; a variant polypeptide (i.e., a mutant of a natural polypeptide having less than 100% sequence identity to the natural polypeptide) or fragment thereof; an engineered polypeptide or peptide fragment, a therapeutic peptide or polypeptide, an imaging marker, a selectable marker, etc.

[0388] As used herein, the term "polynucleotide" refers to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or their analogs. Polynucleotide sequences are composed of four nucleotide bases: adenine (A); cytosine (C); guanine (G); thymine (T); and uracil (U) in place of thymine (T) when the polynucleotide is RNA. Polynucleotides can include a gene or gene fragment (for example, a probe, primer, EST or SAGE tag), exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. Polynucleotide also refers to both double- and single-stranded molecules.

[0389] As used herein, the terms "peptide," "polypeptide," and "protein" can be used interchangeably and refer to molecules having amino acid residues covalently linked by peptide bonds. A polypeptide must contain at least two amino acids, and there is no maximum number of amino acids to a polypeptide. As used herein, the term refers to both short chains, e.g., those commonly referred to in the art as peptides, oligopeptides, and oligomers, and to longer chains, commonly referred to in the art as polypeptides or proteins. "Polypeptide" includes, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, and the like. Polypeptides include natural polypeptides, recombinant polypeptides, synthetic polypeptides, or combinations thereof.

[0390] "Operably linked" refers to the association of multiple nucleic acid sequences on a single nucleic acid fragment such that one sequence's function is affected by another. For example, a promoter is operably linked to a coding sequence or functional RNA when the promoter is capable of influencing the expression of the coding sequence or functional RNA (i.e., the coding sequence or functional RNA is under the transcriptional control of the promoter). Coding sequences can be operably linked to regulatory sequences in either the sense or antisense orientation.

[0391] As used herein, the term“enhanced therapeutic properties” refers to enhanced therapeutic properties of a cell as compared to a typical immune cell of the same general cell type. For example, an NK cell having“enhanced therapeutic properties” will have enhanced, improved, and / or increased therapeutic properties as compared to a typical, unmodified, and / or naturally occurring NK cell. Therapeutic properties of an immune cell can include, but are not limited to, cell engraftment, trafficking, homing, viability, self-renewal, persistence, immune response modulation and regulation, survival, and cytotoxicity. Therapeutic properties of an immune cell are also manifested in antigen targeting receptor expression; HLA presentation or lack thereof; resistance to tumor microenvironment; induction of bystander immune cells and immunomodulation; improved on-target specificity and reduced off-tumor effects; resistance to treatments such as chemotherapy.

[0392] As used herein, the term“engager” refers to a molecule, such as a fusion polypeptide, capable of forming a link between an immune cell (e.g., T cell, NK cell, NKT cell, B cell, macrophage, neutrophil) and a tumor cell; and activating the immune cell. Examples of engagers include, but are not limited to, bispecific T cell engagers (BiTEs), bispecific killer cell engagers (BiKEs), trispecific killer cell engagers, or multispecific killer cell engagers, or universal engagers compatible with multiple immune cell types.

[0393] As used herein, the term“safety switch protein” refers to an engineered protein designed to prevent potential toxicity or other adverse effects of a cell therapy. In some cases, safety switch protein expression is conditionally controlled to address safety concerns of engrafted cells that have permanently incorporated a gene encoding a safety switch protein into their genome. This conditional regulation can be variable and can include control by small molecule-mediated post-translational activation and tissue-specific and / or temporal transcriptional regulation. The safety switch can mediate induction of apoptosis, inhibition of protein synthesis, DNA replication, growth arrest, transcriptional and post-transcriptional genetic regulation, and / or antibody-mediated depletion. In some cases, the safety switch protein is activated by an exogenous molecule (e.g., a prodrug) that, when activated, triggers apoptosis and / or cell death of the therapeutic cells. Examples of safety switch proteins include, but are not limited to, suicide genes such as caspase 9 (or caspase 3 or 7), thymidine kinase, cytosine deaminase, B-cell CD20, modified EGFR, and any combination thereof. In this strategy, a prodrug administered upon the occurrence of an adverse event is activated by the suicide gene product and kills the transduced cells.

[0394] As used herein, the term "pharmaceutically active protein or peptide" refers to a protein or peptide that is capable of effecting a biological and / or medicinal effect on an organism. A pharmaceutically active protein has curative or palliative properties against a disease and can be administered to improve, relieve, alleviate, reverse or lessen the severity of the disease. A pharmaceutically active protein also has prophylactic properties and is used to prevent the onset of a disease or to lessen the severity of such a disease or pathological condition when it occurs. A pharmaceutically active protein includes the entire protein or peptide or a pharmaceutically active fragment thereof. It also includes pharmaceutically active analogs of the protein or peptide or of a fragment of the protein or peptide. The term pharmaceutically active protein also refers to multiple proteins or peptides that cooperate or synergize to provide a therapeutic benefit. Examples of pharmaceutically active proteins or peptides include, but are not limited to, receptors, binding proteins, transcriptional and translational factors, tumor growth inhibitory proteins, antibodies or fragments thereof, growth factors, and / or cytokines.

[0395] As used herein, the term "signaling molecule" refers to any molecule that modulates, participates in, inhibits, activates, decreases or increases cell signal transduction. Signal transduction refers to the transmission of a molecular signal in the form of a chemical modification by recruiting protein complexes along a pathway that ultimately triggers a biochemical event in a cell. Signal transduction pathways are well known in the art and include, but are not limited to, G protein-coupled receptor signaling, tyrosine kinase receptor signaling, integrin signaling, toll gate signaling, ligand-gated ion channel signaling, ERK / MAPK signaling pathway, Wnt signaling pathway, cAMP-dependent pathway, and IP3 / DAG signaling pathway.

[0396] As used herein, the term "targeting modality" refers to a molecule, e.g., a polypeptide, that is genetically incorporated into a cell to facilitate antigen and / or epitope specificity, including but not limited to i) antigen specificity associated with a unique chimeric antigen receptor (CAR) or T cell receptor (TCR), ii) binding specificity associated with a monoclonal antibody or bispecific engager, iii) targeting of transformed cells, iv) targeting of cancer stem cells, and v) other targeting strategies in the absence of a specific antigen or surface molecule.

[0397] As used herein, the term "specific" or "specificity" can be used to refer to the ability of a molecule (e.g., a receptor or engager) to selectively bind to a target molecule, in contrast to non-specific or non-selective binding.

[0398] As used herein, the term "adoptive cell therapy" refers to a cell-based immunotherapy as used herein that involves the infusion of autologous or allogeneic lymphocytes that are identified as T or B cells that have been expanded ex vivo prior to the infusion, whether or not they are genetically modified.

[0399] As used herein, "therapeutically sufficient amount" includes within its meaning a non-toxic but sufficient and / or effective amount of a particular therapeutic and / or pharmaceutical composition to provide a desired therapeutic effect. The exact amount needed varies from subject to subject, depending on factors such as the patient's general health status, the patient's age, and the stage and severity of the condition. In particular embodiments, a therapeutically sufficient amount is sufficient and / or effective to ameliorate, alleviate, and / or improve at least one symptom associated with the disease or condition of the subject being treated.

[0400] "Functional" as used in the context of genome editing or modification of iPSCs and derived non-pluripotent cells differentiated therefrom or non-pluripotent cells reprogrammed therefrom and genome editing or modification of derived iPSCs means (1) successful knock-in, knock-out, knock-down of gene expression, transgene or controlled gene expression at the genetic level, such as inducible or transient expression at the desired cell developmental stage, achieved by direct genome editing or modification or by "passage" via differentiation from or reprogramming of the starting cell of the initial genome engineering; or (2) at the cellular level, successful removal, addition or alteration of cellular functions / characteristics via (i) gene expression modifications obtained in the cell by direct genome editing, (ii) gene expression modifications maintained in the cell by "passage" via differentiation from or reprogramming of the starting cell of the initial genome engineering, (iii) downstream gene regulation in the cell resulting from gene expression modifications that only occur in early developmental stages of the cell or only in the starting cell from which the cell was generated via differentiation or reprogramming, or (iv) enhanced or newly acquired cellular functions or properties originally derived from the genome editing or modification performed at the origin of the iPSC, progenitor cell or dedifferentiated cell that are displayed in the mature cell product.

[0401] “HLA-deficient,” including HLA-Class I deficient or HLA-Class II deficient or both, refers to a cell that lacks or no longer maintains or has a reduced level of surface expression of intact MHC complex comprising HLA Class I protein heterodimers and / or HLA Class II heterodimers, such that the reduced or lowered level is lower than naturally detectable by other cells or by synthetic methods. HLA Class I deficiency can be achieved by functionally deleting any region of the HLA Class I locus (chromosome 6p21), or deleting or reducing the expression level of HLA Class I associated genes including but not limited to the beta-2 microglobulin (B2M) gene, TAP 1 gene, TAP 2 gene, and Tapasin. HLA Class II deficiency can be achieved by functionally deleting or reducing HLA-II associated genes including but not limited to RFXANK, CIITA, RFX5, and RFXAP. Prior to the present invention, it was not known whether HLA complex deficient or altered iPSCs had the ability to enter developmental, maturation, and functional differentiated cells while retaining modulated activity. Further, prior to the present invention, it was not known whether HLA complex deficient differentiated cells could be reprogrammed to iPSCs and maintained as pluripotent stem cells while having HLA complex deficiency. Unanticipated failure in cell reprogramming, pluripotency maintenance, and during differentiation can be related to aspects including but not limited to developmental stage specific gene expression or lack thereof, requirement for HLA complex presentation, shedding of introduced surface expression forms of proteins, need for proper and efficient clonal reprogramming, and need for reconfiguration of differentiation protocols.

[0402] Examples

[0403] Example 1 - S44P and E99K mutations in Cas-CLOVER cause increased in vitro gene editing activity relative to wild type Cas-CLOVER

[0404] This example demonstrates that Cas-CLOVER amino acid sequences carrying S44P and E99K mutations in the Clo051 nuclease domain show increased in vitro gene editing activity in several cell lines compared to wild type Cas-CLOVER.

[0405] Gene editing in Huh7 and HepaRG cell lines

[0406] Huh7 or HepaRG cells were seeded at a density of 5E5 cells / ml in 12-well and transfected with a mixture containing an unsaturated amount of 0.2 pg / ml of gRNA pairs targeting the intron of the albumin gene, APOC3 gene, or TTR gene, 0.5 pg / ml of wild-type Cas-CLOVER mRNA (encoded by the nucleic acid sequence of SEQ ID NO: 11), Cas-CLOVER mRNA containing the S44P mutation (encoded by the nucleic acid sequence of SEQ ID NO: 36), or Cas-CLOVER mRNA containing the S44P and E99K mutations (encoded by the nucleic acid sequence of SEQ ID NO: 77), and 15 mΐ / ml of lipofectamine messengerMAX reagent (Thermo Fisher, Inc) according to the manufacturer’s instructions. After 48 hours, the media was removed, cells were lysed, and genomic DNA was isolated from the cell extract using the QuickExtract kit (Lucigen Corp.) according to the manufacturer’s instructions.

[0407] The isolated genomic DNA was then analyzed using PCR by designing primers flanking the specific target sequence: Albumin-Forward: AAGACGTGTGTGGGGATCAG (SEQ ID NO: 51) and Albumin-Reverse: GAGCAAAGGCAATCAACACCC (SEQ ID NO: 52); APOC3-Forward: CTCAGCCCTGCTCTTTCCTC (SEQ ID NO: 53) and APOC3-Reverse: CTCGCAGGATGGATAGGCAG (SEQ ID NO: 54); TTR-Forward: ATTGAACCCCAAGAACCACAT (SEQ ID NO: 55) and TTR-Reverse: CTGCCTCCTAGATTCAAGGG (SEQ ID NO: 56). PCR products were isolated and DNA sequences were determined by direct Sanger sequencing of the wild-type insertion-deletion rates, S44P, and S44P and E99K Cas-CLOVER variants were quantified using ICE analysis (Synthego Corp.). The percentage of indels for wild-type, S44P, and S44P and E99K in Huh7 and HepaRG cell lines are shown in Table 2.

[0408] Table 2. Percentage of indels in Huh7 cell lines and HepaRG cell lines

[0409] Albumin APOC3 TTR Huh7 WT Cas-CLOVER 48 42 34 Huh7 S44P Cas-CLOVER 60 34 22 Huh7 S44P / E99K Cas-CLOVER 76 52 58 HepaRG WT Cas-CLOVER 76 73 47 HepaRG S44P Cas-CLOVER 70 69 52 HepaRG S44P / E99K Cas-CLOVER 85 83 60

[0410] As shown in Table 2, the S44P / E99K double mutant resulted in an indel rate at the APOC3 and TTR genomes that was about 1.1 to 1.7 fold that of the wild-type Cas-CLOVER sequence.

[0411] Gene editing in the HepG2 cell line

[0412] A mixture containing a non-saturating amount of 0.2 pg / ml gRNA pairs targeting introns of the albumin gene, APOC3 gene, or TTR gene, 0.5 pg / ml wild-type Cas-CLOVER mRNA (encoded by the nucleic acid sequence of SEQ ID NO: 11), Cas-CLOVER mRNA containing the S44P mutation (encoded by the nucleic acid sequence of SEQ ID NO: 36), or Cas-CLOVER mRNA containing the S44P and E99K mutations (encoded by the nucleic acid sequence of SEQ ID NO: 77) was electroporated into 5E5 HepG2 cells using Lonza Nucleofector according to the manufacturer’s instructions. The electroporated cells were plated at a density of 5E6 cells / ml and incubated in culture medium for 48 hours. After 48 hours, the culture medium was removed, cells were lysed, and genomic DNA was isolated from the cell extract using the QuickExtract kit (Lucigen Corp.) according to the manufacturer’s instructions.

[0413] The isolated genomic DNA was then analyzed using PCR by designing primers flanking the target sequence of the specific gene: albumin-forward: AAGACGTGTGTGGGGATCAG (SEQ ID NO: 51) and albumin-reverse: GAGCAAAGGCAATCAACACCC (SEQ ID NO: 52); APOC3-forward: CTCAGCCCTGCTCTTTCCTC (SEQ ID NO: 53) and APOC3-reverse: CTCGCAGGATGGATAGGCAG (SEQ ID NO: 54); TTR-forward: ATTGAACCCCAAGAACCACAT (SEQ ID NO: 55) and TTR-reverse: CTGCCTCCTAGATTCAAGGG (SEQ ID NO: 56). PCR products were isolated and DNA sequences were determined by direct Sanger sequencing. The indel rates of wild-type, S44P, and S44P and E99K Cas-CLOVER variants were quantified using ICE analysis (Synthego Corp.). The percentage of indels for wild-type, S44P, and S44P and E99K Cas-CLOVER variants in the HepG2 cell line are shown in Table 3.

[0414] Table 3. Indel percentage in HepG2 cell line

[0415] Albumin APOC3 TTR HepG2 WT Cas-CLOVER 40 57 12 HepG2 S44P Cas-CLOVER 39 82 22 HepG2 S44P / E99K Cas-CLOVER 74 83 53

[0416] As shown in Table 3, the S44P / E99K variant resulted in an indel rate at the albumin and APOC3 loci that was about 1.5-fold that of the wild-type Cas-CLOVER sequence, and an indel rate at the TTR locus that was about 4.4-fold that of the wild-type Cas-CLOVER sequence.

[0417] Gene editing in HPSCs

[0418] A mixture of a gRNA pair (SEQ ID NO: 67 and SEQ ID NO: 68) targeting the HBG1 gene comprising a non-saturating amount of 0.2 pg / ml, 1.5 or 4.0 pg / ml of wild-type Cas-CLOVER mRNA (encoded by the nucleic acid sequence of SEQ ID NO: 11), Cas-CLOVER mRNA comprising the S44P mutation (encoded by the nucleic acid sequence of SEQ ID NO: 36), or Cas-CLOVER mRNA comprising the S44P and E99K mutations (encoded by the nucleic acid sequence of SEQ ID NO: 77) was electroporated into 5E5 HSPC cells using Lonza Nucleofector according to the manufacturer’s instructions. The electroporated cells were plated at a density of 5E6 cells / ml and incubated in media for 48 hours. After 48 hours, the media was removed, the cells were lysed, and genomic DNA was isolated from the cell extract using the QuickExtract kit (Lucigen Corp.) according to the manufacturer’s instructions.

[0419] For HSPC cells, gene editing at the HBG locus was measured using next-generation sequencing (“NGS”). Briefly, genomic DNA samples were PCR amplified using a pair of DNA primers flanking exon 1 of the HBG1 gene (shown in underlined font), which further contained Illumina partial adaptors: forward

[0420] ACACTCTTTCCCTACACGACGCTCTTCCGATCT GCAGTATCCTCTTGGGGG (SEQ ID NO: 57); and reverse

[0421] GACTGGAGTTCAGACGTGTGCTCTTCCGATCT ACCTCAGACGTTCCAGAAGC(SEQ ID NO: 58). The resulting PCR amplicons were subjected to a second PCR reaction using primers containing Illumina P5 and P7 sequences (Illumina Corp) and unique index sequences (New England Biolabs). The final amplicons were pooled at equimolar concentrations and analyzed using a Miseq benchtop sequencer following the manufacturer’s (Illumina Corp) Amplicon-seq standard procedure. Sequence data was analyzed using the CRISPResso2 program to determine the indel frequencies in each sample. The results are shown in Table 4.

[0422] Table 4. Indel frequencies

[0423]

[0424] As shown in Table 4, the double S44P and E99K Cas-CLOVER variant exhibited approximately 2-fold indel activity at the HBG1 locus relative to wild-type Cas-CLOVER and was further improved compared to the S44P mutant alone.

[0425] Example 2 - S44P and E99K mutations in Cas-CLOVER result in increased in vivo gene editing activity relative to wild-type Cas-CLOVER

[0426] This example demonstrates that Cas-CLOVER amino acid sequences carrying the S44P mutation in the Clo051 nuclease domain show increased in vivo gene editing activity at multiple genomic loci compared to wild-type Cas-CLOVER.

[0427] Psck9 gene editing

[0428] A. LNP preparation

[0429] To formulate the lipid nanoparticles (LNP), the terpene-based lipid HMA-404, the phospholipid DOPC, the structural lipid cholesterol (Chol), and 1,2-dimyristoyl-sn-glycero- methoxypolyethylene glycol (DMG-PEG2000; Avanti Polar Lipids, Alabaster, Alabama, USA) were combined to make the LNP composition. The RNA molecule was encapsulated in the lipid nanoparticles comprising about 40.75% by mole HMA-404, about 51.75% by mole cholesterol, about 5% by mole DOPC, and about 2.5% by mole DMG-PEG2000. The ratio of lipid to nucleic acid in the nanoparticle was about 120:1 (weight / weight), and the total lipid was 25 mM.

[0430] Compound HMA-404

[0431]

[0432] Compound HMA-404 was prepared as described in PCT Application No. PCT / US2023 / 061005. The crude material was purified by silica gel flash chromatography (eluent: 5% MeOH / DCM). 1 H NMR (400 MHz, Chloroform-d) δ 4.38 - 4.12 (m, 16H), 2.90 - 2.78 (m, 4H), 2.71 (t, J = 6.8 Hz, 8H), 2.61 (s, 3H), 2.57 - 2.36 (m, 12H), 2.35 - 2.04 (m, 4H), 2.01 - 1.62 (m, 17H), 1.60 - 0.96 (m, 45H), 0.94 - 0.67 (m, 30H).

[0433] Using (TriLink Corp) further capped mRNA molecules and substituted all cytidine residues in the mRNA with 5-methylcytidine (5-MeC).

[0434] Individual 25 mg / ml stock solutions were prepared by dissolving the lipids in 200-proof HPLC grade ethanol and the stock solutions were stored at -80°C until formulation. At the time of formulation, the lipid stock solutions were briefly equilibrated to room temperature and then placed on a hot plate held at a temperature range of 50°C to 55°C. Subsequently, the hot lipid stocks were combined to achieve the desired final molar percentages.

[0435] A gRNA pair (SEQ ID NO: 59 and SEQ ID NO: 60) targeting the first exon of the mouse pcsk9 gene and 1 mg / ml solutions of mRNA encoding 5'-CleanCap-5MeC-Cas-CLOVER (SEQ ID NO: 69) or 5'-CleanCap-5MeC-Cas-CLOVER S44P (SEQ ID NO: 70) or 5'-CleanCap-5MeC-Cas-CLOVER S44P / E99K (SEQ ID NO: 71) to be incorporated into the LNP were separately added to 150 mM sodium acetate buffer (pH 5.2) to form stock solutions and held on ice. The mRNA was formulated into LNP according to the manufacturer’s instructions using The instrument (Precision Nanosystems, Vancouver, BC, Canada) mixed the lipid phase with the aqueous phase mRNA within the microfluidic chip to form the LNP composition comprising encapsulated mRNA. Nanoassemblr process parameters for mRNA encapsulation are shown in Table 5.

[0436] Table 5. Nanoassemblr process parameters

[0437]

[0438] The resulting mRNA LNP composition was then transferred to a Repligen Float-A-Lyzer dialysis device (Spectrum Chemical Mfg. Corp, CA, USA) with a molecular weight cut-off (MWCO) of 8-10 kDa and dialyzed against phosphate buffered saline (PBS) pH 7.4 (dialysate:dialysis buffer volume at least 1:200 v / v) at 4°C overnight (or alternatively at room temperature for at least 4 hours) to remove the 25% ethanol and achieve complete buffer exchange. In some experiments, the LNP was further concentrated in an Ultra-4 centrifugal filter device MWCO-30 kDa (Millipore Sigma, USA) at approximately 4100 x g for 10 minutes. The mRNA LNP was then stored at 4°C until further use. The average particle size diameter of the LNP was approximately 70 nm.

[0439] B. Pilot Study

[0440] Adult female BALB / C mice (n = 2 / group) were intravenously co-administered with 1.0 mg / kg of a pair of psck9-targeting gRNAs (SEQ ID NO: 59 and SEQ ID NO: 60) formulated in LNP composition in Example 2, Part A, and mRNA encoding 5’-CleanCap-5MeC-Cas-CLOVER (SEQ ID NO: 69) or 5’-CleanCap-5MeC-Cas-CLOVER S44P (SEQ ID NO: 70) or 5’-CleanCap-5MeC-Cas-CLOVER S44P / E99K (SEQ ID NO: 71). One group of mice was treated with vehicle (PBS, Thermo Fisher Scientific, USA) as a negative control.

[0441] Seven days after administration, mice were euthanized and DNA was isolated from the livers of treated and untreated mice. Briefly, livers were excised after euthanasia, flash frozen in liquid nitrogen, mixed with lysis buffer (200 μΐ, lysis buffer + 10 μΐ, 15 mg tissue in Proteinase K), and pulverized using Triple-Pure zirconium beads (Fisher Scientific) in a TissueLyser II (Qiagen). Homogenized tissue was incubated at 56 °C for 30 minutes and column purified using a Monarch Genomic DNA Purification Kit from New England Biolabs following the manufacturer’s instructions. Final DNA elution was performed in 50 μΐ, elution buffer (10 mM Tris-Cl, pH 8.5). Concentration and purity of DNA samples were assessed by measuring absorbance at 260 and 280 nm.

[0442] The extent of gene editing observed for Cas-CLOVER and Cas-CLOVER S44P / E99K mRNA delivered to mice was measured by droplet digital PCR (ddPCR) using a Drop-off assay containing fluorescent probes that hybridize to the Cas-CLOVER target site. Percent indel at the psck9 locus in the livers of treated mice for wild-type Cas-CLOVER and Cas-CLOVER S44P / E99K are shown in Table 6.

[0443] Table 6. Percent indel at the Pcsk9 locus in mouse livers

[0444]

[0445] As shown in Table 6, Cas-CLOVER carrying the S44P mutation or the S44P and E99K mutations each resulted in a percent indel that was approximately 1.6 to 1.8-fold that of wild-type Cas-CLOVER, demonstrating an improvement in the in vivo activity of the S44P and E99K double mutant.

[0446] C. Follow-up Study

[0447] Adult female BALB / C mice (n = 2 / group) were intravenously co-administered with 0.75 mg / kg or 1.5 mg / kg of a pair of psck9-targeting gRNAs (SEQ ID NO: 59 and SEQ ID NO: 60) formulated in the LNP composition in Example 2A, and an mRNA encoding 5'-CleanCap-5MeC-Cas-CLOVER (SEQ ID NO: 69) or 5'-CleanCap-5MeC-Cas-CLOVER S44P (SEQ ID NO: 70) or 5'-CleanCap-5MeC-Cas-CLOVER S44P / E99K (SEQ ID NO: 71). One group of mice was treated with vehicle (PBS, Thermo Fisher Scientific, USA) as a negative control.

[0448] Seven days after administration, mice were euthanized and DNA was isolated from the following five tissue types from each group of mice: liver, heart, spleen, lung, and kidney. Briefly, a liver biopsy was excised after euthanasia, flash frozen in liquid nitrogen, mixed with lysis buffer (200 pL lysis buffer + 10 pL 15 mg of tissue in proteinase K), and pulverized using Triple-Pure zirconium beads (Fisher Scientific) in a TissueLyser II (Qiagen). Homogenized tissues were incubated at 56 °C for 30 minutes and column purified using a Monarch Genomic DNA Purification Kit from New England Biolabs following the manufacturer’s instructions. Final DNA elution was performed in 50 pL elution buffer (10 mM Tris-Cl, pH 8.5). Concentration and purity of DNA samples were assessed by measuring absorbance at 260 and 280 nm.

[0449] The extent of gene editing observed for wild-type Cas-CLOVER, S44P Cas-CLOVER, and S44P / E99K Cas-CLOVER mRNA delivered to mice was measured by droplet digital PCR (ddPCR) using a Drop-off assay containing fluorescent probes that hybridize to the Cas-CLOVER target site. The percentage of indels at the psck9 locus in the livers of treated mice for wild-type Cas-CLOVER, S44P Cas-CLOVER, and S44P / E99K Cas-CLOVER are shown in Table 7.

[0450] Table 7. Percentage of indels at the psck9 locus in mouse liver

[0451]

[0452] As shown in Table 7, Cas-CLOVER carrying the S44P mutation resulted in an indel percentage that was between about 3 to 40-fold of wild-type Cas-CLOVER, while the double S44P and E99K mutant’s indel rate was further between about 4 to 75-fold of wild-type Cas-CLOVER, demonstrating that the double S44P and E99K mutant’s in vivo activity was improved compared to wild-type.

[0453] Example 3 - S44P and E99K mutations in Cas-CLOVER result in increased in vitro gene editing activity relative to wild-type Cas-CLOVER

[0454] This example demonstrates that Cas-CLOVER amino acid sequences carrying S44P and E99K mutations in the Clo051 nuclease domain show increased in vitro gene editing activity in human liver cells compared to wild-type Cas-CLOVER.

[0455] A. LNP preparation

[0456] To formulate the lipid nanoparticles (LNPs), the ionizable lipids SS-OP, the phospholipids DOPC and DSPC, the structural lipid cholesterol (Chol), and 1,2-dimyristoyl-sn-glycero- methoxypolyethylene glycol (DMG-PEG2000; Avanti Polar Lipids, Alabaster, Alabama, USA) were combined to make LNP compositions. The LNPs were prepared as described in PCT Publication No. WO 2022 / 182792. The RNA molecules were encapsulated in lipid nanoparticles comprising about 54% by mole SS-OP, about 35% by mole cholesterol, about 5% by mole DOPC, about 5% by mole DSPC, and about 1% by mole DMG-PEG2000. The ratio of lipids to nucleic acids in the nanoparticles was about 100:1 (weight / weight), and the total lipid was 25 mM. The LNPs were prepared using the lipid film hydration method. The mRNA molecules were further capped using Cap0 (TriLink Corp) and all cytidine residues in the mRNA were substituted with 5-methylcytidine (5-MeC).

[0457] Individual 25 mg / ml stock solutions were prepared by dissolving the lipids in 200-proof HPLC grade ethanol, and the stock solutions were stored at -80°C until formulation. At the time of formulation, the lipid stock solutions were briefly equilibrated to room temperature and then placed on a hot plate held at a temperature range of 50-55°C. Subsequently, the hot lipid stocks were combined to achieve the desired final molar percentages.

[0458] gRNA pairs targeting the human KLKB1 gene (SEQ ID NO: 72 and SEQ ID NO: 73) or mouse klkb1 gene (SEQ ID NO: 74 and SEQ ID NO: 75) to be incorporated into LNP and 1 mg / ml solutions of mRNA encoding 5'-CleanCap-5MeC-Cas-CLOVER (SEQ ID NO: 69) or 5'-CleanCap-5MeC-Cas-CLOVER S44P+E99K (SEQ ID NO: 71) were added individually into 150 mM sodium acetate buffer (pH 5.2) to form stock solutions and kept on ice. The lipid phase was mixed with the aqueous phase mRNA within a microfluidic chip using a Precision Nanosystems™ (Precision Nanosystems, Vancouver, BC, Canada) to form LNP compositions comprising encapsulated mRNA. Nanoassemblr process parameters for mRNA encapsulation are shown in Table 8. Precision Nanosystems™ (Precision Nanosystems, Vancouver, BC, Canada) to form LNP compositions comprising encapsulated mRNA. Nanoassemblr process parameters for mRNA encapsulation are shown in Table 8.

[0459] Table 8. Nanoassemblr process parameters

[0460]

[0461] The resulting mRNA LNP compositions were then transferred to Repligen Float-A-Lyzer dialysis devices (Spectrum Chemical Mfg. Corp, CA, USA) with a molecular weight cut-off (MWCO) of 8-10 kDa and dialyzed against phosphate buffered saline (PBS) pH 7.4 (dialysate:dialysis buffer volume at least 1:200 v / v) at 4°C overnight (or alternatively at room temperature for at least 4 hours) to remove 25% ethanol and achieve complete buffer exchange. In some experiments, LNP was further concentrated in an Ultra-4 centrifugal filter device MWCO-30 kDa (Millipore Sigma, USA) at approximately 4100 x g in a centrifuge for 10 minutes. The mRNA LNP was then stored at 4°C until further use. The average particle size diameter of the LNP was approximately 70 nm. Ultra-4 centrifugal filter device MWCO-30 kDa (Millipore Sigma, USA). The mRNA LNP was then stored at 4°C until further use. The average particle size diameter of the LNP was approximately 70 nm.

[0462] Gene editing in primary human hepatocytes (PHH) and HepaRG cell line

[0463] PHH or HepaRG cells were seeded in 12-well plates at a density of 5E5 cells / ml and transfected with different concentrations of gRNA (SEQ ID NO: 72 and SEQ ID NO: 73) targeting the human KLKB1 gene and mRNA encoding 5'-CleanCap-5MeC-Cas-CLOVER (SEQ ID NO: 69) or 5'-CleanCap-5MeC-Cas-CLOVER S44P+E99K (SEQ ID NO: 71) formulated in the LNP composition of Example 3A. After 48 hours, the culture medium was removed, cells were lysed, and genomic DNA was isolated from cell extracts using the QuickExtract kit (Lucigen Corp.) following the manufacturer's instructions. The isolated genomic DNA was then analyzed by droplet digital PCR (ddPCR) using a Drop-off assay containing fluorescent probes that hybridize to the Cas-CLOVER target site. The percentage of indels in PHH and HepaRG cell lines for wild type and S44P+E99K are shown in Table 9.

[0464] Table 9. Percentage of indels in PHH and HepaRG cell lines

[0465] 0.5ug / mL 1ug / mL PHH WT Cas-CLOVER 19.5 32.9 PHH S44P+E99K Cas-CLOVER 48.5 50.5 HepaRG WT Cas-CLOVER 53.5 79.3 HepaRG S44P+E99K Cas-CLOVER 44.1 84.0

[0466] Example 4 - S44P and E99K mutations in Cas-CLOVER result in increased in vivo gene editing activity relative to wild type Cas-CLOVER

[0467] This example demonstrates that Cas-CLOVER amino acid sequences carrying S44P and E99K mutations in the Clo051 nuclease domain show increased in vivo gene editing activity at multiple genomic loci compared to wild type Cas-CLOVER.

[0468] A. Human KLKB1 gene editing in liver humanized mice

[0469] In fully humanized adult male NOD.Cg-Prkdcscid Il2rgtm1Sug Tg(Alb-UL23)7-2 / ShiJic mice (TK-Nog from Taconic; n=3 / group), 2.0 mg / kg of gRNA (SEQ ID NO:74 and SEQ ID NO:75) formulated with the LNP composition of Example 3A targeting KLKB1 and mRNA encoding 5'-CleanCap-5MeC-Cas-CLOVER (SEQ ID NO:69), 5'-CleanCap-5MeC-Cas-CLOVER S44P (SEQ ID NO:70), or 5'-CleanCap-5MeC-Cas-CLOVER S44P and E99K (SEQ ID NO:71) were co-administered intravenously. A group of mice treated with the medium (PBS, Thermo Fisher Scientific, USA) served as a negative control.

[0470] Seven days after administration, mice were euthanized, and DNA was isolated from the dried tissue. Briefly, liver biopsies were performed after euthanasia, rapidly frozen in liquid nitrogen, mixed with lysis buffer (200 μL lysis buffer + 15 mg tissue in 10 μL proteinase K), and homogenized using Triple-Pure zirconium beads (Fisher Scientific) in TissueLyser II (Qiagen). The homogenized tissue was incubated at 56 °C for 30 min and column purified using the Monarch Genomic DNA Purification Kit from New England Biolabs according to the manufacturer's instructions. Final DNA elution was performed in 50 μL elution buffer (10 mM Tris-Cl, pH 8.5). The concentration and purity of the DNA samples were assessed by measuring absorbance at 260 and 280 nm.

[0471] The degree of gene editing observed in Cas-CLOVER and Cas-CLOVER S44P+E99K mRNA delivered to mice was measured using drop-off assays with a fluorescent probe containing a hybridization site to the Cas-CLOVER target site. The percentage of insertions and deletions at the KLKB1 locus in the livers of treated mice by wild-type Cas-CLOVER and Cas-CLOVER S44P+E99K is shown in Table 10.

[0472] Table 10. Percentage of insertions and deletions at the KLKB1 gene locus in mouse liver

[0473]

[0474] As shown in Table 10, Cas-CLOVER carrying the S44P+E99K mutations resulted in an indel percentage that was approximately 3.2-fold higher than wild-type Cas-CLOVER, demonstrating improved in vivo activity of the S44P+E99K mutant.

[0475] B. Mouse klkb1 gene editing in wild-type BALB / c mice

[0476] Female BALB / c mice (n=3 / group) were intravenously co-administered with 2.0 mg / kg of a pair of gRNAs targeting mouse klkb1 (SEQ ID NO: 74 and SEQ ID NO: 75) and mRNA encoding 5’-CleanCap-5MeC-Cas-CLOVER (SEQ ID NO: 69) 5’-CleanCap-5MeC-Cas-CLOVER S44P (SEQ ID NO: 70), or 5’-CleanCap-5MeC-Cas-CLOVER S44P and E99K (SEQ ID NO: 71) formulated in the LNP composition in Example 3A. One group of mice was treated with vehicle (PBS, Thermo Fisher Scientific, USA) as a negative control.

[0477] Seven days after administration, mice were euthanized and DNA was isolated from dried tissues. Briefly, a liver biopsy was excised after euthanasia, flash frozen in liquid nitrogen, mixed with lysis buffer (200 µL lysis buffer + 10 µL 15 mg of tissue in proteinase K), and pulverized using Triple-Pure zirconium beads (Fisher Scientific) in a TissueLyser II (Qiagen). Homogenized tissues were incubated at 56 °C for 30 minutes and column purified using a Monarch Genomic DNA Purification Kit from New England Biolabs following the manufacturer’s instructions. Final DNA elution was performed in 50 µL elution buffer (10 mM Tris-Cl, pH 8.5). Concentration and purity of DNA samples were assessed by measuring absorbance at 260 and 280 nm.

[0478] The extent of gene editing observed for Cas-CLOVER and Cas-CLOVER S44P+E99K mRNA delivered to mice was measured by droplet digital PCR (ddPCR) using a Drop-off assay containing fluorescent probes that hybridize to the Cas-CLOVER target site. The percentage of indels at the KLKB1 locus in the livers of treated mice for wild-type Cas-CLOVER and Cas-CLOVER S44P+E99K are shown in Table 11.

[0479] Table 11. Percentage of indels at the mouse liver KLKB1 locus

[0480]

[0481] As shown in Table 11, Cas-CLOVER carrying the S44P+E99K mutation resulted in a 2.2-fold increase in the percentage of indels compared to wild-type Cas-CLOVER, demonstrating improved in vivo activity of the S44P+E99K mutant.

Claims

1. A polypeptide comprising the amino acid sequence of SEQ ID NO:

76.

2. A polynucleotide encoding the polypeptide of claim 1.

3. A vector comprising the polynucleotide of claim 2.

4. A pharmaceutical composition comprising the vector of claim 3 and at least one pharmaceutically acceptable excipient or diluent.

5. A method of modifying a target sequence in the genome of a plurality of cells, the method comprising introducing into a population of unmodified cells a composition comprising: a) a polypeptide comprising the amino acid sequence of SEQ ID NO: 76, or a polynucleotide encoding the polypeptide of SEQ ID NO: 76; and b) at least one guide RNA (gRNA), thereby generating a modification at the target sequence in the genome, and wherein 1.1-fold to 100-fold of the plurality of cells comprise the modification at the target sequence in the genome compared to a plurality of modified cells introduced with a composition comprising a polypeptide comprising an amino acid sequence comprising SEQ ID NO: 10 or a polynucleotide encoding the polypeptide of SEQ ID NO:

10.

6. The method of claim 5, wherein 1.6-fold to 3.2-fold of the plurality of cells comprise the modification at the target sequence in the genome compared to a plurality of modified cells introduced with a composition comprising a polypeptide comprising the amino acid sequence comprising SEQ ID NO: 10 or a polynucleotide encoding the polypeptide of SEQ ID NO:

10.

7. The method of claim 5, wherein 4-fold to 75-fold of the plurality of cells comprise the modification at the target sequence in the genome compared to a plurality of modified cells introduced with a composition comprising a polypeptide comprising the amino acid sequence comprising SEQ ID NO: 10 or a polynucleotide encoding the polypeptide of SEQ ID NO:

10.

8. The method of any one of claims 5 to 7, wherein the modification at the target sequence in the genome is a deletion, an insertion, a substitution, an inversion, and / or a relocation.

9. The method of any one of claims 5 to 7, wherein the composition is encapsulated in at least one lipid nanoparticle comprising: about 40.75% by mole of a compound of Formula (I), Formula (I) about 51.75% by mole of cholesterol, about 5% by mole of DOPC, and about 2.5% by mole of DMG-PEG 2000; wherein the polynucleotide encoding the polypeptide of SEQ ID NO: 76 is an RNA molecule, and wherein the ratio of lipids to RNA molecules in at least one nanoparticle is about 120: 1 (w / w).

10. The method of any one of claims 5 to 7, wherein the composition is encapsulated in at least one lipid nanoparticle comprising: about 5% by mole of DSPC, and about 1% by mole of DMG-PEG2000, wherein the polynucleotide encoding the polypeptide of SEQ ID NO: 76 is an RNA molecule, and wherein the ratio of lipids to RNA molecules in the at least one nanoparticle is about 100:1 (w / w) and the total lipid is 25 nM.

11. The method of any one of claims 5-10, wherein the plurality of cells comprises: (a) a liver cell, preferably wherein the liver cell is a hepatocyte, a hepatic stellate cell, a Kupffer cell, or a liver sinusoidal endothelial cell; (b) a T cell, preferably wherein the T cell is an activated T cell, a resting T cell, or a stem memory T cell (T SCM cell); or (c) a hematopoietic stem cell (HSC).

12. A cell modified according to the method of any one of claims 5-11.

13. A composition comprising a population of cells modified according to the method of claims 5-11.

14. A method of treating at least one disease or condition in a subject in need thereof, the method comprising administering to the subject at least one therapeutically effective amount of the pharmaceutical composition of claim 4 or the cell of claim 12 or the composition of claim 13.

15. The method of claim 14, wherein the at least one disease or condition is a liver disease or condition, preferably wherein the liver disease or condition is: (a) a metabolic liver disorder; (b) a urea cycle disorder (UCD), preferably wherein the UCD is N-acetylglutamate synthetase (NAGS) deficiency, carbamoyl phosphate synthetase I deficiency (CPSI deficiency), ornithine transcarbamylase (OTC) deficiency, argininosuccinic acid synthetase deficiency (ASSD) (citrinemia I), citrin deficiency (citrinemia II), argininosuccinic acid lyase deficiency (argininosuccinic aciduria), arginase deficiency (hyperargininemia), ornithine translocase deficiency (HHH syndrome), or any combination thereof.

16. The method of claim 14, wherein the at least one disease or condition is a cancer.

17. The method of claim 14, wherein the at least one disease or condition is hemophilia A.

Images