A microbial composition for preventing and controlling root rot in tea trees and its application

By using microbial compositions to regulate the soil environment and enhance the vitality of tea tree roots, the problem of preventing and controlling tea tree root rot has been solved, achieving a green and sustainable disease control effect.

CN121085710BActive Publication Date: 2026-03-06WENWU TEA IND (LINCANG) CO LTD
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202511657996.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-11-13
Publication Date
2026-03-06
Estimated Expiration
2045-11-13

AI Technical Summary

Technical Problem

Tea tree root rot is difficult to control. Existing technologies suffer from the following problems: the pathogen is highly stubborn, the symptoms are concealed, the transmission routes are complex, the ecological and technological compatibility is limited, and there is a contradiction between economic costs and awareness of prevention and control. As a result, the control is difficult and chemical control is prone to leading to drug resistance and high pesticide residue risks.

Method used

A microbial composition is provided, comprising Bacillus cabrialesii N4471 and Trichoderma yunnanense YNK-FG0001, combined with humic acid, garland chrysanthemum extract, amino acids, fucoidan oligosaccharides, complex vitamins and trace elements, which enhances crop root vitality and antioxidant enzyme activity and inhibits pathogen infection by regulating soil pH and cation exchange capacity.

Benefits of technology

It significantly improves soil water stability, aggregates and pH, enhances root antioxidant enzyme activity, reduces pathogen reproduction, optimizes soil structure, improves the control effect of tea tree root rot, and builds a green and sustainable control system.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

This invention relates to a microbial composition for preventing and controlling root rot in tea trees and its application, belonging to the field of microbial and organic fertilizer technology. The composition comprises the following components: Component 1, Bacillus kaempferi and Trichoderma yunnanensis; Component 2, humic acid, Chrysanthemum indicum extract, amino acids, brown algae oligosaccharides, complex vitamins, and trace elements; wherein, Bacillus kaempferi is N4471 (…). Bacillus cabrialesii The accession number is CCTCC NO: M20221660, and the Yunnan Trichoderma is YNK-FG0001 ( Trichoderma yunnanense The microbial composition, with accession number CCTCC NO: M 2025645, significantly improved soil water stability aggregates, pH, and cation exchange capacity when applied to tea plant cultivation. It also enhanced root vitality and the activity of antioxidant enzymes [superoxide dismutase (SOD) and peroxidase (POD)], thereby reducing the growth of Fusarium rot (…). Fusarium solani ), Pythium ( Pythium spinosum ) and teosinte ( Rosellinia arched The disease index of tea tree root rot caused by infection was used to ultimately achieve effective control of tea tree root rot.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of microbial and organic fertilizer technology, specifically, it relates to a microbial composition for preventing and controlling root rot in tea trees and its application. Background Technology

[0002] With the adjustment of agricultural production structure, tea tree planting often suffers from problems such as neglecting soil pH (e.g., planting in neutral / alkaline soils) and drainage (planting in low-lying, waterlogged areas), variety selection that violates regional climate (blindly introducing foreign varieties), and imbalances in planting density (too high or too low) and pruning management (excessive or extensive). These problems lead to poor root development, weak resistance, and decreased yield and quality in tea trees. In fertilizer management, there are common problems such as unbalanced fertilization structure (over-reliance on nitrogen fertilizer, lack of phosphorus, potassium, and micronutrients), insufficient application of organic fertilizer leading to soil compaction and acidification, and extensive fertilization timing (e.g., applying quick-acting fertilizer during dormancy) and methods (surface application) causing nutrient loss. These issues damage the soil ecology and lead to the accumulation of pathogenic microorganisms in the soil, resulting in severe epidemic root rot diseases.

[0003] Tea root rot is a devastating root disease of tea trees caused by various fungi. Symptoms include brown rot starting from the fine roots and gradually spreading to the main root. A characteristic mycelial layer corresponding to the pathogen will form on the surface of the diseased roots. Above ground, the disease first manifests as a reduction in new shoots, yellowing and thinning of leaves, and premature drop of older leaves. Later, the branches wither and the entire plant may die. This disease is prone to occur in heavy, waterlogged soil, in old tea gardens that have been continuously cropped, and in hot and humid environments. It is often aggravated by improper fertilization, root damage, or infected seedlings. Its damage is significant, not only causing a sharp decline in the yield of fresh tea leaves and patchy death of mature tea trees, but also allowing the pathogen to survive in the soil for many years, creating obstacles to continuous cropping. It also increases the cost of soil disinfection and diseased plant removal, seriously restricting the sustainable management of tea gardens. The challenges of tea tree root rot lie in its multi-dimensional and overlapping nature: First, the pathogen is highly persistent, surviving in the soil for many years via mycelium and sclerotia, making it difficult to eradicate from deep root layers, and it can also form a cycle of infection through surrounding fruit trees, forest trees, and other hosts; Second, the symptoms are highly concealed, with the disease originating in the root system, requiring root digging for examination, while above-ground symptoms such as yellowing and reduced new shoots only appear after the root system has suffered sufficient damage, and are easily confused with nutrient deficiency and drought, leading to difficulties in early diagnosis and delayed control; Third, the transmission routes are complex, spreading through infected seedlings, contaminated farm tools, and rainwater runoff, and coupled with the perennial nature of tea trees, continuous cropping in old tea gardens easily leads to... The accumulation of pathogens in continuous cropping hinders the breaking of the transmission chain; fourth, the ecological and technological adaptability of tea gardens is limited. The suitable humid environment for tea trees is conducive to the reproduction of pathogens, while biological control is greatly affected by temperature and humidity and has a long control cycle, chemical control is prone to resistance and pesticide residue risks, and agricultural control (disease removal, soil improvement) is labor-intensive, time-consuming and costly, making it difficult for small and medium-sized tea farmers to implement quickly; fifth, there is a contradiction between economic costs and awareness of control. Some tea farmers lack awareness of long-term harm and tend to use short-term, low-cost measures, while scientific control (healthy seedlings, biocontrol agents) requires high initial investment, and the enthusiasm for control is limited by market price fluctuations, further exacerbating the difficulty of control. Therefore, tea root rot is currently one of the most difficult crop diseases to control in production. The pathogenic mechanism of this type of pathogen is not yet clear, and effective control measures and technologies for this disease have not been established in production. Summary of the Invention

[0004] The purpose of this invention is to address the problems of poor efficacy and high environmental risks associated with the use of chemical fertilizers and pesticides in tea cultivation, and to provide a microbial composition and its application for preventing and controlling root rot in tea trees. The microbial composition provided by this invention can significantly increase soil water stability aggregates, pH, and cation exchange capacity, improve crop root vitality and the activity of antioxidant enzymes [superoxide dismutase (SOD) and peroxidase (POD)], thereby reducing the risk of root rot caused by Fusarium rot (…). Fusarium solani ), Pythium ( Pythium spinosum ) and teosinte ( Rosellinia arcuataThe disease index of tea tree root rot caused by infection has a good control effect on tea tree root rot.

[0005] To achieve the above objectives, the first aspect of the present invention provides a microbial composition comprising the following components: Component 1: Bacillus jirovecii with accession number CCTCC NO: M20221660 ( Bacillus cabrialesii Trichoderma yunnanensis with accession number CCTCC NO: M2025645 (N4471) Trichoderma yunnanensis YNK-FG0001;

[0006] Component 2: Humic acid, garland chrysanthemum extract, amino acids, brown algae oligosaccharides, complex vitamins and trace elements.

[0007] Furthermore, the amount of Bacillus jirovecii N4471 used in the composition is such that the content of Bacillus jirovecii N4471 in the composition is 2 × 10⁻⁶. 10 -3×10 10 cfu / g; the amount of *Trichoderma yunnanensis* YNK-FG0001 in the composition is such that the content of *Trichoderma yunnanensis* YNK-FG0001 in the composition is 2 × 10⁻⁶. 9 -3×10 9 cfu / g.

[0008] Furthermore, the weight ratio of humic acid, garland chrysanthemum extract, amino acids, fucoidan oligosaccharides, complex vitamins, and trace elements is 50-75:10-20:7-12:4-10:1-2:3-6; the complex vitamins include vitamin C, vitamin B1, vitamin D, vitamin E, and vitamin K, with a weight ratio of 20-60:10-20:10-20:10-20:10-20; the trace elements include ZnSO4·7H2O, H3BO3, FeSO4·7H2O, CuSO4·5H2O, MnSO4·H2O, and (NH4)6Mo7O. 24 ·4H2O, with a weight ratio of 25-54:20-30:20-30:20-30:2-5:2-5.

[0009] Furthermore, the total amount of the composition of Bacillus jirovecii N4471 and Trichoderma yunnanensis YNK-FG0001 is 3%-5% of the total weight of component 2.

[0010] Furthermore, the humic acid contains 5.0-10.0% by weight of water, and on a dry matter basis, 30.0-40.0% by weight of fulvic acid, 10.0-15.0% by weight of palmitic acid, and 50.0-60.0% by weight of black humic acid; and / or, the garland chrysanthemum extract contains 5.0-10.0% by weight of water, and on a dry matter basis, 0.1-0.5% by weight of flavonoids, 1.0-2.0% by weight of polyphenols, 2.0-3.0% by weight of amino acids, 2.0-5.0% by weight of cellulose, 4.0-7.0% by weight of organic acids, and 80.0-90.0% by weight of polysaccharides.

[0011] A second aspect of the present invention provides the application of the above-mentioned microbial composition in improving soil water stability macroaggregates, and / or, increasing soil pH and cation exchange capacity, and / or, improving crop root vigor and antioxidant enzyme [superoxide dismutase (SOD) and peroxidase (POD)] activity, and / or, preventing crop root rot.

[0012] Furthermore, the crop is selected from tea trees, and the root rot disease is selected from Fusarium solani (tea tree bark rot fungus). Fusarium solani Root rot, Pythium ( Pythium spinosum Root rot and cladomycetes ( Rosellinia arcuata At least one of the following root rot diseases; wherein the pathogen causing the tea tree root rot disease is Fusarium solani (…). Fusarium solani ), Pythium ( Pythium spinosum ) and teosinte ( Rosellinia arcuata ).

[0013] The third aspect of the present invention provides a method for improving soil water stability by creating large aggregates, and / or improving soil pH and cation exchange capacity, and / or improving crop root vigor and antioxidant enzyme [superoxide dismutase (SOD) and peroxidase (POD)] activity, and / or preventing crop root rot, wherein the composition is applied to the crop rhizosphere soil at a dosage of 2000-3000 g / plant / application, and is applied 3 times throughout the entire growth period.

[0014] Through the above technical solution, the present invention can achieve at least the following beneficial effects:

[0015] (1) The composition provided by the present invention exhibits multi-dimensional beneficial effects in improving soil pH and cation exchange capacity (CEC) through the synergistic effect of its metabolic activity and soil microecology.

[0016] In terms of increasing soil pH, the microbial composition regulates the acidic soil environment through multiple pathways: one is by directly neutralizing excess hydrogen ions (H+) in the soil. + ) and aluminum ions (Al 3+Firstly, it can alleviate soil acidification; secondly, it can dissolve insoluble minerals in the soil, releasing alkaline cations such as calcium and magnesium. These cations can react with H+ adsorbed on the surface of soil colloids. + Al 3+ The replacement process further raises the soil pH to a level suitable for tea trees, while reducing the reproductive activity of pathogens under acidic conditions. This optimizes the soil's physical and chemical properties and lays the foundation for tea tree growth and disease resistance.

[0017] In improving soil cation exchange capacity (CEC), the core role of microbial compositions is to enhance the nutrient adsorption capacity of soil colloids: on the one hand, accelerating the decomposition and transformation of plant and animal remains and root exudates in the soil promotes humus formation, which can significantly increase the total amount of soil colloids and adsorption sites; on the other hand, the polysaccharides, polypeptides, and other viscous substances produced by the microorganisms themselves can combine with soil inorganic colloids (such as clay particles) to form complex colloids, further expanding the specific surface area of ​​the colloids and enhancing their adsorption capacity for nitrogen (NH4+). + ), phosphorus (H2PO4) - ), potassium (K) + It enhances the adsorption and retention capacity of cationic nutrients such as calcium and magnesium, reducing nutrient loss with rainwater. Furthermore, increased CEC not only provides a continuous and stable nutrient supply to crop roots but also improves root aeration by optimizing soil structure (reducing compaction), indirectly enhancing crop resistance to root rot (healthy roots are less susceptible to pathogen infection).

[0018] (2) The microbial composition provided by the present invention plays a key role in enhancing the vitality of crop roots and the activity of superoxide dismutase (SOD) and peroxidase (POD) by forming a synergistic mechanism of "symbiotic interaction-metabolic regulation-defense activation" with crop roots. It strengthens the growth and metabolism of roots and enhances the antioxidant defense system of crops in response to adverse stress.

[0019] This composition enhances nutrient supply efficiency and provides energy for root metabolism. It converts insoluble nutrients in the soil into readily absorbable forms for crops, while simultaneously secreting various small-molecule organic nutrients to directly provide raw materials for root cell respiration and synthesis, preventing insufficient root metabolic activity due to nutrient deficiency. The functional microorganisms in the composition secrete growth-promoting signaling substances, stimulating root morphology optimization. These functional strains produce auxins (such as indoleacetic acid, IAA) and cytokinins, inducing cell division and elongation in crop root meristems, promoting lateral root germination, increasing root hair numbers, and thickening the taproot. This increased root surface area enhances contact efficiency with soil nutrients and water, further strengthening absorption and forming a positive cycle of growth promotion, absorption, and metabolism. The composition can improve the rhizosphere microenvironment and reduce root damage. Functional microorganisms can also reduce the risk of root diseases by competing for nutrients (inhibiting the reproduction of harmful microorganisms such as root rot pathogens) and secreting antimicrobial substances (such as antimicrobial peptides and chitinases), and reduce the damage of pathogens to root hairs and cortical cells. At the same time, the polysaccharides produced by the strain metabolism can form aggregates with soil particles, optimize the aeration and water retention of the rhizosphere soil, avoid root respiration obstruction or rot caused by hypoxia and water accumulation, and maintain the integrity and metabolic activity of root cells.

[0020] The composition can activate crop defense signaling pathways and induce enzyme gene expression. Microorganisms and their metabolites can act as inducers, recognized by receptors on crop root cell membranes, thereby activating defense signaling pathways, regulating the expression levels of SOD and POD-related genes, promoting the synthesis and accumulation of enzyme proteins, and enhancing enzyme activity at the molecular level. The composition can supplement coenzyme factors essential for enzymatic reactions. SOD activity depends on zinc (Zn). 2+ ), manganese (Mn) 2+ Metal ions such as copper / zinc (Cu / Zn) act as coenzymes, and the activity of POD is also related to that of iron (Fe). 2+ Related to this, the functional bacteria in the microbial composition can dissolve solidified trace elements such as Zn, Mn, and Fe in the soil, converting them into ionic forms that can be absorbed by the roots. This provides sufficient raw materials for the enzymatic reactions of SOD and POD, avoiding the limitation of enzyme activity caused by coenzyme deficiency. The composition can alleviate multiple abiotic stresses and reduce the excessive accumulation of reactive oxygen species (ROS). By inhibiting bacteria and improving soil structure, the composition reduces the damage to crops caused by biotic stress (diseases) and abiotic stress (acidification, waterlogging), reducing ROS production at the source. On the other hand, when crops encounter unavoidable stresses (such as short-term drought, low temperature), the induced and enhanced SOD and POD activities can more efficiently remove excess ROS, prevent cell membrane lipid peroxidation, and maintain the permeability and integrity of root cell membranes.

[0021] Enhanced root vitality provides metabolic energy and raw materials for enzyme protein synthesis, while increased SOD and POD activity protects root cells and maintains their metabolic function by scavenging ROS. Together, these factors promote healthy root growth and nutrient absorption, and significantly improve crop resistance to stresses such as root rot and soil abiotic problems, laying a solid foundation for aboveground growth (shoot emergence and leaf photosynthesis) and crop quality development.

[0022] (3) The occurrence of root rot originates from the colonization, germination and invasion of crop roots by pathogens in the soil. The microbial composition breaks through the limitations of traditional single control methods through a multi-dimensional synergistic mechanism of directly inhibiting pathogens, enhancing crop resistance and optimizing soil micro-ecology. It improves the control effect of crop root rot from the whole chain of source control, process defense and environmental improvement. It not only solves the immediate problem of pathogen infection, but also builds a long-term control system from the physiological and environmental levels, providing key technical support for the green and sustainable control of root rot.

[0023] Biological Preservation

[0024] The Bacillus jirovecii strain used in this invention is classified as Bacillus jirovecii N4471. Bacillus cabrialesii The strain was deposited on October 26, 2022, at the China Center for Type Culture Collection (CCTCC), located at No. 299 Bayi Road, Wuchang District, Wuhan, Hubei Province, China (Wuhan University), with accession number CCTCC No.: M20221660. The preservation information of the strain has been published in the prior invention patent application CN202211742732.9.

[0025] The *Trichoderma yunnanense* strain used in this invention is classified and named as YNK-FG0001. Trichoderma yunnanensis The strain was deposited on March 31, 2025, at the China Center for Type Culture Collection (CCTCC), located at No. 299 Bayi Road, Wuchang District, Wuhan, Hubei Province, China (Wuhan University), with accession number CCTCC No.: M2025645. The preservation information of the strain has been published in the prior invention patent application CN202510757002.3. Detailed Implementation

[0026] The endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0027] In this invention, *Bacillus jirovecii* N4471 and *Bacillus jirovecii* N4471 CCTCC No: 20221660 are the same strain, and they have the same meaning; their names (numbers) can be used interchangeably. Similarly, *Trichoderma yunnanensis* YNK-FG0001 and *Trichoderma yunnanensis* YNK-FG 0001 CCTCC No: M2025645 are the same strain, and they have the same meaning; their names (numbers) can be used interchangeably.

[0028] The inventors of this invention isolated a strain of Bacillus jirovecii during the research process. Bacillus of Cabriales N4471, named N4471, was deposited at the China Center for Type Culture Collection (CCTCC) on November 2, 2022, with accession number CCTCC No: 20221660, along with a strain of *Trichoderma yunnanense*. Trichoderma yunnanensis YNK-FG0001, named YNK-FG0001, was deposited at the China Center for Type Culture Collection (CCTCC) on April 7, 2025, with accession number CCTCC No: M2025645. Studies have found that strains N4471 and YNK-FG0001 possess antibiotic synthesis genes such as srfA, fenB, ituA, ituD, and bymA, which can inhibit mycelial growth and reduce the spore germination rate of pathogenic fungi, exhibiting a strong inhibitory effect on various pathogenic fungi.

[0029] The inventors of this invention also discovered in their research that applying a composition made by mixing humic acid, garland chrysanthemum extract, amino acids, brown algae oligosaccharides, complex vitamins, and trace elements in a certain proportion to the rhizosphere soil of crops can significantly increase soil water-stable macroaggregates, pH, and cation exchange capacity, improve crop root vitality and antioxidant enzyme [superoxide dismutase (SOD) and peroxidase (POD)] activity, and promote the formation of soil microecological conditions conducive to healthy crop growth.

[0030] Further research revealed that when Bacillus kauri N4471 and Trichoderma yunnanensis YNK-FG 0001 are applied alone or in combination with the above-mentioned formulation to the rhizosphere soil of crops, the soil water-stable macroaggregates, pH and cation exchange capacity can be significantly increased, crop root vigor and antioxidant enzyme [superoxide dismutase (SOD) and peroxidase (POD)] activity can be enhanced, and the control effect on crop root rot can be significantly strengthened.

[0031] Based on the above findings, the present invention provides a composition comprising:

[0032] Component 1: Optional Bacillus jirovecii N4471 and Trichoderma yunnanense YNK-FG 0001;

[0033] Component 2: Humic acid, garland chrysanthemum extract, amino acids, brown algae oligosaccharides, complex vitamins and trace elements.

[0034] That is, the composition formulation provided by the present invention is any one of the following:

[0035] (1) Bacillus jirovecii N4471 and Trichoderma yunnanensis YNK-FG0001, humic acid, Chrysanthemum indicum extract, amino acids, brown algae oligosaccharides, complex vitamins and trace elements;

[0036] (2) Humic acid, garland chrysanthemum extract, amino acids, brown algae oligosaccharides, complex vitamins and trace elements.

[0037] The inventors discovered in their research that when the components of the composition are used in a specific weight ratio, the disease control effect is better. Therefore, according to a preferred embodiment of the present invention, the total amount of the Bacillus calcifera N4471 and Trichoderma yunnanense YNK-FG0001 composition, based on the total weight of the composition, is 3-5% by weight of component 2.

[0038] Preferably, the amount of the composition is such that the content of Bacillus jirovecii N4471 in the composition is 2.25 × 10⁻⁶. 10 -3×10 10 cfu / g, preferably 2.50 × 10⁻⁶ 10 -3×10 10 cfu / g, more preferably 2.75×10 10 -3×10 10 cfu / g.

[0039] Preferably, the amount of the composition is such that the content of *Trichoderma yunnanensis* YNK-FG0001 in the composition is 2.25 × 10⁻⁶. 9 -3×10 9 cfu / g, preferably 2.50 × 10⁻⁶ 9 -3×10 9 cfu / g, more preferably 2.75×10 9 -3×10 9 cfu / g.

[0040] According to a preferred embodiment of the present invention, the weight ratio of humic acid, garland chrysanthemum extract, amino acids, fucoidan oligosaccharides, complex vitamins and trace elements in the composition is 50-75:10-20:7-12:4-10:1-2:3-6, preferably 60-75:15-20:9-12:6-10:1.5-2:4-6, and more preferably 70-75:17.50-20:11-12:8-10:1.75-2:5-6.

[0041] According to a preferred embodiment of the present invention, the weight ratio of vitamin C, vitamin B1, vitamin D, vitamin E and vitamin K in the composition is 20-60:10-20:10-20:10-20:10-20, preferably 30-60:13-20:13-20:13-20:13-20, and more preferably 40-60:16-20:16-20:16-20:16-20.

[0042] According to a preferred embodiment of the present invention, the composition contains ZnSO4·7H2O, H3BO3, FeSO4·7H2O, CuSO4·5H2O, MnSO4·H2O, and (NH4)6Mo7O. 24 The weight ratio of 4H2O is 25-54:20-30:20-30:20-30:2-5:2-5, preferably 35-54:23-30:23-30:23-30:3-5:3-5, and more preferably 45-54:26-30:26-30:26-30:4-5:4-5.

[0043] In this invention, there are no particular restrictions on the raw materials used in the above composition (such as humic acid, garland chrysanthemum extract, amino acids, brown algae oligosaccharides, complex vitamins and trace elements). They can be any relevant products in the art that can be used to prepare the composition, either commercially available products or products prepared by the artist according to the prior art.

[0044] The inventors discovered in their research that using specific raw materials resulted in better disease control effects. Therefore, according to a preferred embodiment of the present invention, wherein...

[0045] The humic acid contains 5.0-10.0% by weight of water, preferably 6.0-10.0% by weight, and more preferably 8.0-10.0% by weight. On a dry matter basis, the fulvic acid content is 30.0-40.0% by weight, preferably 33.0-40.0% by weight, and more preferably 36.0-40.0% by weight; the palmitic acid content is 10.0-15.0% by weight, preferably 12.0-15.0% by weight, and more preferably 14.0-15.0% by weight; and the black humic acid content is 50.0-60.0% by weight, preferably 53.0-60.0% by weight, and more preferably 56.0-60.0% by weight.

[0046] The garland chrysanthemum extract contains 5.0-10.0% by weight of water, preferably 7.0-10.0% by weight, and more preferably 9.0-10.0% by weight. On a dry matter basis, the flavonoid content is 0.1-0.5 wt%, preferably 0.2-0.5 wt%, more preferably 0.4-0.5 wt%; the polyphenol content is 1.0-2.0 wt%, preferably 1.3-2.0 wt%, more preferably 1.6-2.0 wt%; the amino acid content is 2.0-3.0 wt%, preferably 2.3-3.0 wt%, more preferably 2.6-3.0 wt%; the cellulose content is 2.0-5.0 wt%, preferably 3.0-5.0 wt%, more preferably 4.0-5.0 wt%; the organic acid content is 4.0-7.0 wt%, preferably 5.0-7.0 wt%, more preferably 6.0-7.0 wt%; and the polysaccharide content is 80.0-90.0 wt%, preferably 83.0-90.0 wt%, more preferably 86.0-90.0 wt%.

[0047] The present invention further provides a method for preparing the above-mentioned composition. According to a preferred embodiment of the present invention, the method includes uniformly mixing the aforementioned vitamin C, vitamin B1, vitamin D, vitamin E and vitamin K in a specified ratio to obtain a complex vitamin; and mixing the aforementioned ZnSO4·7H2O, H3BO3, FeSO4·7H2O, CuSO4·5H2O, MnSO4·H2O and (NH4)6Mo7O... 24 • After uniformly mixing with 4H2O as specified, trace elements are obtained. Humic acid, garland chrysanthemum extract, amino acids, fucoidan oligosaccharides, complex vitamins, and trace elements are further uniformly mixed to obtain a basic composition. Finally, Bacillus carinii N4471 and Trichoderma yunnanensis YNK-FG0001 raw materials, optionally added to the basic composition according to the aforementioned proportions, are mixed evenly to obtain the microbial composition.

[0048] In this invention, there are no particular limitations on the specific storage and use forms of the composition. Since the raw materials used in the composition are primarily solid, and the preparation method involves simply mixing the components in proportion, the composition can be stored or used directly as a solid formulation. Considering the differences in crops, planting methods, and planting conditions, the composition can also be mixed with a certain amount of water to prepare a liquid or slurry (suspension) formulation for storage or use.

[0049] The second aspect of this invention provides the application of Bacillus jirovecii N4471 and Trichoderma yunnanensis YNK-FG0001, or the composition described in the first aspect, in improving soil water stability macroaggregates, and / or, improving soil pH and cation exchange capacity, and / or, improving crop root vigor and antioxidant enzyme [superoxide dismutase (SOD) and peroxidase (POD)] activity, and / or, in preventing crop root rot.

[0050] According to a preferred embodiment of the present invention, the crop is a tea tree.

[0051] In this invention, crop disease prevention and control refers to preventing or reducing the occurrence of crop diseases, or reducing the losses caused by diseases after they occur.

[0052] Preferably, the crop disease is selected from root rot, and more preferably tea tree root rot.

[0053] According to some preferred embodiments of the present invention, the pathogen causing the tea tree root rot is Fusarium solani (…). Fusarium solani ), Pythium ( Pythium spinosum ) and teosinte ( Rosellinia arcuata ).

[0054] The third aspect of the present invention provides a method for preparing a microbial composition for preventing and controlling crop root rot and its application, the method comprising applying the composition described in the first aspect to the rhizosphere soil of crops.

[0055] In other words, the above methods can include the following approaches:

[0056] (1) Apply Bacillus kauri N4471 and / or Trichoderma yunnanensis YNK-FG0001 directly to the rhizosphere soil of crops (usually by applying the solid composition directly to the rhizosphere soil of crops, or by culturing Bacillus kauri N4471 and / or Trichoderma yunnanensis YNK-FG0001 and then applying the culture to the soil).

[0057] (2) Apply the composition that does not contain Bacillus jirovecii N4471 and / or Trichoderma yunnanensis YNK-FG0001 to the rhizosphere soil of crops;

[0058] (3) Apply a microbial composition containing Bacillus jirovecii N4471 and / or Trichoderma yunnanensis YNK-FG0001 to the rhizosphere soil of crops.

[0059] In this invention, the crop is a tea tree.

[0060] Preferably, the pathogen causing the root rot of the tea tree is Fusarium solani (…). Fusarium solani ), Pythium ( Pythium spinosum ) and teosinte ( Rosellinia arcuata ).

[0061] The specific characteristics of Bacillus jirovecii N4471 and / or Trichoderma yunnanensis YNK-FG0001 used in the method provided by this invention and the composition are as described above and will not be repeated here.

[0062] In this invention, there are no particular restrictions on the specific amounts of Bacillus jirovecii N4471 and / or Trichoderma yunnanensis YNK-FG0001 and the composition, as long as they can play a role in preventing and controlling root rot.

[0063] According to a preferred embodiment of the present invention, in the above-described method (1), the amount of Bacillus jirovecii N4471 used is such that the content of Bacillus jirovecii N4471 in the composition is 2 × 10⁻⁶. 10 -3×10 10 The amount of *Trichoderma yunnanensis* YNK-FG0001 used in the composition is such that the content of *Trichoderma yunnanensis* YNK-FG0001 in the composition is 2 × 10⁻⁶ cfu / g. 9 -3×10 9 cfu / g. The amount of Bacillus jirovecii N4471 and / or Trichoderma yunnanensis YNK-FG0001 is calculated based on the amount of the composition applied and the quantity of Bacillus jirovecii N4471 and / or Trichoderma yunnanensis YNK-FG0001 contained therein, wherein the liquid composition is converted to 1 g / mL.

[0064] The inventors of this invention also discovered in their research that when planting different crops, the dosage of the aforementioned Bacillus kaempferi N4471 and / or Trichoderma yunnanensis YNK-FG0001 or their combination can be adjusted accordingly to further improve the crop's systemic resistance and disease prevention effect.

[0065] According to some preferred embodiments of the present invention, wherein, for the above-described method (1):

[0066] When applied to the rhizosphere soil of crops, the total amount of Bacillus jirovecii N4471 and / or Trichoderma yunnanensis YNK-FG0001 shall not be less than 30g to 100g per plant per application, preferably 50g to 100g per plant per application, and more preferably 70g to 100g per plant per application.

[0067] The composition provided by the present invention has a synergistic effect when used together with Bacillus jirovecii N4471 and / or Trichoderma yunnanensis YNK-FG0001. Therefore, in order to obtain better results when using the above method (1), the amount of Bacillus jirovecii N4471 and / or Trichoderma yunnanensis YNK-FG0001 can be appropriately increased compared with the amount of Bacillus jirovecii N4471 and / or Trichoderma yunnanensis YNK-FG0001 applied with the composition in method (3).

[0068] Preferably, for the above method (2):

[0069] When applied to the rhizosphere soil of crops, the amount of the composition that does not contain Bacillus jirovecii N4471 and / or Trichoderma yunnanensis YNK-FG0001 shall not be less than 1000 g / plant / application, preferably 1500 g / plant / application, and more preferably 2000 g / plant / application.

[0070] According to some preferred embodiments of the present invention, in the above methods (2) and (3), the composition is applied to the crop planting soil at a dosage of 1000-2000 g / plant / application. For example, it can be 1000 g / plant / application, 1200 g / plant / application, 1400 g / plant / application, 1600 g / plant / application, 1800 g / plant / application, 2000 g / plant / application, or any intermediate value between any two of the above values.

[0071] The present invention will be described in detail below through embodiments. It should be understood that the following embodiments are only used to further explain and illustrate the present invention, and are not intended to limit the present invention. Example

[0072] In this embodiment, the humic acid was purchased from Kunming Nanrui Bioengineering Co., Ltd., the garland chrysanthemum extract was purchased from Fufeng Sinote Biotechnology Co., Ltd., the amino acids were purchased from Shandong Ruizhaoyuan Biotechnology Co., Ltd., the fucoidan was purchased from Guangzhou Zhenwei Microbial Technology Co., Ltd., vitamin C, vitamin B1, vitamin D, vitamin E and vitamin K were purchased from Shijiazhuang Jinmuwei Biotechnology Co., Ltd., ZnSO4·7H2O was purchased from Shandong Xinheng Chemical Co., Ltd., H3BO3 was purchased from Kunming Nengzhen Trading Co., Ltd., FeSO4·7H2O was purchased from Yunnan Yinglei Chemical Co., Ltd., CuSO4·5H2O was purchased from Kunming Yangpu Sanyi Mineralization Plant, MnSO4·H2O was purchased from Kunming Xinbaoxin Chemical Co., Ltd., and (NH4)6Mo7O was purchased from Kunming Xinbaoxin Chemical Co., Ltd. 24·4H2O was purchased from Kunming Nengzhen Trading Co., Ltd. The composition is a solid microbial agent obtained by drying the liquid culture medium obtained from the propagation of Bacillus jirovecii N4471 (see CN202211742732.9 for acquisition method) and Trichoderma yunnanense YNK-FG0001 (see CN202510757002.3 for acquisition method). The effective viable count of the Bacillus jirovecii N4471 solid microbial agent is 2.4 × 10⁻⁶. 10 The effective viable count of *Trichoderma yunnanense* YNK-FG0001 solid inoculum is 2.6 × 10⁻⁶ cfu / g. 9 cfu / g.

[0073] In this embodiment, the types of multivitamins include S1-S3:

[0074] S1: The multivitamin contains vitamin C, vitamin B1, vitamin D, vitamin E and vitamin K in a weight ratio of 20:10:10:10:10;

[0075] S2: The multivitamin includes vitamin C, vitamin B1, vitamin D, vitamin E and vitamin K, in a weight ratio of 40:15:15:15:15;

[0076] S3: The multivitamin includes vitamin C, vitamin B1, vitamin D, vitamin E and vitamin K in a weight ratio of 60:20:20:20:20.

[0077] In this embodiment, the trace elements include F1-F3:

[0078] F1: Trace elements include ZnSO4·7H2O, H3BO3, FeSO4·7H2O, CuSO4·5H2O, MnSO4·H2O, and (NH4)6Mo7O. 24 ·4H2O, with a weight ratio of 39:25:25:25:3:3;

[0079] F2: Trace elements include ZnSO4·7H2O, H3BO3, FeSO4·7H2O, CuSO4·5H2O, MnSO4·H2O, and (NH4)6Mo7O. 24 ·4H2O, with a weight ratio of 25:20:20:20:2:2;

[0080] F3: Trace elements include ZnSO4·7H2O, H3BO3, FeSO4·7H2O, CuSO4·5H2O, MnSO4·H2O, and (NH4)6Mo7O. 24 ·4H2O, with a weight ratio of 54:30:30:30:5:5.

[0081] Table 1 shows the test results of the raw material components used in the preparation of the base composition. The contents of fulvic acid, brown humic acid and black humic acid were determined by potassium dichromate oxidation-external heating method; the contents of flavonoids and polyphenols were determined by high performance liquid chromatography (HPLC); the contents of amino acids were determined by ninhydrin colorimetric method; the contents of cellulose were determined by anthrone colorimetric method; the contents of organic acids were determined by acid-base titration method; the contents of polysaccharides were determined by anthrone-sulfuric acid method; the contents of zinc (Zn) and copper (Cu) were determined by titration method; the contents of boron (B) and manganese (Mn) were determined by atomic absorption spectrometry; the contents of iron (Fe) were determined by spectrophotometry; and the contents of molybdenum (Mo) were determined by colorimetric method.

[0082] Table 1 Material Composition of Basic Composition

[0083]

[0084] Prepare the microbial composition according to the formula in Table 2. The specific preparation method includes: weighing the raw materials according to the proportions in Table 2, mixing them evenly to obtain the microbial composition (solid preparation). The weight % of component 1 in Table 2 refers to the percentage of each component in component 1 to the total weight of component 2.

[0085] Table 2 Microbial Composition Formulation

[0086]

[0087] Note: In the table, 2 (S3) represents adding 2kg of compound vitamin S3, 6 (F3) represents adding 6kg of micronutrient F3, and so on.

[0088] According to a preferred embodiment of the present invention, the application frequency of the composition of Bacillus jirovecii N4471 and Trichoderma yunnanensis YNK-FG0001 is 1-3 times per growing season.

[0089] To achieve better disease prevention, according to some preferred embodiments of the present invention, when the Bacillus jirovecii N4471 and Trichoderma yunnanensis YNK-FG0001 composition is applied to tea trees, it is applied once every 10-15 days, starting from the beginning of May, for a total of 3 applications.

[0090] According to the formulation of the microbial composition in Table 2, the application rate was 2000-3000 g / plant / application (30 plants per experimental group, 3 replicates). The control effect on various diseases was investigated 3 months after application, and the rhizosphere soil water-stable macroaggregates, pH and cation exchange capacity, root activity and antioxidant enzyme [superoxide dismutase (SOD) and peroxidase (POD)] activities were measured.

[0091] Tea tree Fusarium root rot survey and grading standards:

[0092] Grade 0, healthy roots, no disease symptoms;

[0093] Grade 1: Minor root damage, with a small number of lesions visible (0-10%);

[0094] Grade 2, with some degree of lesions on the roots (11%–25%);

[0095] Level 3, moderate damage, with root lesions spreading (26%–50%);

[0096] Level 4, severe damage, with most of the roots infected and only a very small amount of uninfected tissue (51%–75%).

[0097] Level 5, very serious, the roots are completely infected, and the plant may even die (76% to 100%).

[0098] Tea tree Pythium root rot disease survey and grading standards:

[0099] Grade 0: No disease spots on the roots.

[0100] Grade 1: There are lesions on the roots, and the lesion area accounts for less than 1 / 4 of the total root area.

[0101] Grade 2: The area of ​​lesions on the roots accounts for about 1 / 4 to 1 / 2 of the total root area.

[0102] Grade 3: Disease spots cover more than 1 / 2 of the root area.

[0103] Level 4: The lesions on the roots are confluent and have formed a circling effect around the stem, but the root system is not necrotic.

[0104] Level 5: Above-ground parts wither or die.

[0105] Tea tree root rot caused by *Tea sclerotium* is classified according to the following standards:

[0106] Grade 0, healthy roots, no disease symptoms;

[0107] Grade 1: Minor root damage, with lesions covering less than 10% of the total root area;

[0108] Grade 2, with some degree of lesions on the roots (11%–25%);

[0109] Level 3, moderate damage, with root lesions spreading (26%–50%);

[0110] Level 4, severe damage, with most of the roots infected and only a very small amount of uninfected tissue (51%–75%).

[0111] Level 5, very serious, the roots are completely infected, and the plant may even die (76% to 100%).

[0112] Disease identification:

[0113] Collected separately from Fusarium solani ( Fusarium solani ), Pythium ( Pythium spinosum ) and teosinte ( Rosellinia arcuata Samples of typical root rot disease in tea trees caused by infection were analyzed. The pathogen was isolated and purified using tissue isolation methods to obtain pure cultures. These pure cultures were then inoculated according to Koch's postulates to verify pathogenicity. The pathogen was then isolated again from diseased tissues, yielding pure cultures identical to the original inoculum. These verifications demonstrated the pathogenicity of the isolated bacteria to tea trees. Based on morphological identification of the isolated bacteria, molecular identification using ITS was further performed to ultimately determine the taxonomic position of the pure cultures.

[0114] Fusarium solani ( Fusarium solani )ITS sequence (SEQ ID NO.1): tgaacatacc taaaacgttgcttcggcggg aacagacggc cctgtaacaa cgggccgccc ccgccagagg acccctaactctgtttttataatgtttttc tgagtaaaca agcaaataaa ttaaaacttt caacaacgga tctcttggct ctggcatcgatgaagaacgc agcgaaatgc gataagtaat gtgaattgca gaattcagtg aatcatcgaatctttgaacgcacattgcgc ccgccagtat tctggcgggc atgcctgttc gagcgtcatt acaaccctca ggcccccgggcctggcgttg gggatcggca gaagccccct gtgggcacac gccgtccctc aaatacagtggcggtcccgccgcagcttcc attgcgtagt agctaacacc tcgcaactgg agagcggcgc ggccatgccg taaaacacccaacttctgaa tg.

[0115] Pythium ( Pythium spinosum) ITS sequence (SEQ ID NO.2):ccacacctaa aaaactttccacgtgaactg tcattatttg ttgtgtgtct gcgcgttgtt gacgtgcatt tgcttacgctttggtgtttgtgagtgcgtg ttggcagtgt gcggactgaa cgaaggttgt gtgttgttat gtgcctgctgcactgctgactttgcattca tttgtatggt cttggcggag tggcgggtac tgtgcatgcg cagctgactt attttttcaaaccccatacc taaatgactg attatactgt gagaacgaaa gttcttgctttaaactagat aacaactttcagcagtggat gtctaggctc gcacatcgat gaagaacgct gcgaactgcg atacgtaatg cgaattgcagaattcagtga gtcatcgaaa ttttgaacgc atattgcact tccgggttatacctggaagt atgtctgtatcagtgtccgt aaatcaaact tggctttctt ccttccgtgt agtcggtgga ggagagttgc agatgtgaagtgtctcgcta tggttggcgt ttgtaatgaa tgcacagctt gcgagtccttttaaatggac acgactttctcttttttgta tctgcgtggt gctgtgtatg aacgcggtgg ttttcggatc gctcgcggct gtcggcgacttcggtgaatg cattatggag tgaacctcga ttcgcggtat gttgggcttcggctggacaa tgttgcttattgtgtgtttg ttccgtgttc accttgaggt gtactggtag ttgtgggatt gaactggtta ctgttgttagtagtgtgtag tgcgttgtcg tggatgcatc tgtcttttgt gcacttttgtgtgtgcagtt gatagaagaggagtttgaat ttgggaaatt agtgtactgt gggttaatcc tgcgtgtata tctcaa。.

[0116] Cassia tora ( Rosellinia arcuata )ITS sequence (SEQ ID NO.3): agggatcattaaagagttct ataactccca aaacccatgt gaacatacca cgcgttgcct cggcaggtcgcgtcctaccccgaagtgccc taccctgtta gggcctaccc ggtgggcgcg ggccaacctg ccggcggcccacgaaactct gtttagcatt gaattctgaa cacataacta aataagttaa aactttcaac aacggatctcttggttctggcatcgatgaa gaacgcagcg aaatgcgata agtaatgtga attgcagaat tcagtgaatcatcgaatctt tgaacgcaca ttgcgcccat tagtattcta gtgggcatgc ctgttcgagc gtcatttcaacccttaagcccctgttgctt agtgttgggg gcctgcagcg cctgctgcag cccctcgaag tcagtggcggagtcggtcac acactctaga cgtagtagat ttctcatctc gcctatggtt gtgccggtcc cctgccgtaaaacacccccctataccaaag gt.

[0117] The following two formulas are used to calculate the prevention and control effect:

[0118] Disease index = [(Σ(number of disease-grade plants × representative grade)) / (total number of plants × highest representative grade value)] × 100

[0119] Prevention and control efficacy (%) = [(Disease index of control group - Disease index of treatment group) / Disease index of control group] × 100%

[0120] Soil water-stable macroaggregates were determined using the dry sieving method; soil pH was determined using the potentiometry method; cation exchange capacity was determined using the ammonium acetate displacement method; root activity was determined using the TTC (2,3,5-triphenyltetrazolium chloride) reduction method; and root superoxide dismutase (SOD) and peroxidase (POD) were determined using kits purchased from Suzhou Greens Biotechnology Co., Ltd., with usage instructions following the manufacturer's manual.

[0121] As can be seen from the data in Tables 3, 4 and 5, the application of the microbial composition provided by this invention has a significantly higher effect on the control of root rot than the control; the improvement in soil water stability aggregates, pH and cation exchange capacity is also stronger than the control; in addition, the application of the microbial composition provided by this invention significantly improves the root vigor and antioxidant enzyme [superoxide dismutase (SOD) and peroxidase (POD)] activity of tea trees, thereby achieving the purpose of controlling root rot.

[0122] Table 3. Test conditions and results of the experiment on the control effect of microbial compositions on tea root rot.

[0123]

[0124] *The control group is a blank control group that does not receive any composition.

[0125] Table 4. Test conditions and results of microbial compositions on the physicochemical properties of tea tree soil.

[0126]

[0127] *The control group is a blank control group that does not receive any composition.

[0128] Table 5. Test conditions and results of the effects of microbial compositions on tea tree root vigor and antioxidant enzyme activity.

[0129]

[0130] *The control group is a blank control group that does not receive any composition.

[0131] Finally, it should be noted that the above preferred embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail through the above preferred embodiments, those skilled in the art should understand that various changes can be made to it in form and detail without departing from the scope defined by the claims of the present invention.

Claims

1. A microbial composition for controlling root rot of tea plants, characterized by: The composition comprises the following components: Component 1: Bacillus kayserensis (CCTCC NO: M20221660) Bacillus cabrialesii ) N4471, Trichoderma yunnanense (CCTCC NO: M2025645) Trichoderma yunnanense ) YNK-FG0001; Component 2: humic acid, garden nasturtium extract, amino acid, brown algae oligosaccharide, compound vitamin and microelement.

2. The microbial composition for controlling root rot of tea according to claim 1, characterized in that: the composition is 2 x 10 10 - 3 x 10 10 cfu / g; the Bacillus megaterium N 4471 is used in the composition in an amount such that the content of Bacillus megaterium N 4471 in the composition is 2 x 10 9 - 3 x 10 9 cfu / g.

3. The microbial composition for controlling root rot of tea according to claim 1, characterized in that: In component 2, the weight ratio of humic acid, garden balsam extract, amino acid, phlorotannin, compound vitamin and medium trace element is 50-75:10-20:7-12:4-10:1-2:3-6; the compound vitamin includes vitamin C, vitamin B1, vitamin D, vitamin E and vitamin K, and the weight ratio is 20-60:10-20:10-20:10-20:10-20; the medium trace element includes ZnSO4·7H2O, H3BO3, FeSO4·7H2O, CuSO4·5H2O, MnSO4·H2O, (NH4)6Mo7O 24 ·4H2O, and the weight ratio is 25-54:20-30:20-30:20-30:2-5.

4. The microbial composition for controlling root rot of tea according to claim 1, characterized in that: The total amount of the Bacillus cabrialesii N4471 and Trichoderma yunnanense YNK-FG0001 composition is 3wt%-5wt% of component 2.

5. The microbial composition for controlling root rot of tea according to any one of claims 1 to 4, characterized in that: In the humic acid, the water content is 5.0-10.0wt%, the fulvic acid content is 30.0-40.0wt%, the humin content is 10.0-15.0wt%, and the melanin content is 50.0-60.0wt%; and / or, in the garden nasturtium extract, the water content is 5.0-10.0wt%, the flavonoid content is 0.1-0.5wt%, the polyphenol compound content is 1.0-2.0wt%, the amino acid content is 2.0-3.0wt%, the cellulose content is 2.0-5.0wt%, the organic acid content is 4.0-7.0wt%, and the polysaccharide content is 80.0-90.0wt%.

6. The microbial composition according to any one of claims 1-4 for use in the prevention and treatment of crop root rot.

7. Use according to claim 6, characterized in that: The crop is tea and the root rot disease is at least one of Pythium sylvesterianum (Dasture) Fitzpatrick Fusarium solani ), Pythium aphanidermatum (Edson) Fitzpatrick Pythium spinosum ) and Aspergillus nomius (Thaxt.) Samson Rosellinia arcuata ).

8. A method of controlling root rot of crops, characterized by, The method comprises applying the composition according to any one of claims 1-4 to the rhizosphere soil of the crop, and the amount of the composition applied to the rhizosphere soil of the crop is 2000-3000g / plant / time, and the application frequency is 3 times during the whole growth period.

Citation Information

Patent Citations

  • Bacillus caramelii, liquid agricultural biological agent and application of liquid agricultural biological agent

    CN116254197A

  • Trichoderma yunnanense and application thereof

    CN120249080A

  • Bio-organic fertilizer for preventing and treating root and stem diseases of horseradish and application of bio-organic fertilizer

    CN120349208A

  • MICROORGANISM-BASED PRODUCTS FOR STRENGTHENING PLANT ROOTS AND HEALTHY IMMUNITY

    EA202092555A1