Ptnf-yb15 gene and application thereof in genetic improvement of plant drought resistance

By cloning the trifoliate orange transcription factor PtNF-YB15 gene and reducing its expression, the problem of insufficient drought resistance in citrus was solved, significantly improving the plant's drought resistance and photosynthetic intensity, and promoting the development of green agriculture.

CN121086044BActive Publication Date: 2026-06-19INST OF FRUIT & TEA HUBEI ACAD OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511280819.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-09-09
Publication Date
2026-06-19
Estimated Expiration
2045-09-09

Smart Images

  • Figure CN121086044B_ABST
    Figure CN121086044B_ABST
Patent Text Reader

Abstract

This invention belongs to the field of plant genetic engineering and discloses the trifoliate orange transcription factor. PtNF-YB15 Genes and their application in the genetic improvement of drought resistance in plants. PtNF-YB15 Genes are derived from trifoliate orange ( Poncirus trifoliata The transcription factor gene isolated and cloned from [the organism] is shown in SEQ ID NO.1. An interference vector was constructed using this gene sequence, and it was then transformed into trifoliate orange using virus-induced gene silencing transformation technology. Biological function verification was performed on the obtained transgenic plants, demonstrating that the transcription factor cloned in this invention [is effective]. PtNF- YB15 The gene has the function of reducing plant drought resistance. The development and utilization of this genetic resource is conducive to reducing agricultural production costs and achieving the goal of green and environmentally friendly agriculture.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering, specifically relating to the PtNF-YB15 gene of trifoliate orange and its application in the genetic improvement of drought resistance in plants. The applicant isolated and cloned a drought-negative regulatory gene from trifoliate orange (Poncirus trifoliata). After interfering with this gene in trifoliate orange peel, the resulting transgenic plants showed significantly enhanced drought resistance, proving that this gene plays an important role in drought resistance in citrus. Background Technology

[0002] Plants inevitably face various extreme environments throughout their lives, with drought being one of the most severe stresses. Therefore, utilizing breeding techniques to enhance the drought resistance of citrus can minimize the losses caused by drought to the citrus industry, thereby promoting its sustainable development. However, due to the limited drought-resistant citrus resources in my country and the fact that most varieties have polyembryonic characteristics, sexual hybridization alone is insufficient to improve citrus drought resistance. Therefore, studying the molecular mechanisms and regulatory networks of drought response and identifying and characterizing important stress-resistance genes are crucial prerequisites for conducting genetic improvement of citrus stress resistance through genetic engineering.

[0003] Plants integrate and process various external stress signals through complex regulatory networks and coordinate the transcriptional levels of a series of genes. These network regulations play a crucial role in plant growth and adaptation to adversity. Transcription factors can play a pivotal role in regulating a large number of genes responding to abiotic stresses. Therefore, studying key transcriptional regulators and regulatory networks in stress responses is essential for elucidating plant stress response mechanisms and improving plant resilience.

[0004] NF-Y (nuclear factor Y) is a conserved transcription factor in eukaryotes, also known as HAP (heme activator protein) or CBF (CCAAT binding factor). It is a heterotrimer composed of three subunits: NF-YA (HAP2), NF-YB (HAP3), and NF-YC (HAP5). It regulates gene expression by recognizing the CCAAT-box of target gene promoters. NF-YB, as one subunit, plays an important role throughout the plant life cycle, such as in embryonic development, seed formation, and flowering time regulation, as well as responses to drought, salt stress, heat stress, and disease. In Arabidopsis thaliana, AtNF-YB9 (LEC1) is a key regulator of embryonic development, regulating seed lipid synthesis; in rice, OsNF-YB11 delays flowering by inhibiting flowering gene expression, while OsNF-YB2 / 3 promotes flowering. AtNF-YB2 / 3-YC3 / 4 / 9 interacts with CO to activate FT genes. Tomato SlNF-YB8a / 8b / 8c affects pericarp color by regulating SlCHS1 expression. Overexpression of wheat TaNF-YB3 or maize ZmNF-YB16 significantly enhances plant drought resistance. Poplar PdNF-YB21 enhances root drought resistance by promoting IAA transport. Soybean GmNF-YB1 improves drought tolerance through the ABA signaling pathway. AtNF-YC10 forms a complex with NF-YA2 / B3 in response to heat shock. NF-YB usually forms a heterodimer with NF-YC in the cytoplasm, then transports into the nucleus and binds to NF-YA to form a trimer, recognizing the promoter CCAAT-box, or interacting with other factors (such as bZIP28, CO, DELLA) to form a complex. Therefore, plant NF-YB can integrate plant development and stress signals through a multidimensional regulatory network, making it a potential target for genetic improvement of crop stress resistance and yield. Summary of the Invention

[0005] The purpose of this invention is to provide a trifoliate orange transcription factor PtNF-YB15, wherein the protein encoded by the trifoliate orange transcription factor PtNF-YB15 is shown in SEQ ID NO.2.

[0006] Another objective of this invention is to provide the application of the trifoliate orange transcription factor PtNF-YB15 in controlling drought resistance traits in plants. Knocking out or suppressing this gene or its homologs in plants significantly enhances the drought resistance of the plants.

[0007] To achieve the above objectives, the present invention adopts the following technical measures.

[0008] The applicant identified and cloned a novel gene, PtNF-YB15, from *Citrus trifoliata* using plant gene cloning technology. Its sequence is shown in SEQ ID NO. 1, and the protein it encodes is shown in SEQ ID NO. 2. This gene is 2022 bp in length, encoding 673 amino acids, and its sequence is shown in SEQ ID NO. 2. The gene encoding this protein is shown in SEQ ID NO. 1. Molecular weight prediction shows that the protein has a molecular weight of 73.97 kDa and an isoelectric point (pI) of 5.56.

[0009] The applicant constructed a PtNF-YB15 silent line and analyzed the drought resistance phenotype and related physiological indicators of PtNF-YB15 transgenic plants before and after drought treatment. The results showed that compared to the untreated plants, the PtNF-YB15 interference line exhibited increased drought resistance, improved photosynthetic intensity, and lower electrical conductivity and MDA content. This indicates that PtNF-YB15 is a potential breeding gene that negatively regulates drought resistance in trifoliate orange.

[0010] The scope of protection of this invention also includes:

[0011] The application of PtNF-YB15 in regulating drought resistance in trifoliate orange, wherein the protein encoded by the gene PtNF-YB15 is shown in SEQ ID NO.2.

[0012] The applications described above, specifically:

[0013] Application of knocking out or inhibiting the expression of the PtNF-YB15 gene in improving the drought resistance of trifoliate orange;

[0014] The application described above involves introducing a substance that reduces or eliminates the expression of the PtNF-YB15 gene in trifoliate orange into the trifoliate orange. The substance is an expression cassette, recombinant vector, or recombinant microorganism that reduces the expression of the PtNF-YB15 gene.

[0015] The above-described applications involve knockout using homologous recombination or CRISPR gene editing methods. The knockout gene translates into a protein that has no original function or cannot be translated into a protein.

[0016] The above-described applications involve inhibition using antisense RNA technology or interfering RNA technology.

[0017] The interfering RNA technology described above utilizes VIGS technology.

[0018] The PtNF-YB15 gene described in the above applications is shown in SEQ ID NO.1.

[0019] Application of reagents for detecting the gene encoding the protein shown in SEQ ID NO.2 in the screening or breeding of drought resistance in trifoliate orange.

[0020] The method for determining the application described above is as follows: drought-resistant trifoliate orange is defined as one in which the gene is not detected or the expression level of the gene is significantly reduced compared to normal.

[0021] Applications of expression cassettes that reduce PtNF-YB15 gene expression, recombinant vectors, or recombinant microorganisms in the creation of drought-resistant trifoliate oranges.

[0022] Compared with the prior art, the present invention has the following advantages:

[0023] The cloning and isolation of the drought-negative regulatory gene PtNF-YB15 in trifoliate orange provides a new genetic resource for molecular design breeding of plant stress resistance, and a new genetic resource for implementing green agriculture and water-saving agriculture. The development and utilization of this genetic resource is conducive to reducing agricultural production costs and achieving environmental friendliness. Attached Figure Description

[0024] Figure 1 This is a technical flowchart of the present invention.

[0025] Figure 2 This is a schematic diagram of the expression mode of PtNF-YB15 in response to drought stress treatment according to the present invention.

[0026] Where: A is the relative expression level of the PtNF-YB15 gene under treatment; B is GUS staining of callus transiently transformed by the PtNF-YB15 promoter; C is quantitative analysis.

[0027] Figure 3 This is a schematic diagram of the subcellular localization of PtNF-YB15 in this invention;

[0028] Wherein: A is a schematic diagram of the construction of the PtNF-YB15 subcellular localization vector of the present invention; B is the PtNF-YB15 subcellular localization detection of the present invention.

[0029] Figure 4 This is a schematic diagram of the PCR amplification detection results of the VIGS silencing material of the present invention;

[0030] TRV2-F is the forward primer for the vector, and PtNF-YB15-R is the reverse primer for the fragment.

[0031] Figure 5 This is a schematic diagram illustrating the quantitative relative expression of the PtNF-YB15 gene in the VIGS silencing material of this invention.

[0032] Figure 6 This is a schematic diagram illustrating the drought resistance analysis of the VIGS silent material of this invention;

[0033] Wherein: A is the drought resistance phenotype identification of PtNF-YB15 interferometric material (TRV-NF-YB15) and unloaded (TRV); B is the determination of chlorophyll fluorescence Fv / Fm values ​​of the two groups of plants; C and D are the leaf electrical conductivity and MDA content before and after drought treatment. Detailed Implementation

[0034] The present invention will now be described in detail with reference to specific embodiments. Based on the following description and embodiments, those skilled in the art can determine the basic features of the present invention, and various changes and modifications can be made to the present invention without departing from its spirit and scope to make it suitable for various uses and conditions.

[0035] Example 1:

[0036] Cloning of the full-length cDNA of the PtNF-YB15 gene of Citrus aurantium

[0037] Using trifoliate orange cDNA as a template, amplification was performed using a high-fidelity enzyme. The primer sequences were: forward primer: 5'-ATGGCCGCCGTCACT- 3', reverse primer: 5'-TGAAGGAGACTGATGTTGG- 3'.

[0038] The amplified product was purified and recovered using the AxyPrep-96 DNA gel extraction kit. Using seamless DNA cloning technology, the purified product was ligated into the pEASY-Blunt vector. The ligation product was then transformed into DH5α competent cells (Weidi Biotechnology, China), plated, and incubated upside down at 37°C. Spots were picked and shaken to detect bacterial growth. After PCR detection, positive clones were sent to Wuhan Tianyi Huayu Gene Technology Co., Ltd. for sequencing. Based on the sequencing results, the full-length gene sequence of PtNF-YB15 was obtained.

[0039] The gene is 2022 bp in length, encoding 673 amino acids. Molecular weight prediction indicates the protein has a molecular weight of 73.97 kDa and an isoelectric point (pI) of 5.56. This gene is named PtNF-YB15, with the nucleotide sequence shown in SEQ ID NO.1 and the amino acid sequence shown in SEQ ID NO.2.

[0040] Example 2:

[0041] Expression analysis of PtNF-YB15 under drought treatment

[0042] Wild-type trifoliate orange seedlings were cultured in a light incubator. When the seedlings were 2 months old and of uniform growth, they were slowly removed from the soil substrate, the soil around the roots was cleaned, and they were placed on dry filter paper for dehydration. Leaf samples were taken from the plants at different time points of 0 h, 1 h, 3 h, 6 h, 12 h, 24 h, and 48 h, and were quickly frozen in liquid nitrogen. They were then stored at -80℃ for later use in gene expression pattern analysis.

[0043] The drought expression pattern of the PtNF-YB15 gene was analyzed using real-time quantitative PCR (qPCR). The qPCR was performed using AceQ qPCR SYBR Green Master Mix reagent (Novizan, China), following the manufacturer's instructions. The prepared reaction mixture was processed using a QuantStudio 7 Flex system (Applied Biosystems, USA) quantitative PCR analyzer.

[0044] Using Actin from Citrus aurantium as an internal reference gene, 2 -ΔΔCt The algorithm calculates gene expression. The primers used are as follows:

[0045] Actin-F: 5'-CCGACCGTARAVGCAAGGAAA-3'

[0046] Actin-R: 5'-TTCCTGTGGACAATGGATGGA-3''

[0047] PtNF-YB15-qPCR-F: 5'-GCTTGCAACTCATTCTTGCC-3'

[0048] PtNF-YB15-qPCR-R: 5'-CATTTGCTCAGTCTTTGGGGC-3'

[0049] The results of this experiment indicate that PtNF-YB15 gene expression is strongly induced by drought, reaching a peak expression level of approximately 17-fold after 3 hours of dehydration treatment. Figure 2 (A) This indicates that PtNF-YB15 is a drought-inducible gene and may play an important role in plant drought response.

[0050] Example 3:

[0051] GUS staining analysis of callus transiently transformed by the PtNF-YB15 gene promoter

[0052] 1. Carrier Construction

[0053] This experiment was based on the *Citrus aurantium* whole genome database CPBD (http: / / citrus.hzau.edu.cn / ). Specific primers were designed for the promoter sequence of the PtNF-YB15 (Pt5g014380) gene. Amplification was performed using *Citrus aurantium* cDNA as a template with a high-fidelity enzyme (Novozymes, China). The amplification reaction system and procedure are shown in Tables 1 and 2. After ligation into the pEASY intermediate vector, sequencing was performed to confirm the PtNF-YB15 promoter sequence. The amplification primer sequences are as follows:

[0054] pPtNF-YB15-F: 5'-TTCGATTCACACTTGAGACCTG-3'

[0055] pPtNF-YB15-R:5'-TGGGGGGAGATTTAACAT-3'

[0056] The amplified products were purified and recovered using the AxyPrep-96 DNA gel extraction kit (Axygene, USA). The purified products were ligated into the pEASY-Blunt vector (see Table 3 for the ligation system). After incubation at room temperature for 5 min, the ligation was performed on competent *E. coli* DH5α cells. The cells were plated, single clones were picked, and PCR was performed for positive identification. Positive clones were then sent to Wuhan Tianyi Huayu Gene Technology Co., Ltd. for sequencing. Based on the sequencing results, the promoter sequence of the PtNF-YB15 gene was obtained.

[0057] Using the plasmid with correct sequencing results from the previous step as a template, specific primers were designed to amplify the 5' end of each vector by adding a 15-20 bp sequence from the linearized vector terminal as a homologous sequence. This primer pair was then used to amplify the insert fragment containing the homologous sequence. Using the OneStep Cloning Kit (Novizan, China), the insert was ligated between the PstⅠ and BamHI restriction sites on the DX2181G vector. After successful sequencing, the constructed vector was transformed into GV3101 competent cells. The primers used are as follows:

[0058] pPtNF-YB15-DX2181G-F:

[0059] 5'-CTACAGCGCTAAGCTTGGCTGCAGCCTTCGATTCACACTTGAGACCTG -3'

[0060] pPtNF-YB15-DX2181G-R:

[0061] 5'- AAGGGACTGACCACCCGGGATCCGCTGGGGGAGAGATTTAACAT -3'

[0062] 2. Sweet orange wound healing instant transformation

[0063] (1) Suspension callus: 4-5 days in advance, use a sterile spoon to transfer the prepared sweet orange callus to 50 ml of MT liquid culture medium and shake it thoroughly on a shaker (120 r / min) in a dark room at room temperature;

[0064] (2) Activation of Agrobacterium: Take Agrobacterium stored at -80℃, streak it in LB solid medium (containing antibiotics with carrier resistance) with a sterile inoculation loop, and incubate it upside down in a 28℃ incubator for 2 days until single colonies grow;

[0065] (3) Expanding culture: Use a sterile inoculation loop to pick up a single colony on the plate, inoculate it again onto LB solid medium with the same resistance, streak it twice, and incubate it upside down in a 28℃ incubator for 2-3 days. After the colony has grown, it can be used for infection.

[0066] (4) Preparation of infection solution: On a clean bench, scrape the Agrobacterium cells that have been streaked twice with a sterile knife and add them to 50 ml of suspension medium containing 50 mg / L AS (MT liquid + 0.5 g / L maltose + 1.5 g / L L-glutamine). Shake at 200 r / min for 20 min at 28℃ to fully disperse the cells. Then adjust the OD600 value of the bacterial solution to between 0.6 and 0.8 with MT suspension.

[0067] (5) Infection and culture: Let the shaken callus stand for a few minutes until the callus sinks to the bottom of the bottle. Carefully pour off the liquid on top. Use a sterile spoon or tweezers to transfer the callus to a glass dish lined with sterile filter paper. Drain the water and then transfer it to the prepared Agrobacterium infection solution. Shake at 30 ℃ for 10 min at 200 r / min and let stand for 30 min. Similarly, spread the infected callus on multiple layers of filter paper until the callus dries (let stand at low wind speed in a clean bench for about 40 min). Transfer the callus to co-culture medium (MT solid medium + 50 mg / L AS) with sterile filter paper and incubate at room temperature in the dark for 3-5 days.

[0068] (6) After co-culturing for 3 days, part of the callus tissue was kept in the co-culture medium, and the other part was transferred to MT medium (MT solid medium + 50 mg / L AS + 10% PEG) containing 10% PEG to simulate drought treatment, and then GUS staining was performed.

[0069] 3. GUS staining analysis

[0070] GUS staining of sweet orange callus was performed using a GUS staining kit (coolaber, SL7160, China), and the GUS staining results were quantified using ImageJ software.

[0071] The results of this experiment show that the callus transformed by pPtNF-YB15:GUS without drought treatment is light yellow, while the callus transformed by pPtNF-YB15:GUS becomes significantly darker blue after drought treatment. Figure 2 (Middle B), indicating that drought can enhance the activity of the PtNF-YB15 promoter ( Figure 2 (C), further demonstrating that PtNF-YB15 is strongly induced by drought.

[0072] Example 4:

[0073] Subcellular localization of PtNF-YB15 gene

[0074] The primer sequences for amplifying the ORF region (excluding the stop codon) of PtNF-YB15 are as follows:

[0075] p101YFP-PtNF-YB15-F:5'- ATGGGATCTACTAGTGAATTCATGGCCGCCGTCACT -3'

[0076] p101YFP-PtNF-YB15-R:5'-GGGGGTACCGTCGACGGATCCATGGTCTGAAGGAGACTGATGTTGG -3';

[0077] The target gene was constructed into the p101YFP vector (containing YFP protein, CN118085051B). The YFP protein is located at the 3' end of the gene, and its expression is driven by the CaMV35S promoter. Figure 3 (A) 35S:PtNF-YB15-YFP+mCherry and control 35S:YFP (i.e., empty p101YFP vector)+mCherry were transiently transformed into leaf epidermal cells of *Nicotiana benthamiana*. Laser confocal fluorescence observation revealed that the control cell fluorescence filled the entire epidermal cell, including the cytoplasm and nucleus, while the fluorescence of the transformed 35S:PtNF-YB15-YFP cell was concentrated only in the nucleus. This indicates that PtNF-YB15 is a nuclear localization protein (…). Figure 3 (B)

[0078] Example 5:

[0079] VIGS Interference Identification of Trifoliate Orange and Positive Seedlings

[0080] 1. Carrier Construction

[0081] Using *Citrus aurantium* cDNA as a template, specific primers were designed to amplify a non-conserved region of approximately 500 bp in the CDS of the PtNF-YB15 gene. A one-step ligation method using the OneStep Cloning Kit (Novizan, China) was employed to insert the fragment between the BamHI and SmaI restriction sites on the pTRV2 vector, yielding the recombinant plasmid TRV2-PtNF-YB15. The empty vector was a vector plasmid containing no target fragment. Both the correctly sequenced recombinant plasmid and the empty vector plasmid were transformed into GV3101 competent cells. The primers used to construct the vector are as follows (underlined portions indicate restriction sites):

[0082] pTRV2- PtNF-YB15-F (BamH I):5'- AGAAGGCCTCCATGGGGATCCACTGATTTGGGATTGAGTAGAAATGAG-3';

[0083] pTRV2- PtNF-YB15-R(Sma I):5'-TGTCTCGGGACATGCCCGGGCAGGCATTTGCTCAGTCTTTG-3'.

[0084] 2. VIGS infection

[0085] Seeds were isolated from the fruit of the trifoliate orange, soaked in 1 mol / L NaOH solution for 15 min to remove pectin, rinsed twice with sterile water, and then spread flat on a moistened clean gauze. They were then placed in a 28 ℃ incubator in the dark to germinate. Once the seedlings had germinated to 1-2 cm in length, they were ready for VIGS infection. The procedure is as follows:

[0086] 1) Agrobacterium species containing TRV1, TRV2, and TRV2-PtNF-YB15 were streaked onto LB medium (containing 50 mg / L Rif and 50 mg / L Kan) and cultured upside down at 28 ℃ for 2-3 days to obtain single colonies;

[0087] 2) Pick one single clone from each culture and place it in 5 mL of LB liquid medium containing the same antibiotic. Incubate at 28 °C and 220 r / min for 24-48 h with gentle shaking to fully activate the cells.

[0088] 3) Inoculate the activated Agrobacterium tumefaciens bacterial suspension at a ratio of 1:100 into LB liquid medium containing the same culture medium. Incubate at 28 °C and 220 r / min for 10-12 h. Centrifuge at 4000 r / min to collect the bacterial cells. Resuspend the cells in MES buffer (10 mmol / L MES, 10 mmol / L MgCl2, 150 μmol / L AS, pH=5.6-5.7). OD 600Adjust to 1.0;

[0089] 4) Mix TRV1 and TRV2, and TRV1 and TRV2-PtNF-YB15 resuspensions in a 1:1 ratio respectively. After mixing, incubate in the dark at 28 ℃ for 2-3 h to prepare the infection solution.

[0090] 5) Use a syringe needle to gently poke some small holes in the germinating seedlings, completely immerse them in the prepared Agrobacterium infection solution, vacuum for 10 minutes, then quickly release the air to allow the Agrobacterium to penetrate the germinating seeds. Repeat this process 3 times. After that, let them stand for 15 minutes, then remove the infected seeds and air them on dry filter paper. After standing for 2-3 minutes, spread them evenly in a large dish with filter paper moistened with sterile water. Incubate in a dark room at room temperature for 2-3 days.

[0091] 6) Rinse the seeds after dark culture with clean water to remove residual bacterial solution, sow them in the substrate (soil:vermiculite = 3:1), and grow them in a room temperature light incubator for about one month before positive identification.

[0092] 3. Identification of positive materials

[0093] VIGS-silenced trifoliate orange positive plants were identified by PCR using extracted trifoliate orange DNA as a template and a reverse primer constructed from the TRV2 forward primer and the target gene recombinant vector. The sequences are as follows:

[0094] TRV2-F: 5'-ATTCACTGGGAGATGATACGCT-3'

[0095] PtNF-YB15-R:5'-caggcatttgctcagtctttg-3'.

[0096] The results are as follows Figure 4 As shown, the recombinant plasmid carrying the target gene in the VIGS vector was successfully transformed into the plant. The PtNF-YB15 gene in the positive plants was quantified using the real-time quantitative PCR (qPCR) method described in Example 2. The results are as follows. Figure 5 As shown, the expression level of the PtNF-YB15 gene in VIGS-silenced trifoliate orange plants was significantly lower than that in the control group.

[0097] Example 6:

[0098] Drought resistance identification of PtNF-YB15 trifoliate orange

[0099] Positive plants with high inhibition of TRV-PtNF-YB15 expression were selected for drought treatment. Before treatment, there was no significant difference in growth between the empty vector plants (TRV2) and the silent line plants (TRV2-NF-YB15). However, after 30 days of natural drought, the empty vector plants showed severe leaf curling, yellowing, drying, and even death, while the TRV2-PtNF-YB15 silent line plants only showed mild yellowing and wilting. Figure 6 (A) This indicates that TRV2-NF-YB15 interference can alleviate drought stress damage in trifoliate orange. Simultaneously, chlorophyll imaging showed that the photosynthetic intensity of the TRV2-NF-YB15 silent line plants after drought treatment was significantly higher than that of the untreated plants, and the Fv / Fm value was also significantly increased. Figure 6 (B) indicates that the inhibition of photosynthetic response in the TRV2-NF-YB15 silent line was alleviated under drought stress. The electrical conductivity and MDA content of the TRV2-NF-YB15 silent line after drought were also measured. Figure 6 The values ​​of C and D were significantly lower than those of the uninoculated plants, indicating that the TRV2-NF-YB15 silent line plants suffered less drought damage compared to the uninoculated plants.

[0100] The above results demonstrate that silencing PtNF-YB15 can significantly improve the drought resistance of trifoliate orange plants, further proving the important regulatory role of PtNF-YB15 in improving plant drought resistance.

Claims

1. A type of trifoliate orange (from the plant *Citrus aurantium*) Poncirus trifoliata Separated from ) PtNF-YB15 The application of the gene in improving the drought resistance of trifoliate orange, wherein the protein sequence encoded by the gene is shown in SEQ ID NO.2, and the application employs knockout or inhibition. PtNF-YB15 The expression level of genes is used to improve the drought resistance of trifoliate orange.

2. The application according to claim 1, wherein... PtNF-YB15 The gene is shown in SEQ ID NO.

1.

3. The application according to claim 1, wherein the application process involves reducing the amount of trifoliate orange. PtNF-YB15 The expression level of a gene or a substance that inhibits its expression is introduced into the trifoliate orange, wherein the substance is a substance that reduces the expression level of a gene. PtNF-YB15 Gene expression cassettes, recombinant vectors, or recombinant microorganisms.

4. In the application according to claim 1, the knockout is performed using homologous recombination or CRISPR gene editing methods, and the protein translated from the knocked-out gene has no original function or cannot be translated into a protein.

5. The application according to claim 1, wherein the inhibition is performed using antisense RNA technology or interfering RNA technology.

6. Application of reagents for detecting the gene encoding the protein shown in SEQ ID NO.2 in the screening or breeding of drought resistance in trifoliate orange.

7. reduce PtNF-YB15 The application also provides a use of an expression cassette, a recombinant vector or a recombinant microorganism in creating drought-resistant P. trifoliatum, wherein the gene coding a protein sequence shown in SEQ ID NO. 2.