Chitin synthase 2 gene of diabrotica balteata and application thereof, dsrna for diabrotica balteata control and application thereof
By silencing the chitin synthase 2 gene in the two-spotted leaf beetle and using dsRNA interference technology, the problem of the two-spotted leaf beetle's resistance to chemical pesticides was solved, achieving the control of the two-spotted leaf beetle and the improvement of crop resistance, while reducing the use of chemical pesticides and environmental pollution.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- YAZHOUWAN NATIONAL LABORATORY
- Filing Date
- 2025-11-07
- Publication Date
- 2026-04-21
AI Technical Summary
In existing technologies, the two-spotted leaf beetle has developed resistance to chemical pesticides, which increases the difficulty of control. Furthermore, the use of chemical pesticides is toxic to the environment and to non-target beneficial insects.
The chitin synthase 2 (CHS2) gene of the two-spotted leaf beetle was identified using bioinformatics techniques. dsRNA was designed to interfere with this gene to silence its expression. The dsRNA was then expressed in crops using recombinant plasmids to enhance crop resistance.
It effectively inhibits the growth of the two-spotted firefly beetle, reduces the use of chemical pesticides, lowers environmental pollution, avoids toxicity to non-target beneficial insects, and improves crop resistance to the two-spotted firefly beetle.
Smart Images

Figure CN121087064B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to a chitin synthase 2 gene of the two-spotted firefly beetle and its application, as well as dsRNA for the control of the two-spotted firefly beetle and its application. Background Technology
[0002] Two-spotted firefly beetle Monolepta hieroglyphica ( Motschulsky The two-spotted leaf beetle (Gymnocladus orientalis) is a widely distributed polyphagous pest. It primarily damages crops such as corn, sorghum, beans, alfalfa, potatoes, peppers, and cotton. Adults feed on leaves, flower spikes, and seeds, while larvae feed on roots, causing yield reduction. Chemical pesticides are commonly used in agriculture to control the two-spotted leaf beetle; however, long-term and frequent use of chemical pesticides leads to pesticide resistance. Therefore, given the increasingly serious problem of the two-spotted leaf beetle, exploring new control methods is urgently needed.
[0003] RNA interference (RNAi) refers to the phenomenon where exogenous or endogenous double-stranded RNA (dsRNA) specifically induces gene expression silencing. After entering the cell, dsRNA is cleaved by the Dicer enzyme into small RNA molecules (siRNA) of 21-23 bp. Then, under the action of the RNA-induced silencing complex (RISC), the siRNA unwinds into single strands, and the antisense strand specifically binds to homologous target mRNA, ultimately leading to gene expression silencing. Due to its high specificity and low production cost, RNAi has been applied as a novel method in agricultural pest control.
[0004] In view of this, the present invention is hereby proposed. Summary of the Invention
[0005] The first objective of this invention is to provide a chitin synthase 2 (2) for the two-spotted firefly beetle. CHS2 )Gene.
[0006] The second objective of this invention is to provide the application of the chitin synthase 2 gene of the two-spotted firefly beetle in the control of the two-spotted firefly beetle, so as to solve the above-mentioned technical problems.
[0007] A third objective of this invention is to provide a dsRNA for the control of the two-spotted leaf beetle.
[0008] A fourth objective of this invention is to provide a recombinant plasmid.
[0009] The fifth objective of this invention is to provide a cell.
[0010] The sixth objective of this invention is to provide the application of the above-mentioned dsRNA, or recombinant plasmid, or cell in the control of the two-spotted leaf beetle.
[0011] The seventh objective of this invention is to provide a reagent for the control of the two-spotted leaf beetle.
[0012] The eighth objective of this invention is to provide a method for improving the resistance of crops to the two-spotted leaf beetle.
[0013] To achieve the above objectives, the following technical solution is adopted:
[0014] In a first aspect, the present invention provides a chitin synthase 2 gene for the two-spotted firefly beetle, the nucleic acid sequence of which is shown in SEQ ID NO.1.
[0015] Secondly, this invention provides the application of the chitin synthase 2 gene of the two-spotted firefly beetle in the control of the two-spotted firefly beetle, and the chitin synthase 2 gene of the two-spotted firefly beetle is horizontally silenced after transcription to achieve the control of the two-spotted firefly beetle.
[0016] The nucleic acid sequence of the chitin synthase 2 gene is shown in SEQ ID NO.1.
[0017] As a further technical solution, the method to silence the chitin synthase 2 gene of the two-spotted firefly beetle is RNA interference (including dsRNA interference, siRNA interference and shRNA interference, etc.).
[0018] Thirdly, the present invention provides a dsRNA for the control of the two-spotted leaf beetle, the nucleic acid sequence of which is shown in SEQ ID NO.2 or SEQ ID NO.3.
[0019] Fourthly, the present invention provides a recombinant plasmid expressing the dsRNA.
[0020] Fifthly, the present invention provides a cell containing the dsRNA or the recombinant plasmid described above; the cell is a non-plant cell.
[0021] Sixthly, the present invention provides the application of the above-mentioned dsRNA, or recombinant plasmid, or cells in the control of the two-spotted leaf beetle.
[0022] In a seventh aspect, the present invention provides a reagent for the control of the two-spotted leaf beetle, comprising the above-mentioned dsRNA or cells.
[0023] Eighthly, the present invention provides a method for improving the resistance of crops to the two-spotted firefly beetle by introducing the above-mentioned recombinant plasmid into the crop and expressing dsRNA in the crop to improve the resistance of the crop to the two-spotted firefly beetle.
[0024] As a further technical solution, the crop includes corn, soybeans, or cotton.
[0025] Compared with the prior art, the present invention has the following beneficial effects:
[0026] This invention uses bioinformatics technology to identify the two-spotted leaf beetle. CHS2 The gene can be silenced to effectively inhibit the growth of the two-spotted firefly beetle, thus achieving the control of the two-spotted firefly beetle.
[0027] This invention utilizes dsRNA designed based on this gene, which can mediate the behavior of the two-spotted firefly beetle. CHS2 Gene silencing enables specific control of the two-spotted leaf beetle; avoids the toxicity of chemical pesticides to non-target beneficial insects; reduces the use of chemical pesticides and lowers environmental pollution. Attached Figure Description
[0028] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.
[0029] Figure 1 To express ds CHS2 A schematic diagram of the plasmid. CHS2 Two-spotted firefly beetle CHS2 Gene fragments;
[0030] Figure 2 For conversion to ds CHS2 Identification of positive maize samples EF1ɑ ds is a corn internal reference gene. CHS2 Two-spotted firefly beetle ds CHS2 In the fragment, M stands for Marker, WT represents non-GMO background maize, and in A, lines 2, 3, and 12 are transgenic ds. CHS2 (SEQ ID NO.2) Maize; in B, line 1, line 2, and line 3 are transgenic ds. CHS2 (SEQ ID NO.3) Corn;
[0031] Figure 3 For the use of non-GMO background corn and transgenic ds CHS2 The midgut of the two-spotted firefly beetle was examined after feeding it with corn leaves. CHS2 Relative expression level; A is the expression level of ds CHS2 (SEQ ID NO.2) Maize; B is transds CHS2 (SEQ ID NO.3) Corn;
[0032] Figure 4 For the use of non-GMO background corn and transgenic ds CHS2 Harm statistics of feeding two-spotted leaf beetle with maize leaves; WT represents non-GMO background maize, ds CHS2 For conversion to ds CHS2 Corn; A and D represent non-GMO background corn and transgenic corn. CHS2 Diagram illustrating damage caused by feeding corn leaves for one day; B and E represent non-GMO background corn and GMO ds. CHS2 Damaged leaf area of corn after 2 days of foliar feeding; C and F represent non-GMO background corn and GMO ds. CHS2 The percentage of damaged corn leaves after 2 days of feeding with corn leaves; AC represents the percentage of damaged leaves after 2 days of feeding with corn leaves; CHS2 (SEQ ID NO.2) Maize; DF stands for transds. CHS2 (SEQ ID NO.3) Corn;
[0033] Figure 5 For the use of non-GMO background corn and transgenic ds CHS2 Mortality and survival curves of *Dystrophus bisporus* fed with maize leaves; WT represents non-GMO background maize, ds CHS2 For conversion to ds CHS2 Corn; A and C represent corn grown in a non-GMO background and corn grown using transgenic ds. CHS2 Cumulative and corrected mortality rates every 12 hours after feeding maize leaves to the two-spotted leaf beetle; B and D represent the results of feeding non-GMO background maize and transgenic ds. CHS2 Survival curves of the two-spotted firefly beetle fed with maize leaves; AB represents the transition from ds CHS2 (SEQ ID NO.2) Corn; CD is for ds CHS2 (SEQ ID NO.3) Corn. Detailed Implementation
[0034] The embodiments and examples of the present invention will be described in detail below. However, those skilled in the art will understand that the following embodiments and examples are for illustrative purposes only and should not be considered as limiting the scope of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention. Unless otherwise specified, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.
[0035] CHS2 The chitin synthase 2 gene is an insect-specific gene that determines the formation of the peritrophic membrane in the midgut of insects. (Deleted gene) CHS2Insects with certain genes suffer from a fitness cost, making them unable to feed on normal host plants and prone to death. Therefore, interfering with key genes... CHS2 By inhibiting gene expression, the adaptability of the two-spotted firefly beetle to its host plant can be reduced, thereby achieving the goal of controlling the two-spotted firefly beetle.
[0036] In a first aspect, the present invention provides a chitin synthase 2 gene for the two-spotted firefly beetle, the nucleic acid sequence of which is shown in SEQ ID NO.1.
[0037]
[0038] This invention uses bioinformatics technology to identify the two-spotted leaf beetle. CHS2 The gene can be silenced to effectively inhibit the growth of the two-spotted firefly beetle, thus achieving the control of the two-spotted firefly beetle.
[0039] Secondly, this invention provides the application of the chitin synthase 2 gene of the two-spotted firefly beetle in the control of the two-spotted firefly beetle, and the chitin synthase 2 gene of the two-spotted firefly beetle is horizontally silenced after transcription to achieve the control of the two-spotted firefly beetle.
[0040] The nucleic acid sequence of the chitin synthase 2 gene is shown in SEQ ID NO.1.
[0041] This invention achieves the control of the two-spotted firefly beetle by silencing the chitin synthase 2 gene.
[0042] In some alternative embodiments, methods for silencing the chitin synthase 2 gene of the two-spotted firefly beetle include, but are not limited to, RNA interference (including dsRNA interference, siRNA interference, and shRNA interference), miRNA inhibition, or antisense oligonucleotide technology, or other techniques known to those skilled in the art.
[0043] Thirdly, the present invention provides a dsRNA for the control of the two-spotted leaf beetle, the nucleic acid sequence of which is shown in SEQ ID NO.2 or SEQ ID NO.3:
[0044] CTATGTGGCACGAAACTAAAGAAGAAATGATTGAATTTTTAAAATCCGTTCTTAGAATGGACGAAGATCAATGTGCTCACAGAAATGTCAGGAATTATTTGCAATATAACATGCCGAACTACTACGAATTTGAAACTCACATATTCTTCGATGACGCTTTTGTGAGAGTCTCCC AAGAAGATCAAGATCCTCATATCAATCAGTACGTCCTGGACCTTATTGATTCCGTAAGTGATGCTGCCAGTAAAGTACATGCCGTGAATGTTAAAATCAAGCTCCTACGATATATTCTACCGCTTACGGAGGTAGATTAGTGTGGACTTTACCAGGAAAAACCAAAATGA (SEQ ID NO.2);
[0045] GATAATGGACAATGAAGATTTTAGTGCTACAGAGGTCAAGAACATCGCCAGAAACACATACATCCTCGCTCTGGATGGTGATATCGATTTCCAACCAGCTGCTGTCCATCTTTTAGTGGATTACATGAAGAAAAATCAGGCTTTAGGGGCGGCCTGTGGTAGAATTCATCCGATAGGCTCAGGCACGATGGCTTGGTATCAGATTTTTGAATACGCCGTTGGTCATTGGTTACAAAAA GCGACAGAACACGTCATCGGTTGCGTACTGTTGATGTCCAGGATGTTTCTCACTTTTCCGAGCAGGTGCACTTATGGATGACAACGTTATGGCTAAATATACAACAGAAGCCACCGAAGCTAGGCATTATGTACAATATGATCAAGGTGAAGACCGTTGGTTATGTACTCTGTTATTACAAAGGGGTTATCGGGTAGAATATTCAGCTGCGTCTGACGCCTACACGCATTGTCCA (SEQ ID NO.3).
[0046] This invention utilizes dsRNA designed based on this gene, which can mediate the behavior of the two-spotted firefly beetle. CHS2 Gene silencing enables specific control of the two-spotted leaf beetle; avoids the toxicity of chemical pesticides to non-target beneficial insects; reduces the use of chemical pesticides and lowers environmental pollution.
[0047] Fourthly, the present invention provides a recombinant plasmid expressing the dsRNA.
[0048] Fifthly, the present invention provides a cell containing the dsRNA or the recombinant plasmid described above; the cell is a non-plant cell.
[0049] This cell can be used for the preparation of dsRNA or recombinant plasmids.
[0050] Sixthly, the present invention provides the application of the above-mentioned dsRNA, or recombinant plasmid, or cells in the control of the two-spotted leaf beetle.
[0051] In a seventh aspect, the present invention provides a reagent for the control of the two-spotted leaf beetle, comprising the above-mentioned dsRNA or cells.
[0052] The reagents provided by this invention include the dsRNA or cells of this invention, and therefore have all the beneficial effects of the dsRNA of this invention, and can be used for the control of the two-spotted leaf beetle.
[0053] Eighthly, the present invention provides a method for improving the resistance of crops to the two-spotted firefly beetle by introducing the above-mentioned recombinant plasmid into the crop and expressing dsRNA in the crop to improve the resistance of the crop to the two-spotted firefly beetle.
[0054] The inventors discovered through research that feeding with ds CHS2 (Double-spotted firefly beetle) CHS2 The mortality rate of the two-spotted firefly beetle in the leaves of crops such as maize (containing dsRNA) is significantly higher than that in non-transgenic crops. Therefore, introducing dsRNA into crops can help control the mortality rate of this beetle. CHS2 The plasmid can improve the crop's resistance to the two-spotted leaf beetle.
[0055] In some alternative implementations, the crop includes, but is not limited to, corn, soybeans, or cotton, and may also be other crops known to those skilled in the art that are susceptible to the two-spotted leaf beetle.
[0056] The present invention will be further illustrated below with specific embodiments. However, it should be understood that these embodiments are merely for the purpose of more detailed illustration and should not be construed as limiting the present invention in any way.
[0057] Example 1 CHS2 Gene cloning, expression ds CHS2 Carrier preparation, ds CHS2 Maize conversion, indoor bioassay
[0058] 1. Using the insects identified in this experiment, such as the cotton bollworm, fall armyworm, and beet armyworm... CHS2 Genes, identified through conserved sequences of the two-spotted firefly beetle CHS2 The gene was identified by PCR amplification and sequencing, and its nucleic acid sequence is shown in SEQ ID NO.1.
[0059] 2. Test insects
[0060] Adult two-spotted leaf beetles were collected from weeds surrounding a cornfield in the experimental field of Inner Mongolia Agricultural University. The rearing conditions were: temperature 27±2℃, relative humidity 75%±10%, and photoperiod 14L:10D.
[0061] 3. RNA extraction
[0062] The collected adult worms were ground in liquid nitrogen. 50-100 mg of powder was transferred to a 1.5 ml centrifuge tube without ribonuclease, and 1 ml of Trizol was added and mixed thoroughly. The collected tissue was then placed in a centrifuge tube, 200 μL of Trizol was added, and the tissue was ground thoroughly with a plastic grinding rod. After thorough grinding, 800 μL of Trizol was added.
[0063] Incubate at room temperature for 5 min to facilitate complete separation of ribosomes from the homogenized sample. Add 200 μL of chloroform, vortex for 15 s, and let stand at room temperature for 5 min. Then centrifuge at 12000 rpm and 4℃ for 15 min; transfer 400 μL of the supernatant to a new centrifuge tube, add an equal volume of isopropanol, invert to mix thoroughly, let stand at room temperature for 10 min, and centrifuge at 12000 rpm and 4℃ for 10 min; discard the supernatant, add 1 ml of 75% ethanol to wash gently, and then centrifuge at 12000 rpm and 4℃ for 5 min; remove the supernatant, dry the precipitate at room temperature, and dissolve it thoroughly in 50-150 μL of nuclease-free water.
[0064] 4. Synthesis of first-strand cDNA
[0065] First-strand cDNA was synthesized from the extracted total RNA using the TransScript One-step gDNA Removal and cDNA SynthesisSuperMix reverse transcription kit, following its instructions. The specific steps are as follows:
[0066] The configuration system is as follows:
[0067]
[0068] Mix gently and incubate at 42°C for 15 minutes; heat at 85°C for 5 seconds to inactivate the reverse transcriptase. After the reaction is complete, store in an ultra-low temperature freezer at -80°C.
[0069] 5. Express ds CHS2 Preparation of the carrier
[0070] ds were prepared using homologous recombination and the Golden Gate seamless cloning method. CHS2 The expression vector is pBWA(V)BU.
[0071] 1) Primers for target fragment amplification
[0072]
[0073] 2) PCR amplification of the target fragment
[0074] The gene was amplified using FastPfu enzyme with cDNA as a template from the two-spotted firefly beetle. The reaction system is as follows:
[0075]
[0076] After mixing the above reaction solutions, briefly centrifuge, and then proceed with the reaction in a PCR instrument according to the following procedure:
[0077]
[0078] After PCR amplification, the PCR products were recovered according to the Wizard SV Gel and PCR Clean-Up System kit instructions.
[0079] 3) Vector enzyme digestion
[0080] The enzyme digestion system is as follows:
[0081]
[0082] After mixing the above reaction solutions, briefly centrifuge, and then digest with enzymes at 37°C for 1 hour in a PCR instrument. Gel recovery is then performed.
[0083] 4) Target fragment digestion
[0084] The enzyme digestion system is as follows:
[0085]
[0086] After mixing the above reaction solutions, briefly centrifuge, and then digest with enzymes at 37°C for 1 hour in a PCR instrument. Gel recovery is then performed.
[0087] 5) Connection reaction
[0088] The connection reaction system is as follows:
[0089]
[0090] After mixing the above reaction solutions, briefly centrifuge and then incubate at 20°C for 1 hour in a PCR instrument. The ligation product is then transformed into competent cells.
[0091] 6) Transformation
[0092] Transform 5-10 μL of the ligation product into competent E. coli cells, plate the transformed cells onto Kans resistant plates, incubate at 37°C for 12-15 hours, and then perform plaque PCR identification.
[0093] 7) Plaque PCR identification
[0094] Ten bacterial plaques were selected and simultaneously inoculated into 1.5 ml EP tubes for PCR identification. The primers were:
[0095]
[0096] The reaction system is as follows:
[0097]
[0098] After mixing the above reaction solutions, briefly centrifuge, and then proceed with the reaction in a PCR instrument according to the following procedure:
[0099]
[0100] The target bands are fragments of approximately 346 bp and 473 bp. Take 100 μL of bacterial culture corresponding to 1-3 positive bands for sequencing. Inoculate the remaining 400 μL of bacterial culture into 5-10 ml of Kan-resistant LB broth. Shake the tubes. After sequencing results are obtained, extract the plasmid from the tube corresponding to the correctly sequenced bands. Its nucleic acid sequence is shown in SEQ ID NO. 2 and SEQ ID NO. 3. Expression ds CHS2 plasmid structure such as Figure 1 As shown.
[0101] 6. ds CHS2 Maize transformation (i.e., importing expression ds) CHS2 The plasmid, so that maize can express ds CHS2 )
[0102] 1) Plasmid transformation
[0103] Add 1 µL of plasmid to 50 µL of EHA105 Agrobacterium competent cells, mix thoroughly, and then transfer to an electroporation cuvette. After electroporation, add 1 mL of LB liquid medium, mix thoroughly, and then transfer to a 1.5 mL centrifuge tube. Incubate at 30 °C and 180 rpm for 30 min on a shaker. Inoculate 50 µL of the activated Agrobacterium culture onto LB solid medium and incubate in the dark at 30 °C for 48 h. Subsequently, colony PCR detection yields positive Agrobacterium clones.
[0104] 2) Agrobacterium infection and co-culture
[0105] Remove the outer shell of the ear and place it in a container for sterilization. Take a sterilized 2ml EP tube, add the suspension to the tube, and collect the immature embryos. Pick Agrobacterium and place it in the infection solution to prepare an Agrobacterium resuspension with OD600 = 0.2. Aspirate the suspension from the EP tube, add the prepared Agrobacterium culture, and infect the embryos. Pour the infected immature embryos and the culture solution into a co-culture medium, and aspirate the culture solution. Incubate at 25℃ in the dark for 2-3 days.
[0106] 3) Callus induction and screening
[0107] After co-culture, the embryos were inoculated onto induction medium and cultured in the dark at 28°C for 7-10 days. The induced calluses were then inoculated onto selection medium for selection culture and cultured in the dark at 28°C for 2 weeks. The calluses that survived the first selection were then used for a second selection.
[0108] 4) Differentiation and rooting
[0109] The selected embryogenic callus was inoculated onto a predifferentiation medium and cultured in the dark at 28°C for 10 days. The predifferentiated callus was then inoculated onto a differentiation medium and cultured under light at 25°C until seedlings differentiated. The differentiated seedlings were then transferred to a rooting medium and cultured under light at 25°C until the root system was fully developed. The developed seedlings were then hardened off and transplanted into the greenhouse substrate.
[0110] 5) Positive vaccine detection
[0111] Genomic DNA was extracted from maize using the CTAB method, and PCR detection was performed to screen for transgenic ds. CHS2 Positive maize lines. To further verify the ds... CHS2 For positive maize lines, we randomly selected one non-transgenic background maize (WT) and three positive maize lines (line 2, line 3, and line 12) and extracted RNA from their leaves according to steps 3 and 4 above. First-strand cDNA was synthesized and subjected to PCR detection. The gene being detected was the maize internal reference gene. EF1ɑ and the two-spotted firefly beetle CHS2 Genes, results showed EF1ɑ It was expressed in all four maize plants, while ds CHS2 Only in turn ds CHS2 Expression in maize indicates the selection of transgenic ds CHS2 Positive maize lines do indeed express ds CHS2 ( Figure 2 ).
[0112] 7. Indoor bioassay
[0113] The indoor bioassay for the two-spotted leaf beetle was conducted according to the relevant departmental announcement No. 864-19-2024, "Indoor Bioassay for Insect Resistance in Insect-Resistant Maize." Adult two-spotted leaf beetles were transferred to transgenic ds... CHS2 Corn (ds) CHS2 The two-spotted leaf beetles were fed on leaves of the transgenic corn (group 1) and non-transgenic corn (WT) leaves (corresponding to the transgenic corn) as a control. The survival of the two-spotted leaf beetle on both transgenic and non-transgenic corn was observed daily. Corrected mortality was calculated based on the natural mortality rate of the infected group to assess the resistance level of the transgenic corn to the two-spotted leaf beetle. RNA was extracted from the midgut of the two-spotted leaf beetles after 1 and 2 days of feeding and analyzed. CHS2The relative expression levels of *D. spp.* were compared with those of *D. spp.* leaf beetles fed non-GM corn (WT) leaves for 2 days as a control. The relative expression levels of *D. spp.* leaf beetles fed with transgenic *D. spp.* leaf beetles were compared with those fed with transgenic *D. spp.* leaf beetles. CHS Two-spotted firefly beetle on corn leaves Gene expression levels decreased significantly on day 2. ), indicating ds Interference with the two-spotted firefly leaf beetle Gene expression. Using non-GMO background maize and transgenic ds... Feeding maize leaves to the two-spotted leaf beetle resulted in significantly more harm to non-GMO background maize compared to GMO maize. Corn is more severely affected. Using non-GMO background corn and transgenic ds. After feeding the two-spotted firefly beetle with corn leaves, its feeding habits changed to ds. The mortality rate of the two-spotted firefly beetle on maize leaves was significantly higher than that of maize fed on non-GMO background maize, and the corrected mortality rate reached 85-100% after 48-60 hours. ), indicating the conversion to ds Corn exhibits high resistance to the two-spotted firefly beetle.
[0114] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.
Claims
1. A dsRNA for the control of the two-spotted leaf beetle, characterized in that, The nucleic acid sequence of the dsRNA is shown in SEQ ID NO.2 or SEQ ID NO.
3.
2. A recombinant plasmid, characterized in that, The recombinant plasmid expresses the dsRNA as described in claim 1.
3. A cell, characterized in that, The cell contains the dsRNA as described in claim 1, or the recombinant plasmid as described in claim 2; the cell is a non-plant cell.
4. The application of the dsRNA of claim 1, the recombinant plasmid of claim 2, or the cell of claim 3 in the control of the two-spotted leaf beetle.
5. A reagent for the control of the two-spotted leaf beetle, characterized in that, This includes the dsRNA of claim 1, or the cell of claim 3.
6. A method for improving the resistance of crops to the two-spotted leaf beetle, characterized in that, The recombinant plasmid of claim 2 is introduced into crops, and dsRNA is expressed in the crops to improve the crops' resistance to the two-spotted leaf beetle.
7. The method according to claim 6, characterized in that, The crops include corn, soybeans, or cotton.