Application of bone marrow mesenchymal stem cell-derived nano-vesicle loaded let-7e inhibitor in preventive treatment of postmenopausal osteoporosis

Abstract

The invention discloses application of a let-7e inhibitor loaded on nano-vesicles derived from bone marrow mesenchymal stem cells in preventive treatment of postmenopausal osteoporosis, and belongs to the technical field of biological medicines. According to the invention, the let-7e inhibitor is designed and synthesized and is'neutralized ', so that the inhibition of the let-7e inhibitor on an osteogenic gene is relieved, the osteogenic function of osteoblasts is promoted, and meanwhile, the nano-vesicles which are derived from mesenchymal cells and have an anti-inflammatory effect are selected as a delivery tool of the let-7e inhibitor to prevent and treat osteoporosis. Experimental results indicate that the mouse bone marrow mesenchymal stem cell-derived nano-vesicle loaded with the let-7e inhibitor has a good preventive treatment effect on mouse osteoporosis after ovariectomy. A stem cell nano-vesicle treatment platform based on mouse bone marrow mesenchymal stem cell-derived nano-vesicles loaded with let-7e inhibitors is expected to be developed into a novel clinical intervention scheme for preventing postmenopausal osteoporosis.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to the application of let-7e inhibitor loaded with nanovesicles derived from bone marrow mesenchymal stem cells in the preventive treatment of postmenopausal osteoporosis. Background Technology

[0002] Postmenopausal osteoporosis is a systemic skeletal disease caused by a sharp decline in estrogen levels, leading to bone resorption exceeding bone formation, resulting in decreased bone mass, bone microarchitecture deterioration, and increased bone fragility. It is the most common metabolic bone disease in postmenopausal women, significantly increasing the risk of fractures in areas such as the hip and vertebrae, leading to high rates of disability and mortality, and imposing a heavy socioeconomic burden. Estrogen deficiency alters the expression profile of various miRNAs in the body; these dysregulated miRNAs cause an imbalance in the expression of genes that promote osteoclast resorption or inhibit osteogenic resorption, thereby accelerating the progression of osteoporosis.

[0003] Currently, there is still a lack of ideal treatments in clinical practice that are safe, convenient, and can be used long-term. Summary of the Invention

[0004] The purpose of this invention is to provide the application of let-7e inhibitor loaded with nanovesicles derived from bone marrow mesenchymal stem cells in the preventive treatment of postmenopausal osteoporosis, in order to solve the problems existing in the prior art.

[0005] To achieve the above objectives, the present invention provides the following solution: One of the technical solutions of this invention is the application of let-7e inhibitor in the preparation of drugs for the prevention and / or treatment of postmenopausal osteoporosis.

[0006] The second technical solution of the present invention is a drug for preventing and / or treating postmenopausal osteoporosis, including let-7einhibitor.

[0007] Based on the above technical solution, the present invention has the following technical effects: This invention selects let-7e, which is upregulated in postmenopausal women, and designs and synthesizes let-7e inhibitors to neutralize it, thereby relieving its inhibition of osteogenic genes and promoting osteogenic function of osteoblasts. Simultaneously, it selects nanovesicles derived from bone marrow mesenchymal stem cells, which have anti-inflammatory effects, as a delivery vehicle for the let-7e inhibitor, thus providing preventative treatment for osteoporosis. Experimental results suggest that let-7e inhibitor-loaded nanovesicles derived from mouse bone marrow mesenchymal stem cells have a good preventative therapeutic effect on osteoporosis in mice after ovariectomy. The stem cell nanovesicle therapeutic platform based on let-7e inhibitor-loaded nanovesicles derived from mouse bone marrow mesenchymal stem cells holds promise for developing into a novel clinical intervention for the prevention of postmenopausal osteoporosis. Attached Figure Description

[0008] Figure 1 The effect of let-7e-5p on the expression of the downstream target gene col1a1.

[0009] Figure 2 The effect of let-7e-5p on the expression of the downstream target gene IGF-1.

[0010] Figure 3 The ultrastructure of nanovesicles under electron microscopy and the effect of ELISA detection on the inhibition of macrophage inflammatory factor release.

[0011] Figure 4 The data included various bone parameters of the control group and the let-7e inhibitor-treated group, as well as the let-7e inhibitor-loaded group of mouse bone marrow mesenchymal stem cell vesicles, as detected by MicroCT.

[0012] Figure 5 The result is from toluidine blue staining.

[0013] Figure 6 The results of Masson staining.

[0014] Figure 7 Results of Von kossa staining.

[0015] Figure 8 Results of Goldner staining. Detailed Implementation

[0016] Unless otherwise specified, the technical solutions described in this invention are all conventional solutions in the field, and the reagents or raw materials used are all purchased from commercial channels or are publicly available unless otherwise specified.

[0017] This invention provides the use of let-7e inhibitor in the preparation of medicaments for the prevention and / or treatment of postmenopausal osteoporosis.

[0018] In some specific implementations, let-7e inhibitors promote osteoblast function by increasing the gene expression of Igf-1r and col1a1.

[0019] This invention also provides a medicament for the prevention and / or treatment of postmenopausal osteoporosis, including let-7einhibitor.

[0020] In some specific implementations, the let-7e inhibitor is loaded in nanovesicles derived from bone marrow mesenchymal stem cells.

[0021] In some specific implementations, the method for preparing the bone marrow mesenchymal stem cell-derived nanovesicles is as follows: (1) The collected bone marrow cell clumps were blown to form a single-cell suspension. The cell suspension was passed through a 70 μm cell sieve to remove bone fragments and tissue blocks. The suspension was centrifuged at 500g for 5 minutes and the supernatant was discarded. (2) Add red blood cell lysis buffer, resuspend the cell pellet, incubate at room temperature for 3-5 minutes, add excess PBS to stop the reaction, centrifuge again at 500g for 5 minutes, and discard the supernatant; (3) Resuspend the cell pellet, inoculate it into DMEM medium for culture, and incubate it in a 37°C, 5% CO2 incubator for 2 days. After the cells have grown to confluence, digest them into a single-cell suspension. (4) The single-cell suspension is aspirated and installed at one end of the mini-Extruder, and an empty syringe is installed at the other end. The syringe piston is pushed to squeeze the membrane suspension through the polycarbonate membrane into the empty syringe at the other end. (5) Remove the syringe after squeezing once, turn it around, push the piston again to squeeze the liquid back in the opposite direction, and repeat this 5 times; (6) Add optiprep separation solution to the liquid after the cell suspension is squeezed by mini-Extruder, 100,000g, and centrifuge at low temperature and high speed for 2 hours. The separation layer obtained at the interface of 50% and 10% iodixanol layers is a high concentration of NV particles. The separation layer is further centrifuged at high speed of 120,000g to finally obtain bone marrow mesenchymal stem cell nanovesicle precipitate.

[0022] In some specific implementations, filter membranes of 10 μm, 5 μm, and 1 μm are placed inside the mini-extruder, respectively.

[0023] In some specific implementations, electroporation technology is used to introduce let-7e inhibitor into bone marrow mesenchymal stem cell nanovesicles. Example 1

[0024] 1. Osteoblast isolation and culture: Newborn mice euthanized under aseptic conditions at 24 hours of age, their skulls were completely removed, washed with pre-cooled PBS to remove blood stains, and repeatedly rinsed with PBS to remove attached brain tissue and connective tissue. The skull was then cut into pieces approximately 1-2 mm in size. 2Small bone fragments were collected. They were transferred to centrifuge tubes, and 0.25% trypsin-EDTA was added. The cells were digested at 37°C in a shaker for 15 minutes, discarding the digest as it mainly contained fibroblasts and other contaminating cells. Then, 0.1% type I collagenase solution was added, and the cells were digested at 37°C in a shaker for 60-90 minutes, gently agitating the cells every 20 minutes. The collagenase supernatant containing cells was collected into a new centrifuge tube, and an equal volume of complete culture medium was added to terminate the digestion. The remaining tissue fragments were then treated with fresh collagenase solution, and the digestion process was repeated 2-3 times to fully release the cells. All collected cell suspensions were centrifuged (1000 rpm, 5 minutes). The supernatant was discarded, and the cells were resuspended in complete culture medium and passed through a 100 μm cell sieve to remove undigested tissue. After cell counting, the cells were cultured at a suitable density of 5 × 10⁻⁶ cells / mL. 4 cells / cm 2 Seeds were placed in culture flasks / plates. Incubated at 37°C in a 5% CO2 incubator. The medium was changed for the first time after 24 hours to remove non-adherent cells, and thereafter every 2-3 days. When the primary cells reached 80%-90% confluence, induction was initiated using complete induction medium (DMEM high glucose + 10% FBS + 1% P / S) with osteogenic induction additives (50 μg / mL ascorbic acid + 10 mM β-glycerophosphate sodium + 100 nM dexamethasone). The induction medium was replaced with fresh medium every 2-3 days, and induction was continued for 14-21 days until obvious mineralized nodules formed.

[0025] 2. Osteoblast Transfection: Cell transfection was performed according to the Lipofectamine 3000 kit instructions. Transfection complexes were prepared for different groups, totaling five groups. The blank control group received no treatment. The other four groups (let-7e mimics, let-7e inhibitor, negative control, and inhibitor negative control) were prepared separately in two sterile EP tubes as solutions A and B. Solution A consisted of miRNA preparations diluted with serum-free medium (10 nM / well miRNA mimics, 20 nM / well miRNA inhibitor, 10 nM / well miRNA mimics negative control, 20 nM / well miRNA inhibitor negative control). Solution B consisted of transfection reagent diluted with serum-free medium at 0.5 μL / 10 μL / well, gently vortexed, and incubated at room temperature for 5 minutes. Solutions A and B were then mixed, gently pipetted to mix, and incubated at room temperature for 15-20 minutes. Add 20 μL of the transfection complex dropwise evenly to the cell culture medium in the corresponding well, gently shake the culture plate back and forth and left and right to mix it thoroughly, and put it back into the incubator for 48 hours.

[0026] 3. Western blot experiment: 3.1 Protein extraction from mouse osteoblasts: 1) Wash adherent cells three times with PBS, harvest cells with a cell scraper, centrifuge to collect the cells, wash once with PBS, and centrifuge to collect the cells.

[0027] 2) Add an appropriate amount of protein lysis buffer, lyse on ice for half an hour, and centrifuge at 12000 g, 4℃ for half an hour.

[0028] 3) Collect the supernatant, which is the protein lysis buffer, and store it in a refrigerator at -80°C.

[0029] 4) Determine protein concentration using a BCA kit. First, prepare a standard curve of BSA standard solution concentration versus absorbance, then calculate the concentration based on the absorbance value of the target protein solution.

[0030] 3.2 SDS-PAGE electrophoresis: 1) Gel pouring and electrophoresis: First, prepare the lower separating gel, 8% to 15% (the concentration depends on the molecular weight of the protein to be measured), flatten it with anhydrous ethanol, wait for the lower gel to solidify, pour off the anhydrous ethanol, pour in 5% upper stacking gel, insert a comb and wait for the upper gel to solidify.

[0031] 2) The protein loading amount for each lane is 60 μg. Add 5×SDS loading buffer to a final concentration of 1× and boil in boiling water for 10 minutes. Add electrophoresis buffer to the electrophoresis tank, put the prepared gel into the tank, remove the comb, add the protein sample, and use the pre-stained marker as the molecular weight standard.

[0032] 3) During electrophoresis, pass the stacking gel at a constant voltage of 80V, and then pass the separating gel at 150V. The electrophoresis time is determined based on the molecular weight of the protein being detected and the pre-stained marker.

[0033] 3.3 Transfer of film 1) Soak the nitrocellulose membrane and filter paper in the electrotransfer buffer beforehand.

[0034] 2) In a shallow tray filled with electrotransfer buffer, open the transfer cassette and stack the following materials in order from cathode (the black well plate of the transfer cassette) to anode (the white well plate of the transfer cassette): sponge pad, Whatman 3MM filter paper, electrophoresis-recovered polyacrylamide gel, nitrocellulose membrane (or PVDF membrane), Whatman 3MM filter paper, sponge pad. All materials should be pre-soaked in electrotransfer buffer, ensuring no air bubbles are left between layers. Close the transfer cassette and clamp the clips to form a polyacrylamide gel-membrane "sandwich".

[0035] 3) Insert the transfer box into the groove of the transfer device, fill it with electroporation buffer, and cool it with ice water while electroporating.

[0036] 4) Set the power conditions: 100V power for 1 hour and 20 minutes, then turn on the power.

[0037] 3.4 Immune Response After electroporation, the PVDF membrane was blocked in 10% skim milk blocking solution for 2 hours. The primary antibody incubation solution was diluted with TBST + 5% skim milk to an appropriate concentration, and incubated at room temperature with shaking for 2 hours. Then the primary antibody solution was discarded, and the membrane was washed several times with TBST on a shaker. The secondary antibody incubation solution was diluted with TBST + 5% skim milk to an appropriate concentration, and incubated at room temperature with shaking for 2 hours. The secondary antibody solution was discarded, and the membrane was washed several times with TBST on a shaker.

[0038] 3.5 Alkaline phosphatase chromogenic solution for color development and photography Place the nitrocellulose membrane in a small petri dish, add 10 ml of alkaline phosphatase colorimetric solution (freshly prepared), observe the degree of color development, and terminate the colorimetric reaction with distilled water as needed. Blot dry the membrane, take a picture, and store it in a cool, dark place.

[0039] 4. Alizarin Red Staining Detection in Osteoblasts: Fix cells (4% PFA, 30 min). Add 2% ARS solution (pH 4.1-4.3) and incubate for 20-30 min. Gently rinse away excess staining solution with water. Under a microscope, the orange-red / reddish-brown deposits are calcium nodules.

[0040] 5. Preparation of mouse bone marrow mesenchymal stem cell nanovesicles Six-week-old C57BL / 6 mice were euthanized by cervical dislocation and disinfected by immersion in 70% ethanol for 1-2 minutes. The femur and tibia were carefully removed using sterile instruments, and most of the muscle tissue attached to the bones was removed. The ends of the bones (epithels) were cut off to expose the medullary cavity. The medullary cavity was flushed with a 1mL syringe containing pre-chilled α-MEM complete culture medium, transferring the bone marrow to a new culture dish or centrifuge tube. Flushing was repeated until the medullary cavity turned white. The collected bone marrow cell clumps were gently pipetted repeatedly to form a single-cell suspension. The cell suspension was filtered through a 70 μm cell sieve into a 50mL centrifuge tube to remove bone fragments and tissue blocks. The tube was centrifuged at 500g for 5 minutes, and the supernatant was discarded. 2-3 mL of erythrocyte lysis buffer was added to gently resuspend the cell pellet. The tube was incubated at room temperature for 3-5 minutes, and excess PBS was added to terminate the reaction. The tube was centrifuged again at 500g for 5 minutes, and the supernatant was discarded. Resuspend the cell pellet in preheated complete culture medium, take a small amount of the cell suspension for cell counting, and then add 5 × 10⁻⁶ cells. 5Cells were seeded in cell culture flasks and cultured for 2 days at 37°C with 5% CO2. Mouse bone marrow mesenchymal stem cells were cultured in DMEM medium supplemented with 1% penicillin-dextrose antibody and 10% fetal bovine serum. The entire culture was controlled at 37°C with 5% CO2. Cells were passaged every two days. After the cells reached confluence, they were digested into a single-cell suspension. 1 mL of the cell membrane suspension was drawn into a 1 mL syringe and attached to one end of a mini-Extruder (Sigma Aldrige Company). An empty syringe was attached to the other end. The syringe plunger was slowly and steadily pushed to squeeze the membrane suspension through the polycarbonate membrane into the empty syringe. The syringe was removed after one squeeze, the direction was reversed, and the plunger was pushed again to squeeze the liquid back in the opposite direction. This process was repeated 5 times. 10-μm, 5-μm, and 1-μm filter membranes were placed inside the mini-Extruder. OptiP separation buffer was added to the liquid after the cell suspension was squeezed through the mini-Extruder, and the mixture was centrifuged at low temperature and high speed (100,000 g, 2 hours) at the interface of 50% and 10% iodixanol layers. The resulting separated layer contained high-concentration NV particles. The separated layer was further centrifuged at 120,000 g to obtain mouse bone marrow mesenchymal stem cell nanovesicles. After resuspending in PBS, the precipitate was aliquoted and stored at -80°C. Under external force, the cell membrane ruptured and reorganized, forming uniformly sized, closed nanovesicles with cell membrane structure and function.

[0041] 6. miRNA translocation into vesicles via electroporation Let-7e inhibitor (purchased from Shanghai Gemma Gene) was introduced into the cavities of nanovesicles using electroporation. The nanovesicles and let-7e inhibitor were mixed with serum-free culture medium and then added to a 0.4 cm electroporation cup and placed on ice for 5 min. Under the same electroporation conditions (0.7 kV, 350 μs, 20 pulses), the nanovesicles were click-loaded using an Eppendorf multiporator.

[0042] 7. Macrophage isolation and culture Six-week-old C57BL / 6 mice were euthanized by cervical dislocation and disinfected by immersion in 70% ethanol for 1-2 minutes. Using sterile instruments, the femur and tibia were carefully removed, and most of the muscle tissue attached to the bones was discarded. The ends of the bones (epithels) were cut off to expose the medullary cavity. The medullary cavity was flushed with a 1 mL syringe containing pre-cooled DMEM complete culture medium, transferring the bone marrow to a new culture dish or centrifuge tube. Flushing was repeated until the medullary cavity turned white. The collected bone marrow cell clumps were gently pipetted repeatedly to form a single-cell suspension. The cell suspension was filtered through a 70 μm cell strainer into a 50 mL centrifuge tube to remove bone fragments and tissue blocks. The tube was centrifuged at 500g for 5 minutes, and the supernatant was discarded. 2-3 mL of erythrocyte lysis buffer was added to gently resuspend the cell pellet. The tube was incubated at room temperature for 3-5 minutes, and excess PBS was added to terminate the reaction. The tube was centrifuged again at 500g for 5 minutes, and the supernatant was discarded. Resuspend the cells in complete culture medium containing 20-40 ng / mL M-CSF, and then incubate the cells at 5 × 10⁻⁶ ppm. 5 Seeds were inoculated into culture dishes at a density of 100 ng / mL. M1 polarization could be induced with LPS (100 ng / mL) + IFN-γ (20 ng / mL) as needed for the experiment.

[0043] 8. ELISA Detection of Inflammatory Factors: Purchase a commercially available kit for inflammatory factors (such as Mouse TNF-α, Mouse IL-1, and Mouse IL-6). When culturing cells, centrifuge (e.g., 1000×g, 5 min) to remove cell debris. Collect the supernatant for immediate detection or aliquot and store at -80℃, avoiding repeated freeze-thaw cycles. Remove all components of the kit (including standards, detection antibodies, enzymes, etc.) from the -20℃ freezer and allow to equilibrate to room temperature for approximately 30 minutes. Standards must be completely dissolved before dilution. Perform serial dilutions of the standards strictly according to the instructions to establish an 8-point standard curve (including one zero-concentration standard). Set up three replicates for each sample, adding 100 μL of standard or test sample to each well. Follow all kit instructions strictly for all steps.

[0044] 9. Establishment of a mouse ovariectomy animal model via surgery Select 15-week-old C57BL / 6 mice. Acclimate them to their living environment for one week before surgery, fast them for 4-6 hours preoperatively (water is permitted), and administer 3% isoflurane inhalation anesthesia. Remove hair from the lumbar region of the back (approximately 1 cm behind the last rib) using a shaver. Disinfect the surgical area sequentially with iodine and 75% alcohol, repeating the disinfection 2-3 times. Drape the area with a sterile drape. Make an incision approximately 0.5 cm lateral to the spine and below the last rib using a scalpel. Bluntly dissect the subcutaneous connective tissue to expose the underlying muscle layer. After separating the muscles, a white fat pad (retroperitoneal fat) will automatically ooze from the incision. Gently remove the fat pad with curved toothless forceps. The ovary is usually tightly attached to the end of the fat pad, appearing as a pale pink, translucent, granular structure, about the size of a millet grain. Ligate the uterine horn above the junction of the fallopian tube with a pre-placed silk suture (ensuring a secure ligation). Repeat steps 1-5 at the symmetrical location on the opposite side of the same mouse to complete the removal of the other ovary. Use iris scissors to cut the ovary on the side away from the ligation point, completely removing the ovary.

[0045] 10 ovariectomized mice were divided into three groups and administered the drug via tail vein injection.

[0046] The experimental animals were divided into three groups: a blank control group, a group that was injected with let-7e inhibitor alone, and a group that was injected with nanovesicles derived from umbilical cord mesenchymal stem cells containing let-7e inhibitor.

[0047] Using a 1mL insulin syringe with a 29G ultrafine needle, draw up the accurate dose of insulin, removing any air bubbles. Place the mouse in a restraint, adjusting its position so that its tail is fully exposed. Soak the tail in 50℃ warm water for 1-2 minutes, then thoroughly dry it with gauze. Wipe the injection site with a 75% alcohol swab; this disinfects the area and makes the veins more visible. Hold the tail tip with the hand not holding the syringe, gently straightening and securing the tail. Position the needle bevel upwards at an angle of approximately 5-10 degrees to the tail, with the needle tip lightly against the skin. Then, insert the needle smoothly and decisively to a depth of approximately 2-4mm. Once blood return is observed, keep the needle tip absolutely stable and slowly and evenly inject the insulin directly into the dorsal tail vein. After injection, gently press a dry gauze or alcohol swab onto the injection site, then quickly withdraw the needle, maintaining pressure for 15-30 seconds to prevent bleeding. The simple let7e-inhibitor injection group received injections twice a week at a dose of 50 nmol per injection. The injection group encapsulated with let7e-inhibitor nanovesicles received injections once a week at a dose of 100 μg / kg of NVs containing 50 nmol of let7e-inhibitor. The blank control group received an equal volume of physiological saline.

[0048] 11 MicroCT Detection Three samples were randomly selected from each of the experimental animals in the blank control group, the let-7e-inhibitor injection group, and the group containing let-7e inhibitor-encapsulated umbilical cord mesenchymal stem cell-derived nanovesicles. Bone microstructure parameters were obtained using a Quantum FX Micro-CT scanner (Revvity, USA). During scanning, the femur was fixed along its long axis within the imaging chamber. The voltage was set to 70 kV, the current to 100 μA, the FOV to 10 mm, the pixel size to 20 μm, and the scanning time to 3 min. The proximal bulge of the left femoral neck was selected as the region of interest. Images and analysis results were obtained using Analyze 15.0 software. The relevant parameters for whole bone quantitative analysis are as follows: mean bone mineral density (TrabeculaeMean BMD), total volume (TV), bone volume (BV), bone surface area (BS), bone volume fraction (BV / TV), bone surface area density (BS / TV), bone specific surface area (BS / BV); number of trabeculae (Tb.N); trabecular thickness (Tb.Th), trabecular separation (Tb.Sp), standard deviation of trabecular thickness (Tb.Th.SD), standard deviation of trabecular separation (Tb.Sp.SD), structural model index (SMI), connectivity density (Conn.D), cortical bone area (Ct.Ar), and cortical bone area fraction (Ct.Ar / Tt.Ar).

[0049] 12. Staining of tissue sections After euthanizing all mice in the blank control group, the let7e-inhibitor injection group, and the group containing let-7e inhibitor-derived umbilical cord mesenchymal stem cell nanovesicles, femurs were rapidly removed and immediately placed in a sufficient amount of 4% paraformaldehyde (PFA) fixative and fixed at 4°C for 24-48 hours. The fixation time depends on the size of the bone block to ensure complete tissue fixation. Decalcification was performed using 10% EDTA (pH 7.2-7.4), a time-consuming process requiring approximately 2-4 weeks and regular replacement of the solution. The decalcified bone tissue was then dehydrated using a gradient of alcohols (e.g., 70%, 80%, 90%, 95%, 100%). Clearing agents such as xylene were used. The tissue was then immersed in paraffin at 60°C. Finally, the tissue was embedded into paraffin blocks using a paraffin embedding machine, and the embedded blocks were cut into 4-7 μm sections using a paraffin microtome. The sections were retrieved from glass slides and baked in a 60°C oven for several hours to ensure tight adhesion. Before staining, dewax the sections to water, then immerse them in the following solutions in sequence: xylene I → xylene II (10-15 minutes each), 100% ethanol I → 100% ethanol II (3-5 minutes each), 95% ethanol → 80% ethanol → 70% ethanol (2-3 minutes each), and finally rinse with distilled water (2-3 minutes).

[0050] 12.1 Toluidine Blue Staining Immerse the dewaxed sections in 0.5% toluidine blue working solution and stain at room temperature for 3-10 minutes. Remove the sections and rinse quickly with distilled water to remove any excess stain. Dissociate rapidly with 95% ethanol for a few seconds (1-5 seconds). Rinse gently again with distilled water to stop differentiation. Quickly pass the sections through the following solutions in sequence: 95% ethanol (quick pass), 100% ethanol I → 100% ethanol II (30-60 seconds each), xylene I → xylene II (2-3 minutes each) until clear. While the sections are still wet, immediately add neutral resin, cover with a coverslip, and avoid creating air bubbles.

[0051] 12.2 Von kossa dyeing After dewaxing and hydration, the sections were immersed in a 5% silver nitrate aqueous solution, and the container was placed under a UV lamp for 60 minutes. The sections were then fixed in a 5% sodium thiosulfate solution. The sections were thoroughly rinsed with distilled water 2-3 times, and the cell nuclei were counterstained with Nuclear Fast Red for 5-10 minutes. The sections were then quickly rinsed with distilled water. The sections were then rapidly dehydrated sequentially through a gradient of 50%, 70%, 95%, and 100% ethanol, approximately 30 seconds per stage. The sections were then cleared twice in xylene or a substitute, 2-3 minutes each time, and mounted with neutral resin.

[0052] 12.3 Goldner staining After dewaxing and hydration, section the slides and stain the nuclei with Weigert's iron hematoxylin solution for 5-10 minutes. Rinse with running water for 10 minutes, or until the slides turn blue (blue return). Immerse in Ponceau S-Acid Fuchsin solution for 5-10 minutes, rinse quickly with 0.2% glacial acetic acid solution (<30 seconds), immerse in phosphotungstic acid-phosphomolybdic acid solution for 5-10 minutes, and counterstain directly with Brilliant Green solution for 3-5 minutes without rinsing. Rinse twice quickly with 0.2% glacial acetic acid solution (approximately 10-20 seconds each time) to stop the Brilliant Green reaction and remove excess dye. Dehydrate rapidly in 95% ethanol, 100% ethanol (I), and 100% ethanol (II) sequentially, approximately 30 seconds to 1 minute each time. Clear twice in xylene or a substitute, 3-5 minutes each time. Mount with neutral resin.

[0053] 12.4 Masson staining Stain with Weigert iron hematoxylin solution (mix solutions A and B fresh for use) for 5-10 minutes. Add Ponceau S and acid fuchsin solution and stain for 5-10 minutes. Rinse briefly with distilled water. Treat with phosphomolybdic acid / phosphotungstic acid solution for 5-10 minutes. This step is crucial; it removes the red color from muscle fibers and cytoplasm while retaining the red color in collagen fibers. Discard the phosphomolybdic acid solution; no rinsing with water is necessary. Add aniline blue solution directly and stain for 3-5 minutes. Collagen fibers will be stained blue. Treat with 1% glacial acetic acid solution for 1 minute to wash away excess dye and achieve color separation. Quickly dehydrate through a gradient of alcohols, clear with xylene I and II, and mount with neutral resin.

[0054] Experimental results: 1. For example Figure 1-2 As shown, osteoblasts were divided into five groups. The blank control group received no treatment, while the other four groups were transfected with let-7e mimics, let-7e inhibitor, negative control, and inhibitor negative control, respectively. Western blotting results of protein extraction 7 days after transfection indicated that overexpression of let-7e-5-inhibitor in mouse osteoblasts could increase the gene expression of IgF-1r and col1a1, and promote osteoblast function.

[0055] 2. Figure 3 As shown, ovariectomy resulted in a sharp drop in estrogen levels compared to normal age-matched female mice, triggering chronic inflammation, which activated osteoclasts, promoted bone resorption, and disrupted bone homeostasis. Compared to mouse macrophages cultured in the normal control group, mouse bone marrow mesenchymal stem cell-derived nanovesicles exhibited anti-inflammatory effects, thus playing a positive role in the preventative treatment of osteoporosis through anti-inflammatory mechanisms.

[0056] 3. Figure 4 As shown, using a mouse model of postmenopausal osteoporosis induced by ovariectomy, micro-CT and bone tissue section staining were used to detect that bone marrow mesenchymal stem cell-derived nanovesicles loaded with let-7e inhibitors played a positive preventive and therapeutic role in osteoporosis.

[0057] 4. Because the mature sequence of mouse let-7e-5p is highly homologous to the human gene sequence, and the target gene binding sequence also has high homology, previous studies have reported that both human and mouse BMSCs can inhibit inflammation. Therefore, let-7e inhibitors loaded into nanovesicles derived from bone marrow mesenchymal stem cells have therapeutic potential in the preventive treatment of postmenopausal osteoporosis in humans.

[0058] hsa-let-7e-5p Sequence: TGAGGTAGGAGGTTGTATAGTT; mmu-let-7e-5p Sequence: TGAGGTAGGAGGTTGTATAGTT.

[0059] 5. Figure 5-8 As shown, toluidine blue staining results indicated a significant increase in the number of trabeculae in the metaphysis, the region of most active bone metabolism, in both the Let-7e inhibitor-only treatment group and the bone marrow mesenchymal stem cell vesicle-loaded Let-7e inhibitor treatment group. Masson staining results indicated a significant increase in the blue bone tissue area in both groups. Von Kossa staining results indicated a significant increase in the black mineralized area in the metaphysis, the region of most active bone metabolism, in both groups. Goldner staining results indicated a significant increase in the proportion of green mature mineralized bone in the metaphysis, the region of most active bone metabolism, in both the Let-7e inhibitor-only treatment group and the bone marrow mesenchymal stem cell vesicle-loaded Let-7e inhibitor treatment group. Using a mouse model of postmenopausal osteoporosis induced by ovariectomy, the results of tissue section staining indicated that both the let-7e inhibitor treatment group and the bone marrow mesenchymal stem cell vesicle-loaded let-7e inhibitor treatment group played a positive preventive and therapeutic role in osteoporosis.

[0060] This invention, through dual-luciferase reporter gene assays and Western blot analysis, confirms that let-7e inhibitor can enhance osteoblast activity by targeting and regulating the expression of IgF-1r and col1a1 genes, demonstrating its therapeutic potential in preventing osteoporosis. Using an ovariectomized (OVX) mouse model, let-7e inhibitor was encapsulated in nanovesicles derived from mouse bone marrow mesenchymal stem cells and delivered systemically via tail vein injection. Experimental results show that this delivery system significantly reduces the required dose of let-7e inhibitor, exhibits good biosafety and delivery efficiency, and effectively prevents the occurrence of osteoporosis. Due to the high similarity in pathological mechanisms between mouse osteoporosis models and human osteoporosis, and the high conservation of mouse miRNA sequences between mouse and human homologous miRNA sequences, the therapeutic strategy of loading let-7e inhibitor onto nanovesicles derived from bone marrow mesenchymal stem cells has enormous application potential and prospects in the treatment of human osteoporosis.

[0061] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively describe all embodiments here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. Use of let-7e inhibitor in the preparation of a drug for preventing and / or treating postmenopausal osteoporosis.

2. Use according to claim 1, characterized in that, The let-7e inhibitor promotes the osteogenic function of osteoblasts by increasing the gene expression of Igf-1r and col1a1.

3. A medicine for preventing and / or treating postmenopausal osteoporosis, characterized by, The let-7e inhibitor is loaded in a mesenchymal stem cell-derived nanovesicle.

4. The medicament according to claim 3, characterized in that, The let-7e inhibitor is loaded in a mesenchymal stem cell-derived nanovesicle.

5. The medicament according to claim 4, characterized in that, The preparation method of the mesenchymal stem cell-derived nanovesicle is as follows: (1) Blow the collected bone marrow cell mass to make it a single cell suspension, pass the cell suspension through a 70 μm cell screen to remove bone fragments and tissue blocks, centrifuge at 500g for 5 minutes, and discard the supernatant; (2) Add red blood cell lysis solution, resuspend the cell pellet, incubate at room temperature for 3-5 minutes, add excess PBS to terminate the reaction, centrifuge at 500g for 5 minutes again, and discard the supernatant; (3) Resuspend the cell pellet and inoculate in DMEM medium for culture, place in a 37°C, 5% CO2 incubator for 2 days, and then digest into a single cell suspension when the cells are fully grown; (4) Take the single cell suspension and install it into one end of a mini-Extruder extruder, install an empty syringe at the other end, push the syringe plunger, and extrude the membrane suspension through the polycarbonate membrane into the empty syringe at the other end; (5) Remove the syringe after one extrusion, reverse the direction, push the plunger again, and extrude the liquid back in the opposite direction, and repeat this 5 times; (6) Add optiprep separation solution to the liquid after the cell suspension is extruded through the mini-Extruder, centrifuge at 100,000g for 2 hours at low temperature and high speed, obtain the separation layer of high concentration NV particles at the interface between 50% and 10% iodixanol layers, and continue to centrifuge the separation layer at 120,000g to obtain a mesenchymal stem cell nanovesicle precipitate.

6. The medicament according to claim 5, characterized in that, The mini-Extruder is respectively provided with 10-μm, 5-μm and 1-μm filter membranes.

7. The medicament according to claim 6, characterized in that, The let-7e inhibitor is introduced into the mesenchymal stem cell nanovesicle by using electroporation technology.

Images