Application of Chinese knotweed rhizome and aloe bowel-relaxing composition in drugs for inducing macrophage M1 type differentiation to resist helicobacter pylori inflammation

Abstract

The invention relates to the technical field of medicines, relates to a novel application of a fallopia multiflora and aloe bowel-relaxing composition in the fields of immunoregulation and inflammation intervention, and in particular relates to an application of the fallopia multiflora and aloe bowel-relaxing composition in a medicine for inducing macrophage M1 type differentiation to resist helicobacter pylori inflammation. The fallopia multiflora and aloe bowel-relaxing composition consists of fallopia multiflora, semen cassiae, immature bitter orange, aloe, donkey-hide gelatin, medlar, bighead atractylodes rhizome and ginseng. Experiments show that the fallopia multiflora and aloe bowel-relaxing composition has new functions of promoting M1 type differentiation of macrophages and enhancing innate immunity, and the application of the fallopia multiflora and aloe bowel-relaxing composition in interference of helicobacter pylori inflammation is further verified.

Description

Technical Field

[0001] This invention relates to the field of pharmaceutical technology, and to a new application of the Shouhui laxative composition in the fields of immune regulation and inflammation intervention, specifically to the application of a Shouhui laxative composition in a drug for inducing macrophage M1 differentiation and combating Helicobacter pylori inflammation. Background Technology

[0002] Macrophages, as core effector cells of the innate immune system, play a crucial role in defending against Helicobacter pylori (H. pylori) infection. However, macrophages exhibit significant "functional polarization," differentiating into functionally opposing M1 and M2 subtypes. M1 macrophages are activated by IFN-γ and LPS in the early stages of H. pylori infection, directly enhancing their phagocytic and killing capabilities against H. pylori and activating adaptive immune responses to form a coordinated defense network. M2 macrophages, responding to stimuli such as IL-4, IL-13, and IL-10, dominate in the later stages of chronic infection. While participating in tissue repair, excessive polarization can lead to incomplete bacterial clearance, exacerbate chronic inflammation, and is associated with gastric mucosal fibrosis and precancerous lesions.

[0003] Regulating macrophage differentiation into the M1 type can significantly enhance H. pylori clearance efficiency and alleviate inflammatory damage. Experimental studies have shown that the TLR4 agonist lipopolysaccharide (LPS) drives M1 polarization by activating the TLR4 signaling pathway on the macrophage surface, upregulating the expression of pro-inflammatory genes. In animal models, TLR4 activation enhances the gastric mucosa's ability to clear H. pylori, reduces bacterial load, and improves inflammatory pathology. Furthermore, other M1 polarization inducers such as IFN-γ and bacterial peptidoglycan also exert synergistic effects through pathways such as JAK-STAT1 and MAPK, confirming the therapeutic potential of M1 polarization regulation.

[0004] While LPS, a typical M1 inducer, has shown significant efficacy in experiments, its clinical application is limited. Its high toxicity (e.g., causing fever, shock, and even fatal endotoxemia) and systemic inflammatory risks (uncontrollable systemic immune activation) prevent its direct use. Furthermore, its lack of specificity (affecting multiple immune cells such as dendritic cells and neutrophils) makes it difficult to precisely regulate the local immune microenvironment of the gastric mucosa. In addition, LPS has low oral bioavailability, high toxicity risks with injection, and dosage control and individual variability further restrict its application.

[0005] Given the current challenges of standard bismuth quadruple therapy, including rising antibiotic resistance, gut microbiota dysbiosis, and high relapse rates, coupled with the lack of targeted immunomodulatory strategies, developing novel, low-toxicity, and highly effective inducers that selectively induce local M1 polarization in the gastric mucosa has become a key direction for overcoming the treatment bottleneck of H. pylori.

[0006] Shouhui Laxative Composition, a compound preparation composed of multiple traditional Chinese medicines such as Polygonum multiflorum and Aloe vera, has previously been clinically applied and studied primarily for its "laxative" effects, promoting intestinal peristalsis and improving intestinal water absorption to treat functional constipation. Its role in immune regulation has not yet been studied. Currently, no research reports any association between Shouhui Laxative Composition and macrophage polarization, and there is a lack of exploration into its interventional effects and mechanisms on Helicobacter pylori-related inflammation. Summary of the Invention

[0007] In view of the shortcomings of existing Helicobacter pylori inflammation interventions, namely "high drug resistance, large side effects, and weak targeting", this invention, based on our company's patent CN100453105C, entitled "A composition with laxative, detoxifying, weight loss and lipid-lowering functions and its preparation method", develops a new application, specifically the application of a Shouhui laxative composition in drugs that induce macrophage M1 differentiation to fight Helicobacter pylori inflammation.

[0008] The components of the composition of the present invention are prepared or extracted according to the preparation or extraction method of each component in the composition and preparation method of the patent CN100453105C, which has the functions of relieving constipation and detoxification, weight loss and lipid reduction.

[0009] The traditional Chinese medicine composition Shouhui laxative composition of the present invention consists of: Polygonum multiflorum, Cassia seed, Citrus aurantium, Aloe vera, donkey-hide gelatin, Lycium barbarum, Atractylodes macrocephala, and ginseng.

[0010] The components of the composition, by weight, are: 80-140 parts of Polygonum multiflorum, 100-170 parts of Cassia tora, 80-180 parts of Citrus aurantium, 80-210 parts of Aloe vera, 40-140 parts of Colla corii asini, 40-160 parts of Lycium barbarum, 20-80 parts of Atractylodes macrocephala, and 20-90 parts of Ginseng; preferably, the composition is: 120 parts of Polygonum multiflorum, 140 parts of Cassia tora, 120 parts of Citrus aurantium, 160 parts of Aloe vera, 75 parts of Colla corii asini, 75 parts of Lycium barbarum, 50 parts of Atractylodes macrocephala, and 50 parts of Ginseng.

[0011] The first-grade laxative composition of the present invention has novel functions of promoting macrophage M1 differentiation and enhancing innate immunity. The present invention clarifies its use in the intervention of Helicobacter pylori inflammation through the verification of examples.

[0012] Preferably, the application includes asymptomatic carriers of Helicobacter pylori, chronic gastritis, peptic ulcers, MALT lymphoma, and precancerous lesions of the stomach, which can achieve efficient eradication and reduce the risk of gastric mucosal atrophy, intestinal metaplasia, and gastric cancer transformation.

[0013] The first-grade laxative composition of the present invention can be prepared into medicines, health products and food. The medicines include conventional dosage forms such as capsules, granules and decoctions. The health products include, but are not limited to, tea bags, solid beverages and dietary supplements. The food is made from medicinal and edible herbs and prepared into functional ingredients or health foods.

[0014] Preferably, in the stated use, the composition of the present invention can be used in combination with antibiotics for the prevention or treatment of Helicobacter pylori infection.

[0015] The objective of this invention is mainly achieved through the following technical solutions:

[0016] Examples 1, 3, and 4 demonstrate that the Shouhui laxative composition regulates the secretion of inflammation-related factors, which was verified by detecting NO concentration, TNF-α and IL-6 content in cell supernatant (ELISA method), and intracellular RT-qPCR level.

[0017] Example 2 shows that the Shouhui laxative composition enhances innate immune function, which is verified by detecting the macrophage phagocytic rate level.

[0018] Examples 4 and 5 show that the Shouhui laxative composition promotes macrophage differentiation into the M1 type, which is verified by detecting the expression levels of the CD86 marker gene on the macrophage surface and the intracellular iNOS protein.

[0019] The traditional Chinese medicine composition of this invention is formulated from Polygonum multiflorum, Cassia tora, Citrus aurantium, Aloe vera, Colla corii asini, Lycium barbarum, Atractylodes macrocephala, and Panax ginseng in a specific ratio. Each component plays a synergistic role in promoting the differentiation of macrophage M1 type, enhancing innate immunity, and inhibiting Helicobacter pylori inflammation, as detailed below:

[0020] In the traditional Chinese medicine composition of this invention, Polygonum multiflorum (He Shou Wu) has a bitter, sweet, and astringent taste, is slightly warm in nature, and enters the liver and kidney meridians. It has the effects of tonifying the liver and kidneys, nourishing essence and blood, blackening hair, strengthening tendons and bones, and moistening the intestines to relieve constipation. The active ingredient in Polygonum multiflorum, emodin, can regulate the immune microenvironment by inhibiting tumor cell proliferation and inducing apoptosis. Furthermore, the ethyl acetate extract of Polygonum multiflorum can arrest the G2 phase of the cell cycle, induce apoptosis in vitro, and inhibit tumor growth and angiogenesis in vivo, providing a basis for clearing abnormal cells related to Helicobacter pylori infection.

[0021] In the traditional Chinese medicine composition of this invention, cassia seed is bitter, sweet, and slightly cold in nature, and enters the liver and kidney meridians, possessing the functions of clearing the liver and improving eyesight, promoting diuresis and relieving constipation. The anthraquinone compounds it contains, such as rhein, emodin, and chrysophanol, have a strong inhibitory effect on the growth of Helicobacter pylori, directly reducing pathogen load and helping to alleviate inflammatory triggers.

[0022] In the traditional Chinese medicine composition of the present invention, Fructus Aurantii Immaturus is bitter, pungent, sour and slightly cold in nature, and belongs to the spleen and stomach meridians. It has the effects of breaking qi to eliminate accumulation and resolving phlegm to disperse mass, can bidirectionally regulate gastrointestinal smooth muscle, and improve gastrointestinal qi stagnation. The prescription with Fructus Aurantii Immaturus as the core can increase the levels of pepsinogen and serum gastrin in patients with Helicobacter pylori-related gastritis, directly inhibit the gastric mucosal inflammatory reaction, and synergistically improve the gastrointestinal microenvironment with other components.

[0023] In the traditional Chinese medicine composition of the present invention, Aloe Vera is cold in nature and bitter in taste, and belongs to the liver and large intestine meridians. It has the effects of purging, clearing the liver and killing parasites. The antibacterial substances contained in it, such as aloe-emodin and aloin, can interfere with the cell wall structure of Helicobacter pylori and inhibit its growth and reproduction; at the same time, the anti-inflammatory effect of aloe can reduce gastric mucosal inflammation and excessive gastric acid secretion, and the antioxidant substances can reduce the oxidative stress caused by Helicobacter pylori infection and reduce gastric mucosal cell damage, providing a good tissue environment for macrophages to exert immune functions.

[0024] In the traditional Chinese medicine composition of the present invention, Colla Corii Asini is mild in nature and sweet in taste, and has the effects of enriching blood and nourishing yin, etc. Its unique polyanionic group structure can increase the resistance to bacterial perforation in immune and inflammatory reactions, form a gastric mucosal protection barrier, promote the repair and healing of gastric mucosa after Helicobacter pylori infection, and assist in the subsidence of inflammation.

[0025] In the traditional Chinese medicine composition of the present invention, Rhizoma Atractylodis Macrocephalae can scavenge oxygen free radicals in the body, reduce the inhibition of immune cells by oxidative damage, and at the same time regulate the immune function of the body, providing a stable immune internal environment for macrophage activation and M1 type differentiation.

[0026] In the traditional Chinese medicine composition of the present invention, Radix Ginseng is sweet, slightly bitter, and slightly warm in nature, and belongs to the spleen, lung, heart and kidney meridians. It has the effects of greatly tonifying primordial qi and invigorating the spleen and benefiting the lung. The acidic polysaccharide contained in it can inhibit the adhesion of Helicobacter pylori to human gastric adenocarcinoma epithelial cells, reduce pathogen colonization, and at the same time enhance the activity of immune cells and synergistically promote the activation of macrophage function.

[0027] In the traditional Chinese medicine composition of the present invention, Fructus Lycii has the effects of nourishing the liver and kidney and improving eyesight with essence. It can assist in enhancing the innate immune response by regulating the secretion of immune factors, and synergistically maintain immune balance with other components.

[0028] Compared with the prior art, the present invention has the following outstanding advantages:

[0029] 1. The new application of the Shouhui Laxative Composition of the present invention in promoting macrophage M1 type differentiation, enhancing innate immunity and reducing Helicobacter pylori-related inflammation can not only expand its clinical uses, but more importantly, provide a new "low-toxicity, targeted, safe" intervention plan for Helicobacter pylori-related inflammation, with important clinical value and innovative significance.

[0030] 2. Breaking through the limitations of the application scenarios of the Shouhui laxative composition and providing its new uses: By verifying the effect of the Shouhui laxative composition in promoting the differentiation of macrophage M1 type, clarifying its effect of activating innate immunity and reducing Helicobacter pylori inflammation, filling the technological gap of traditional Chinese medicine in this field.

[0031] 3. The first-grade laxative composition of the present invention can improve the treatment success rate of Helicobacter pylori-related inflammation, meet the needs of individualized medication, and has significant preventive, early intervention and disease reversal effects.

[0032] 4. This invention provides a novel application of the Shouhui laxative composition for combating Helicobacter pylori, and experimental verification demonstrates its significant inhibitory effect on Helicobacter pylori. The combination of drugs in the formula may achieve comprehensive body conditioning by regulating the functions of the internal organs and the circulation of Qi and blood, rather than treating only a single symptom. This invention's novel application of the Shouhui laxative composition establishes a mechanism of action of "traditional Chinese medicine compound → macrophage polarization → innate immune regulation," providing new insights into the research of the immune regulation mechanism of traditional Chinese medicine. Attached Figure Description

[0033] Figure 1 The effects of different concentrations of *Sophora flavescens* and *H. pylori* treatment on NO content in RAW 264.7 cells were investigated in Example 1.

[0034] Figure 2 The effects of different concentrations of Sophora flavescens and H. pylori treatment on the phagocytic rate of RAW 264.7 cells were investigated in Example 2.

[0035] Figure 3 shows the effects of different concentrations of Sophora flavescens and H. pylori treatment on the levels of inflammation-related cytokines secreted by RAW 264.7 cells in Example 3.

[0036] Figure 4 shows the effect of Shouhuitongbian on the expression of inflammatory genes in H. pylori-induced RAW 264.7 cells, as analyzed by RT-qPCR in Example 4.

[0037] Figure 5 shows the effect of Western blotting on the expression of related proteins by Shouhuitong in Example 5. Detailed Implementation

[0038] The following specific embodiments further illustrate the present invention, but do not limit the scope of the present invention in any way. Those skilled in the art can make various modifications or improvements based on the basic idea of ​​the present invention, but as long as they do not depart from the basic idea of ​​the present invention, they are all within the scope of the present invention.

[0039] The Shouhui Tongbian Capsule Dry Extract (SHTB) used in the following embodiments of the present invention was produced by Lunan Houpu Pharmaceutical Co., Ltd. Strains: Helicobacter pylori standard strain ATCC700392. Cell line: Mouse mononuclear macrophage leukemia cells RAW264.7.

[0040] Example 1: Effects of different concentrations of *H. pylori* laxative and *H. pylori* treatment on NO content in RAW 264.7 cells.

[0041] RAW 264.7 cells were treated with different concentrations of SHTB (160, 320, and 640 μg / mL) for 24 h, while ATCC700392 strain (MOI = 100:1) was added to stimulate the cells. The control group did not receive this strain. The control groups in other examples were treated similarly, consisting only of cells and culture medium. Cell supernatants were collected, and NO activity was assessed using a Griess reagent kit. Absorbance at 540 nm was measured using a CLARIO star microplate reader.

[0042] The results show that: Figure 1 As shown, compared with the control group, the NO content in the model group (HP group, which was induced by H. pylori) was significantly increased (P < 0.001); while compared with the model group, the use of SHTB at concentrations of 160–640 μg / mL significantly inhibited the increase in intracellular NO level in RAW 264.7 cells induced by H. pylori (P < 0.01, 0.001).

[0043] Example 2: Effects of different concentrations of *H. pylori* laxative and *H. pylori* treatment on the phagocytic rate of RAW 264.7 cells.

[0044] RAW 264.7 cells were cultured at a rate of 2 × 10⁻⁶. 4Cells were seeded at a density of 10 cells / well in 96-well cell culture plates and cultured until adherence. Then, 80 μg / mL, 160 μg / mL, and 320 μg / mL of a suitable antibiotic were added, along with ATCC700392 strain (MOI = 100:1) to stimulate cell growth, followed by incubation for 24 h. After intervention, the culture medium in each well was discarded, and 100 μL of 0.08% neutral red staining solution was added to each well. The cells were incubated at 37°C and 5% CO2 in the dark for 1 h. The staining solution was then discarded, and the cells were gently washed three times with pre-cooled PBS buffer. Finally, an appropriate amount of cell lysis buffer was added to each well, and the absorbance of each well was measured at 540 nm using a microplate reader. Background wells (containing only culture medium, no cells) were included to exclude non-specific absorption interference. Phagocytic activity was expressed as relative phagocytosis rate, calculated as: Relative phagocytosis rate (%) = (OD drug-treated wells - OD background wells) / (OD blank control wells - OD background wells) × 100%.

[0045] Phagocytosis is an important indicator for evaluating the immune activity of macrophages. Results showed that: Figure 2 As shown, compared with the control group, the phagocytic rate of the model group (HP group, which was induced by H. pylori) was significantly increased (P < 0.001); while compared with the model group, the use of SHTB at concentrations of 160–640 μg / mL could significantly inhibit the increase in phagocytic rate of RAW 264.7 cells induced by H. pylori (P < 0.01).

[0046] Example 3: Effects of different concentrations of *H. pylori* laxative and *H. pylori* treatment on the levels of inflammation-related cytokines secreted by RAW 264.7 cells.

[0047] RAW 264.7 cells were planted at a density of 4 × 10⁶ cells per well. 5 Cells were seeded at a density of [number] cells per well in 6-well plates and co-cultured with ATCC 700392 strain (MOI = 100:1) at different concentrations of [unspecified ingredient] (160–640 μg / mL) for 24 h. Subsequently, the cell culture supernatant was collected and centrifuged. The levels of IL-6 and TNF-α were measured using an enzyme-linked immunosorbent assay (ELISA) kit, following the kit instructions. The absorbance at 450 nm was measured using a CLARIOstar microplate reader.

[0048] The results show that, Figure 3-1 and 3-2As shown, compared with the control group, the expression levels of inflammatory factors IL-6 and TNF-α were increased in the H. pylori-induced model group (HP group) (P<0.001); compared with the model group, the expression levels of these inflammatory factors were reduced by using SHTB at concentrations of 160–640 μg / mL (P<0.05, 0.001).

[0049] Example 4: RT-qPCR analysis of the effect of Shouhui defecation on H. pylori-induced inflammatory gene expression in RAW 264.7 cells.

[0050] Assay method: RAW 264.7 cells (2×10⁻⁶) were cultured in 6-well plates. 6 Cells were cultured with ATCC 700392 strain (MOI = 100:1) for 24 h using different concentrations of Trizol (320–640 μg / mL). Cells were collected, and 500 μL of Trizol was added to each well to transfer to an enzyme-free centrifuge tube. 1 / 5 volume of chloroform was added, and the tube was vigorously vortexed for 15 s, incubated on ice for 2–3 min, and centrifuged at 12000 rpm for 15 min. The supernatant was transferred to a new enzyme-free EP tube, and an equal volume of pre-chilled isopropanol was added. The tube was incubated on ice for 10 min. The tube was centrifuged at 12000 rpm for 5 min, and the supernatant was discarded. Pre-chilled 75% ethanol was added, and the tube was centrifuged at 12000 rpm for 5 min at 4 °C. The supernatant was discarded, and the tube was washed twice with pre-chilled 75% ethanol, then allowed to evaporate completely. An appropriate amount of DEPC-treated water was added, and the RNA concentration was determined using a NanoDrop spectrophotometer. Subsequently, the RNA was reverse transcribed into cDNA. The detection process used a Thermo Fisher Scientific 7500 Rapid Real-Time PCR instrument, and the reagents used were TB. Premix Ex Taq TM Reagent II. Data processing employed 2 -ΔΔCt Methods were employed, and normalization was performed using an internal reference gene. The drug-treated group was compared with the control group. The specific primer sequences used in this study are shown in Table 1.

[0051] Table 1 Primers used for RT-qPCR analysis

[0052] Gene Positive primer (5′–3′) Anti-primer (5′–3′) Gapdh GGCAAATTCAACGGCACAGTCAAG TCGCTCCTGGAAGATGGTGATGG Tnf CACCACGCTCTTCTGTCTACTGAAC AGATGATCTGAGTGTGAGGGTCTGG Cd86 TCTGCCGTGCCCATTTACAAAGG TGCCCAAATAGTGCTCGTACAGAAC

[0053] like Figure 4-1 and 4-2 As shown, the mRNA expression of Tnf and Cd86 was detected by RT-qPCR. The results showed that the expression levels of Tnf and Cd86 mRNA in the model group (HP group, induced by H. pylori) were higher than those in the control group (P<0.001), while the expression level of these genes in the Shouhui laxative treatment group was lower than that in the model group (P<0.001).

[0054] Example 5: Western blotting detection of the effect of Shouhui defecation on the expression of related proteins.

[0055] Assay method: RAW 264.7 cells were cultured at a density of 2 × 10⁶ cells per well. 6 Cells were seeded at a density of 100 mcg / well in 6-well plates and allowed to grow for 24 h. Subsequently, cells were co-infected with *Saccharomyces boulardii* and ATCC 700392 strains at a ratio of 100:1 for 24 h. Cells were then placed on ice and lysed with a solution containing 100 mM PMSF, protease inhibitors, phosphatase inhibitors, and RIPA reagent. Protein concentration in the lysate was determined using a BCA protein assay kit. The supernatant was collected, mixed with protein loading buffer, and heated at 100 °C for 10 min. SDS-PAGE gels were prepared using a 12% SDS-PAGE gel ultra-rapid preparation kit, and 10 μg of sample was loaded onto each gel. Samples were separated by SDS-PAGE electrophoresis for 90 min. Next, PVDF membranes were soaked in methanol for 3 min. After electrophoresis, membrane transfer was performed. The membranes were then removed and blocked with 5% non-lipid whey protein at room temperature for 2 h. The membranes were then incubated with primary antibody overnight at 4 °C on a shaker. Subsequently, the membrane was incubated with a 1:5000 dilution of mouse or rabbit secondary antibody in a shaker (at room temperature) for 70 min. Finally, reagent A and reagent B were mixed in a 1:1 ratio to prepare a highly sensitive ECL chemiluminescence reagent, and chemiluminescence detection was performed using a chemiluminescence imaging analyzer. Grayscale values ​​were analyzed using ImageJ software.

[0056] The results show that: Figure 5-1 and 5-2 As shown, H. pylori infection upregulated iNOS expression in cells (P < 0.05), suggesting that H. pylori infection activates iNOS. When combined with the Shouhui laxative composition, the upregulation trend of iNOS protein in H. pylori-infected cells was reversed.

[0057] The novel application of the Shouhui laxative composition in this invention, through multi-dimensional experiments including molecular mechanism analysis, functional activity verification, and effect correlation analysis, has constructed a progressive verification relationship of "target of action - biological activity - overall effect," elucidating the multi-level scientific basis for the composition's improvement of constipation, revealing its molecular regulatory mechanism and synergistic effect, and providing scientific support for the application of constipation intervention.

[0058] (1) Clear mechanism and strong targeting: The first laxative composition of the present invention can activate the iNOS pathway, promote the differentiation of macrophage M1 type from the protein (iNOS protein) level, target and regulate the innate immune pathway, and avoid non-specific effects on normal immune function.

[0059] (2) Effect of regulating phagocytic function under inflammatory state: In the Helicobacter pylori-induced inflammatory model, the phagocytic function of macrophages was abnormally activated due to excessive inflammatory stress. After intervention by the Shouhui laxative composition described in this invention, the abnormally high phagocytic rate decreased from 144.7% in the model group to 108.6%, returning to a functional state close to the normal physiological level, thus avoiding secondary damage to the gastric mucosa caused by excessive phagocytosis.

[0060] (3) NO secretion balance regulation effect: Helicobacter pylori infection can lead to excessive NO secretion by macrophages (up to 7.5 μm in the model group), which causes oxidative stress damage. The Shouhui laxative composition of the present invention can reduce the NO concentration to 5.3 μm by regulating iNOS activity. While maintaining the basic level of NO required for macrophage bactericidal action, it can significantly reduce the inflammatory damage caused by excessive secretion and achieve precise balance of NO secretion.

[0061] (4) Clear inflammation regulation effect: The Shouhui laxative composition of the present invention can induce macrophages to differentiate into M1 type, enhance their ability to clear Helicobacter pylori, regulate the balance of inflammatory response, and ultimately reduce the excessive secretion of TNF-α and IL-6 caused by Helicobacter pylori infection, forming a complete effect chain of "M1 type differentiation → pathogen clearance → downregulation of inflammatory factors", providing direct experimental evidence for alleviating Helicobacter pylori-related inflammation.

[0062] (5) Combining safety and innovation: Compared with the risk of antibiotic resistance and mucosal damage from nonsteroidal anti-inflammatory drugs, the Shouhui laxative composition of the present invention has no obvious toxic side effects, and expands its application scenarios from "laxative" to "immune regulation-inflammatory intervention", filling the technological gap of traditional Chinese medicine in this field.

Claims

1. The use of the Shouhui laxative composition in an anti-Helicobacter pylori inflammatory drug that induces M1 macrophage differentiation, characterized in that... The aforementioned laxative composition consists of Polygonum multiflorum, Cassia tora, Citrus aurantium, Aloe vera, donkey-hide gelatin, Lycium barbarum, Atractylodes macrocephala, and ginseng.

2. The use as described in claim 1, characterized in that, The intended use is in the preparation of drugs that promote the differentiation of macrophage M1 type and enhance innate immune function.

3. The use as described in claim 1 or 2, characterized in that, The intended use is in the application of drugs that induce M1 differentiation of macrophages to combat Helicobacter pylori inflammation.

4. The use as described in claim 1, characterized in that, The stated uses include asymptomatic carriers of Helicobacter pylori, chronic gastritis, peptic ulcers, MALT lymphoma, and precancerous lesions of the stomach.

5. The use as described in claim 1, characterized in that, The composition can be used in combination with antibiotics for the prevention or treatment of Helicobacter pylori infection.

6. The use as described in claim 1, characterized in that, The aforementioned laxative composition can be prepared as a medicine, health product, and food.

7. The use as described in claim 6, characterized in that, The medicines include capsules, granules, or decoctions.

8. The use as described in claim 6, characterized in that, The health products include tea bags, solid beverages, and dietary supplements.

9. The use as described in claim 6, characterized in that, The food products are made from medicinal and edible herbs, and are formulated with functional ingredients or health foods.

10. The use as described in claim 1, characterized in that, The composition is Shouhui laxative capsules.

Images