A recombinant human type III triple-helix collagen, a recombinant yeast strain expressing it, and a method for its construction.
By knocking out the YPS1 protease in Pichia pastoris and expressing human type III triple-helix collagen, and combining C-terminal peptide, C-propeptide and hydroxylase, the structural damage and safety issues in the collagen expression process were solved, achieving efficient extracellular secretion and high biological activity, thus expanding the application of collagen.
Patent Information
- Application Number
- CN202511679685.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-17
- Publication Date
- 2026-03-03
- Estimated Expiration
- 2045-11-17
AI Technical Summary
Existing technologies make it difficult to mass-produce collagen while maintaining its natural triple helix structure. Furthermore, animal-derived collagen poses immunogenicity and safety risks, and the expression of collagen in yeast expression systems is complex and its structure is easily disrupted.
Using Pichia pastoris as the host, through genetic engineering design, the YPS1 protease was knocked out, human type III triple helix collagen was expressed, and the C-terminal peptide and C-prepeptide were linked at the C-terminus. Combined with proline hydroxylase and genes such as TANGO1 and Hsp47, extracellular secretory expression was achieved, forming a natural triple helix conformation.
This technology enables highly efficient extracellular secretory expression of collagen, simplifies processing steps, improves biological activity, expands application areas, reduces production costs, and provides safer collagen materials.
Smart Images

Figure CN121108314B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of gene recombination technology, specifically relating to a recombinant human type III triple-helix collagen, a recombinant yeast strain expressing it, and a construction method thereof. Background Technology
[0002] Collagen is a biological macromolecule that maintains the structure of animal tissues and is the most abundant and widely distributed functional protein in mammals. Collagen forms collagen fibers, providing many tissues with firmness and elasticity. In its spatial structure, collagen exhibits a triple-helix configuration, formed by three independent collagen α-peptide chains primarily linked by hydrogen bonds. In vivo, collagen binds to tissues and cells in this triple-helix conformation to exert its biological effects; therefore, the biological activity of collagen largely depends on its natural triple-helix conformation.
[0003] Currently, most collagen on the market is extracted from animal tissues using acid, alkali, or enzymatic methods. However, these methods disrupt the natural triple helix structure of collagen during extraction, affecting its biological activity. Furthermore, due to structural differences between animal and human collagen, there is a potential for immunogenicity in clinical practice, and collagen extracted from animal tissues carries risks such as animal-derived diseases. Producing human collagen with a natural triple helix structure using molecular biology techniques such as genetic engineering holds great potential in addressing these issues.
[0004] Compared to animal and plant cells, which are difficult to cultivate and have high costs for large-scale production, microbial fermentation is relatively easy and the technology is relatively mature, making microorganisms an ideal choice for biosynthesis. *E. coli*, as a commonly used biosynthetic host, is suitable for high-density culture and is currently the mainstay of industrial collagen production. However, its prokaryotic expression system has drawbacks that can affect collagen production: the expressed products cannot be directly used clinically and require isolation, purification, and safety assurance; collagen requires sufficient post-translational modification to achieve high stability and complete biological activity, but *E. coli* lacks the endoplasmic reticulum (ER), and therefore lacks molecular chaperone proteins that help collagen proteins fold into higher conformations, as well as enzymes for modifying and synthesizing proteins such as hydroxylation and disulfide bond formation. Therefore, the *E. coli* system has difficulty expressing the naturally occurring triple-helix collagen with its higher-order structure.
[0005] Yeast expression systems, as another commonly used biosynthetic method, lack enzymes related to hydroxylation and glycosylation modifications, but possess post-translational modification systems. Through genetic engineering design and modification, yeast can be able to form the triple helix conformation of natural collagen. Furthermore, yeast recombinant expression systems offer advantages such as good safety, stable quality, defined molecular weight, absence of pyrogens, simple purification, and good reproducibility, and their culture conditions are highly suitable for large-scale industrial fermentation production. However, the production of recombinant human collagen using yeast as a host via biosynthesis is usually a non-secretory intracellular expression process, requiring complex post-processing to obtain the target product. During these processing steps, the triple helix structure of collagen is easily destroyed. Therefore, the research and design of stably expressed recombinant human triple helix collagen and its production technology are of great significance for expanding the application fields of collagen and providing new materials for collagen products. Summary of the Invention
[0006] To address the above problems, this invention provides a recombinant human type III triple-helix collagen, a recombinant yeast strain expressing it, and a construction method thereof. The recombinant human type III triple-helix collagen has a triple-helix structure close to the natural biological structure of collagen; the recombinant yeast strain can express the recombinant human type III triple-helix collagen and achieve its extracellular secretory expression, greatly simplifying the processing steps and making it suitable for the industrial production of the recombinant human type III triple-helix collagen.
[0007] To achieve the above-mentioned objectives, the present invention adopts the following technical solution:
[0008] The first aspect of this invention provides a recombinant human type III triple helix collagen, the amino acid sequence of which is shown in SEQ ID NO. 1.
[0009] The recombinant human type III triple-helix collagen provided by this invention is based on human type III collagen with the removal of the triplet containing amino acids (aromatic amino acids and leucine) that are easily degraded by vacuole protease A and vacuole protease B in Pichia pastoris. A C-terminal peptide and a C-propeptide of human type III triple-helix collagen are then linked at the C-terminus to form a triple-helix structure. Its triple-helix conformation is closer to the natural biological structure of collagen, thus possessing excellent biological activities (such as platelet aggregation, maintenance, regulation, and repair of normal physiological functions of cells, tissues, and organs), physicochemical properties, and processability similar to natural collagen. It has enormous application value and potential in biomedical materials, medical aesthetics, and other fields, and can serve as a substitute and supplement to existing technologies in the field.
[0010] The second aspect of the present invention provides a gene encoding the above-mentioned recombinant human type III triple helix collagen, the nucleotide sequence of which is shown in SEQ ID NO. 2.
[0011] A third aspect of the present invention provides a recombinant yeast strain expressing the above-mentioned recombinant human type III triple-helical collagen, wherein the recombinant yeast strain contains an expression cassette expressing the above-mentioned recombinant human type III triple-helical collagen and an expression cassette expressing proline hydroxylase and at least one of TANGO1, Hsp47 and cTAGE5, but does not express YPS1 protease.
[0012] This recombinant yeast strain can not only achieve the hydroxylation of recombinant collagen to form a natural triple helix conformation, thus solving the degradation problem of collagen during expression, but also achieve the extracellular secretory expression of the aforementioned recombinant human type III triple helix collagen, greatly simplifying the processing steps.
[0013] Preferably, the starting strain of the recombinant yeast strain includes Pichia pastoris, Saccharomyces cerevisiae, Yersinia lipolytica, and Hansenula polymorpha, etc.
[0014] More preferably, the starting strain of the recombinant yeast strain is Pichia pastoris.
[0015] Preferably, the recombinant yeast strain contains an expression cassette expressing the above-mentioned recombinant human type III triple-helix collagen, and also contains an expression cassette expressing proline hydroxylase, TANGO1, Hsp47 and cTAGE5, but does not express YPS1 protease.
[0016] The fourth aspect of this invention provides a method for constructing the above-mentioned recombinant yeast strain, specifically including the following steps:
[0017] S1. Construct a pGAP plasmid containing the Cas9 sequence;
[0018] S2. Construct expression cassette I containing the folded sequences of human type III collagen and human collagen C-terminal peptide and C-prepeptide, with a promoter, signal peptide and terminator each containing 500bp Pichia pastoris homologous sequences at both ends.
[0019] S3. Construct expression cassettes II containing human P4H alpha and beta subunits and encoding genes for at least one of TANGO1, Hsp47 and cTAGE5, and each containing a promoter, signal peptide and terminator with 500 bp Pichia pastoris homologous sequences at both ends.
[0020] S4. Transform the pGAP plasmid described in S1 into Pichia pastoris and screen out Pichia pastoris recombinant strain I with the Cas9 sequence integrated into its genome.
[0021] S5. The YPS1 protease gene in the Pichia pastoris recombinant strain I obtained in S4 was knocked out using CRISPR-Cas9 technology, and the Pichia pastoris recombinant strain II with the YPS1 protease gene successfully knocked out was screened out; the nucleotide sequence of the YPS1 protease gene is shown in SEQ ID NO. 5.
[0022] S6. The expression cassette I obtained in S2 was knocked into the Pichia pastoris recombinant strain II obtained in S5 using CRISPR-Cas9 technology, and Pichia pastoris recombinant strain III containing human type III collagen C-terminal teptide and propeptide folding fragments was screened.
[0023] S7. The expression cassette II obtained in S3 was knocked into the recombinant Pichia pastoris strain III obtained in S6 using CRISPR-Cas9 technology. The co-expression strains were then screened and obtained.
[0024] This construction method involves transferring a Cas9 expression cassette into the Pichia pastoris genome, facilitating subsequent gene knock-in and knock-out. Knocking out the YPS1 protease in the Pichia pastoris strain reduces the degradation of the target protein during secretion. Knocking in an expression cassette containing the P4H encoding gene and the encoding genes for at least one of the proteins TANGO1, Hsp47, and cTAGE5 promotes the construction of the triple helix structure and vesicle secretion of collagen. This method involves adding a C-terminal peptide and a C-prepeptide fold fragment to the C-terminus of a highly active human type III triple helix collagen, and co-expressing these fragments with the proline hydroxylase P4H and the encoding genes for at least one of the proteins TANGO1, Hsp47, and cTAGE5 in yeast cells with the YPS1 protease knocked out. This not only achieves hydroxylation of recombinant collagen, forming a natural triple helix conformation and solving the problem of collagen degradation during expression, but also enables the extracellular secretion of triple helix collagen, greatly simplifying subsequent processing steps.
[0025] Preferably, the expression cassette II in S3 contains the encoding genes for human P4H alpha and beta subunits and TANGO1, Hsp47 and cTAGE5 proteins, and each has a promoter, signal peptide and terminator with 500 bp Pichia pastoris homologous sequences at both ends.
[0026] For example, the specific operation of S1 is as follows:
[0027] S11, Synthesize Cas9 DNA fragments;
[0028] S12. Design primers to amplify the Cas9 DNA fragment, and obtain the Cas9 amplified fragment containing homologous end sequences of pGAP plasmid at both ends;
[0029] S13. Design primers and perform reverse PCR on the pGAP plasmid to obtain the pGAP plasmid amplification product.
[0030] S14. The Cas9 amplification fragment and the pGAP plasmid amplification product are ligated using a one-step cloning method, and the reactants are transformed into Escherichia coli.
[0031] S15. Culture the transformed E. coli and screen for E. coli containing the Cas9 cloned into the pGAP plasmid.
[0032] Step S14 can be performed as follows: the Cas9 amplification fragment and the pGAP plasmid amplification product are ligated at 37°C using a one-step cloning method, and the reactants are transformed into competent Escherichia coli DH5α using the CaCl2 heat shock method.
[0033] Step S15 can be performed as follows: the transformed E. coli are plated on LB plates containing bleomycin and cultured for 16 hours. Colony PCR is performed on the obtained E. coli colonies to screen for E. coli colonies containing Cas9 cloned into the pGAP plasmid.
[0034] For example, the specific operation of S2 is as follows:
[0035] S21. Synthesize a human type III triple helix collagen DNA fragment with a promoter, signal peptide, and terminator that connects the C-terminal peptide and C-propeptide of collagen.
[0036] S22. Design primers to amplify the human type III triple-helix collagen DNA fragment described in S21, obtaining a human type III triple-helix collagen expression cassette (e.g., containing C-terminal links between collagen C-terminal peptides and C-propeptides) with homologous sequences from the Pichia pastoris genome fragment at both ends. Figure 2 (as shown)
[0037] S23. Select an insertion site in the Pichia pastoris GS115 genome and design primers to amplify the homologous sequences 500 bp above and below the insertion site.
[0038] S24. The human type III triple helix collagen expression cassette and the homologous sequence are fused using fusion PCR to obtain a human type III triple helix collagen expression cassette with 500bp Pichia pastoris homologous sequences at both ends, namely expression cassette I.
[0039] For example, the specific operation of S3 is as follows:
[0040] S31, a DNA fragment containing the coding genes of the synthetic human P4H alpha and beta subunits and at least one of the proteins TANGO1, Hsp47 and cTAGE5, and with the corresponding promoter, signal peptide and terminator.
[0041] S32. Design primers to amplify the DNA fragments described in S31 to obtain gene expression cassettes containing homologous sequences of Pichia pastoris genome fragments at both ends;
[0042] S33. Select an insertion site in the Pichia pastoris GS115 genome and design primers to amplify the homologous sequences 500 bp above and below the insertion site.
[0043] S34. The expression cassette and the homologous sequence plasmid are fused using fusion PCR to obtain an expression cassette containing at least one protein encoding human P4H alpha and beta subunits and TANGO1, Hsp47 and cTAGE5 with 500bp Pichia pastoris homologous sequences at both ends.
[0044] For example, the specific operation of S4 is as follows:
[0045] S41. The pGAP plasmid was linearized using AvrII restriction endonuclease and transformed into Pichia pastoris by electroporation.
[0046] S42. The yeast strain from step S41 is cultured and screened to obtain the Cas9 expression strain, namely Pichia pastoris recombinant strain I.
[0047] For example, the specific operation of S5 is as follows:
[0048] S51. Two gRNAs were designed based on the YPS1 protease gene sequence in the Pichia pastoris genome; the sequences of the gRNAs are shown in SEQ ID NO. 6 and SEQ ID NO. 7.
[0049] S52. Ligate the designed gRNA into the pPIC9k plasmid containing the gRNA expression cassette;
[0050] S53. Transform the constructed plasmid into competent Escherichia coli DH5α, and use kanamycin to screen E. coli colonies containing the pPIC9k plasmid with gRNA expression cassette.
[0051] S54. The pPIC9k plasmid containing the gRNA expression cassette was extracted from the E. coli colony obtained from S53 and electroporated into Pichia pastoris recombinant strain I. The transformant with YPS1 knockout was verified by G418 antibiotic screening and sequencing, which is Pichia pastoris recombinant strain II.
[0052] Step S52 can be performed as follows: using a one-step cloning method, the designed gRNA and the pPIC9k plasmid containing the gRNA expression cassette are ligated at 37°C.
[0053] Steps S53 and S54 can be performed as follows: The reactants from S52 are transformed into competent *E. coli* DH5α using the CaCl2 heat shock method. The transformed *E. coli* are plated on LB agar plates containing kanamycin and cultured for 16 hours. After extracting the plasmid, the plasmid is transformed into the *Pichia pastoris* recombinant strain I described in S4 using electroporation. *Pichia pastoris* colonies carrying the pPIC9k plasmid containing the gRNA expression cassette are screened using G418 antibiotic, and the YPS1 protease gene knockout is verified by sequencing. A colony with the successfully knocked-out YPS1 protease gene is cultured in a YPD-free medium, plasmid is removed, and the result is verified by plate replication to obtain the YPS1 protease gene knockout strain GS115.
[0054] For example, the specific operation of S6 is as follows:
[0055] S61. Design a gRNA based on an intron gene sequence in the Pichia pastoris genome;
[0056] S62. Ligate the designed gRNA into the pPIC9k plasmid containing the gRNA expression cassette;
[0057] S63. Transform the constructed plasmid into competent Escherichia coli DH5α, and use kanamycin to screen E. coli colonies containing the pPIC9k plasmid with gRNA expression cassette.
[0058] S64. After extracting the pPIC9k plasmid containing the gRNA expression cassette from the E. coli colony obtained in S63, the plasmid was electroporated together with the expression cassette I described in S2 into the Pichia pastoris recombinant strain II described in S5. The transformant with the knock-in human type III collagen C-terminus telopeptide and propeptide folding fragment was verified by G418 antibiotic screening and sequencing, namely the Pichia pastoris recombinant strain III.
[0059] Step S62 can be performed as follows: the designed gRNA and pPIC9k plasmid are ligated at 37°C using a one-step cloning method, and the reactants are transformed into competent Escherichia coli DH5α using the CaCl2 heat shock method.
[0060] Steps S63 and S64 can be performed as follows: The constructed plasmid is transformed into competent *E. coli* DH5α cells. The transformed *E. coli* are plated on LB agar plates containing kanamycin and cultured for 16 hours. After plasmid extraction, the plasmid and expression cassette I described in S2 are transformed into the *Pichia pastoris* recombinant strain II described in S5 using electroporation. *Pichia pastoris* colonies carrying the pPIC9k plasmid containing the gRNA expression cassette are screened using G418 antibiotic, and the success of knocking in the human type III collagen expression cassette is verified by sequencing. The successfully knocked-in colonies are cultured in antibiotic-free YPD medium for one day to remove the plasmid, and then verified using a plate printing method to obtain a strain with successfully knocked-in human type III collagen C-terminus YPS1 protease knockout.
[0061] For example, S7 includes:
[0062] S71. Design one gRNA based on the sequences of each of the five intron genes in the Pichia pastoris genome.
[0063] S72. Ligate the designed gRNA into the pPIC9k plasmid containing the gRNA expression cassette;
[0064] S73. The constructed plasmid was transformed into competent Escherichia coli DH5α, and E. coli colonies containing the pPIC9k plasmid containing the gRNA expression cassette were screened using G418 antibiotic.
[0065] S74. After extracting the pPIC9k plasmid containing the gRNA expression cassette from the Escherichia coli colony obtained in S73, the plasmid was co-electroplated with each expression cassette II described in S3 into the Pichia pastoris recombinant strain III described in S6. Transformants encoding genes of at least one of the human P4H alpha and beta subunits and TANGO1, Hsp47, and cTAGE5 were screened by G418 antibiotic and sequenced to verify the transformations.
[0066] Step S72 can be performed as follows: the designed gRNA and pPIC9k plasmid are ligated at 37°C using a one-step cloning method, and the reactants are transformed into competent Escherichia coli DH5α using the CaCl2 heat shock method.
[0067] Steps S73 and S74 can be performed as follows: The constructed plasmid is transformed into competent Escherichia coli DH5α, the transformed E. coli is plated on LB plates containing kanamycin and cultured for 16 h, the plasmid is extracted, and the plasmid and each expression cassette II described in S3 are transformed into the Pichia pastoris recombinant strain III described in S6 by electroporation. Pichia pastoris colonies containing the pPIC9k plasmid of gRNA expression cassette are screened with G418 antibiotic and the expression cassette containing the coding gene of at least one of the following proteins: TANGO1, Hsp47 and cTAGE5 is successfully knocked in by sequencing. After successfully knocking in, the colonies were cultured in antibiotic-free YPD for one day to remove plasmids and then verified by plate printing. This yielded a strain that successfully knocked in the YPS1 protease-knockout gene encoding the C-terminus of human type III collagen, which includes telopeptide and propeptide folds, as well as the gene encoding at least one of the following proteins: human P4H alpha and beta subunits, TANGO1, Hsp47, and cTAGE5.
[0068] The fifth aspect of this invention provides the application of the above-mentioned recombinant yeast strain in the production of recombinant human type III triple helix collagen.
[0069] The sixth aspect of the present invention provides a method for producing recombinant human type III triple-helix collagen using the above-mentioned recombinant yeast strain: the recombinant yeast strain is induced to express, and the recombinant human type III triple-helix collagen is obtained from the fermentation supernatant.
[0070] Preferably, the method for inducing expression is as follows: inoculate into BMGY liquid medium containing bleomycin, culture at 30°C and 220 rpm for 16 hours with shaking, then add BMMY liquid medium containing 1% methanol for 72 hours of induction expression, adding 1% methanol of the total system volume every 24 hours. Collect the fermentation supernatant and bacterial cells.
[0071] The seventh aspect of the present invention also provides the application of the above-mentioned recombinant human type III triple-helix collagen, including:
[0072] Applications in the preparation of medical aesthetic products;
[0073] Applications in the preparation of beauty products;
[0074] Applications in the preparation of soft tissue repair materials;
[0075] Application in the preparation of hard tissue repair materials;
[0076] Applications in the preparation of drug sustained-release carrier materials;
[0077] Application in the preparation of tissue engineering scaffold materials.
[0078] The beneficial effects of this invention are as follows:
[0079] (1) The recombinant human type III triple-helix collagen provided by this invention is based on a segment of amino acid sequence with good activity in human type III collagen, by removing the triplet containing aromatic amino acids and leucine that is easily degraded by Pichia pastoris intracellular proteases, and by linking the C-terminal peptide and C-prepeptide of human type III triple-helix collagen to form a triple-helix collagen structure. The triple-helix structure gives it excellent biological activity and can be used as a highly active biomedical material or medical cosmetic material, possessing great application value and potential.
[0080] (2) The recombinant yeast strain provided by this invention adds C-terminal peptide and C-prepeptide folding fragments to the C-terminus of human type III collagen. Furthermore, it co-expresses this human type III collagen with proline hydroxylase in yeast cells with YPS1 protease knocked out, while simultaneously introducing genes beneficial to vesicle transport and protein folding. This not only achieves hydroxylation of the recombinant collagen, forming a natural triple helix conformation, but also solves the degradation problem of collagen during expression and enables the extracellular secretion expression of triple helix collagen. This represents an industrial innovation and technological advancement in the industrial production of triple helix collagen. The recombinant human type III triple helix collagen prepared by this method is more similar to natural collagen in amino acid composition and spatial structure. Compared with recombinant collagen prepared by conventional methods, its application areas can be further expanded, and the production cost is lower. This is beneficial for providing more materials for the increasingly developing medical device, cosmetic, and food industries, and has a good application market.
[0081] (3) Compared with animal-derived collagen and single-chain collagen expressed by Escherichia coli, the yeast recombinant human triple-helix collagen provided by the present invention has a higher structure of natural collagen and is safer and more reliable. It can provide higher quality and safer materials for downstream collagen products such as beauty and cosmetic products, soft tissue repair materials, hard tissue repair materials, drug sustained-release carrier materials and tissue engineering scaffold materials. It has great practical significance for solving the potential safety hazards and low bioactivity levels of animal-derived collagen and single-chain collagen. Attached Figure Description
[0082] Figure 1 This is a plasmid map of the pGAP plasmid containing the Cas9 sequence in Example 1 of the present invention;
[0083] Figure 2This is a schematic diagram of the human type III triple-helix collagen expression cassette in Example 1 of the present invention, which connects the C-terminal peptide and C-propeptide of collagen at the C-terminus; wherein, AOX1 promoter is the promoter of the alcohol oxidase gene; ost secretion signal is the co-translational transport secretion signal peptide; C-telopeptide is the C-terminal peptide; C-propeptide is the C-propeptide; and AOX1 terminator is the terminator of the alcohol oxidase gene.
[0084] Figure 3 This is a plasmid map of the pPIC9k plasmid containing a gRNA expression cassette in Example 1 of the present invention;
[0085] Figure 4 The following are the Western blotting and SDS-PAGE results of recombinant human type III collagen in the soluble supernatant and fermentation supernatant of bacterial cell lysate in Example 2 of this invention before and after pepsin treatment: 1: Protein Marker; 2: Soluble supernatant of bacterial cell lysate (untreated with pepsin); 3: Soluble supernatant of bacterial cell lysate (treated with pepsin for 4 h); 4: Fermentation supernatant (untreated with pepsin); 5: Fermentation supernatant (treated with pepsin for 0 h); 6: Fermentation supernatant (treated with pepsin for 1 h); 7: Fermentation supernatant (treated with pepsin for 2 h); 8: Fermentation supernatant (treated with pepsin for 4 h); 1-3 are Western blotting results, and 4-8 are SDS-PAGE results.
[0086] Figure 5 This describes the secretion of intracellular and extracellular recombinant human type III triple-helix collagen in Example 2 of the present invention.
[0087] Figure 6 This is the circular dichroism spectral verification result of the recombinant human type III triple helix collagen in Example 2 of the present invention. Detailed Implementation
[0088] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to specific embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention. All other embodiments obtained by those skilled in the art based on the implementation methods of this invention without inventive effort fall within the protection scope of this invention.
[0089] The biological activity of collagen largely depends on its natural triple-helix conformation. However, methods for extracting collagen from animal tissues using acid, alkali, or enzymatic methods can disrupt this natural triple-helix structure, thus affecting its biological activity. Furthermore, animal-derived collagen carries risks such as immunogenicity and the development of animal-derived diseases. Producing collagen through biosynthesis using *E. coli* as a host requires the separation and purification of the expression product, and the *E. coli* system struggles to express the naturally occurring triple-helix collagen. While yeast, through genetic engineering, can form the natural triple-helix conformation of collagen, and yeast recombinant expression systems offer good safety, are pyrogen-free, and are easy to purify, the production of recombinant human collagen using yeast as a host is typically a non-secretory intracellular expression process requiring complex post-processing to obtain the target product. However, the triple-helix structure of collagen is easily destroyed during these processing steps.
[0090] To address this issue, this invention provides a recombinant human type III triple-helix collagen, the amino acid sequence of which is shown in SEQ ID NO. 1. This recombinant human type III triple-helix collagen has a triple-helix conformation that closely resembles the natural biological structure of collagen.
[0091] This invention also provides a gene encoding the above-mentioned recombinant human type III triple-helix collagen.
[0092] This invention also provides a recombinant yeast strain expressing the above-mentioned recombinant human type III triple-helix collagen and its construction method.
[0093] This invention also provides a method for producing recombinant human type III triple-helix collagen using the above-mentioned recombinant yeast strain.
[0094] The present invention will be described below through specific embodiments.
[0095] Unless otherwise specified, the technical means used in the following embodiments are conventional means well known to those skilled in the art; the materials and reagents used in the following embodiments are all commercially available.
[0096] Example 1
[0097] This embodiment provides a recombinant yeast strain expressing recombinant human type III triple helix collagen with the amino acid sequence shown in SEQ ID NO. 1 and its construction process.
[0098] S1. Construct a pGAP plasmid containing the Cas9 sequence (plasmid map as shown). Figure 1 (as shown)
[0099] S11. A Cas9 DNA fragment of 4140 bp in size was artificially synthesized (as shown in SEQ ID NO.3 in the sequence listing), and its protein sequence is shown in SEQ ID NO.4 in the sequence listing;
[0100] S12. The Cas9 DNA fragment was amplified using primer pairs F1 and R1 to obtain the Cas9 amplified fragment containing homologous end sequences of pGAP plasmid at both ends.
[0101] F1: AATCAATTGAACAACTATCGAAACGATGGACAAGAAGTACTC;
[0102] R1:CATGTCTAAGGCTAAAACTCACACCTTCCTCTTCTTCTTGG;
[0103] S13. Amplify the pGAP plasmid vector using reverse PCR, and recover and purify the amplified DNA.
[0104] S14. The amplified fragment and pGAP plasmid were ligated using a one-step cloning method at 37°C, and the reactants were transformed into competent Escherichia coli DH5α using the CaCl2 heat shock method.
[0105] S15. The transformed *E. coli* were plated on LB agar plates containing bleomycin and cultured for 16 h. Colony PCR was performed on the obtained *E. coli* colonies to screen for *E. coli* colonies containing the Cas9 cloned into the pGAP plasmid. DNA sequencing of positive clones showed that their sequences were the Cas9 fragment sequences shown in SEQ ID No. 3 of the sequence listing.
[0106] S2. Construct expression cassette I containing the folded sequences of human type III collagen and human collagen C-terminal peptide and C-prepeptide, with a promoter, signal peptide and terminator each containing 500bp Pichia pastoris homologous sequences:
[0107] S21. A human type III triple-helix collagen DNA fragment artificially synthesized with a promoter, signal peptide, and terminator, C-terminus linking collagen C-terminal peptide and C-propeptide (as shown in SEQ ID NO.2), the protein sequence of which is shown in SEQ ID NO.1;
[0108] S22. The human type III triple helix collagen DNA fragment was amplified using primer pairs F2 and R2 to obtain a human type III triple helix collagen expression cassette containing homologous sequences of Pichia pastoris genome fragments at both ends, with the C-terminal linking collagen C-terminal peptide and C-propeptide.
[0109] S23. Select an insertion site in the Pichia pastoris GS115 genome, and amplify the Pichia pastoris GS115 genome using primer pairs F3 and R3 and F4 and R4 to obtain the 500bp sequences above and below the selected insertion site.
[0110] F3:ACATTGTTCGTGAGGCTAATCC;
[0111] R3:GAAAGTGGCACTGGAGTTCC;
[0112] F4:AGCTTTTAGACTAGTATTTACGTTGC;
[0113] R4:GACAGTAGTGAATTGGTTGCATG;
[0114] S24. The sequence is fused with the human type III triple helix collagen expression cassette obtained in S22 using fusion PCR to obtain a human type III triple helix collagen expression cassette with 500bp Pichia pastoris homologous sequences at both ends, namely expression cassette I.
[0115] S3. Construct expression cassettes II containing the coding genes for human P4H alpha and beta subunits and proteins containing TANGO1 (amino acid sequence as shown in SEQ ID NO. 9), Hsp47 (amino acid sequence as shown in SEQ ID NO. 10), and cTAGE5 (amino acid sequence as shown in SEQ ID NO. 11), each with a promoter, and each with a 500bp Pichia pastoris homologous sequence at both ends of the signal peptide and terminator:
[0116] S31, the amino acid sequence of the human P4H alpha subunit and beta subunit linked by the Kex2 protease (shown in SEQ ID NO.8), and a DNA fragment containing the encoding genes of TANGO1, Hsp47 and cTAGE5 proteins, and carrying the corresponding promoter, signal peptide and terminator.
[0117] S32. Design the following primers:
[0118] P4H-F: GATGCTCCAGAAGAAGAAGATCATG
[0119] P4H-R:TTATTCCAACTCTGACAAGGTACATG
[0120] TANGO1-F:GCTGCTGCTCCAGGTTTGC
[0121] TANGO1-R: TGGAGATTGTTTTAGCGCCTG
[0122] Hsp47-F:ATGAGATCCTTACTGCTATTGTCTGC
[0123] Hsp47-R: CAACTCGTCTCTCATCTTGTCACC
[0124] cTAGE5-F:ATGGAAGAGCCAGGCGCA
[0125] cTAGE5-R: AGACTTAATCCCAAGGTATGCTCC
[0126] The DNA fragments described in S31 were amplified to obtain gene expression cassettes containing homologous sequences of Pichia pastoris genome fragments at both ends;
[0127] S33. Select an insertion site in the Pichia pastoris GS115 genome and design primers to amplify the homologous sequences 500 bp above and below the insertion site.
[0128] S34. The expression cassette and the homologous sequence plasmid are fused using fusion PCR to obtain an expression cassette containing human P4H alpha and beta subunits and TANGO1, Hsp47 and cTAGE5 proteins encoded by 500bp Pichia pastoris homologous sequences at both ends.
[0129] S4. Transform the pGAP plasmid described in S1 into Pichia pastoris GS115 and screen for Pichia pastoris recombinant strain I with the Cas9 sequence integrated into its genome:
[0130] S41. Linearize the pGAP plasmid containing Cas9 in S1 using AvrII restriction endonuclease and transform it into Pichia pastoris GS115 by electroporation.
[0131] S42. Spread the yeast from step S41 onto YPD solid medium containing bleomycin (20 g peptone, 10 g yeast powder, 20 g glucose, 15 g agar powder, dissolved in 1 L distilled water and then sterilized) plates, and incubate them in a 30°C constant temperature incubator for 72 hours to obtain plates with yeast colonies. Screen the Cas9 expression strain, namely Pichia pastoris recombinant strain I.
[0132] S5. Knock out the YPS1 protease gene in the Pichia pastoris recombinant strain I obtained in S4 using CRISPR-Cas9 technology and screen out the Pichia pastoris recombinant strain II with the YPS1 protease gene successfully knocked out (nucleotide sequence as shown in SEQ ID NO. 5):
[0133] S51. Locate the YPS1 protease gene sequence in the Pichia pastoris genome on NCBI. Use the gRNA design webpage Benchling to design two gRNAs on the YPS1 gene sequence, as shown in SEQ ID NO. 6 and SEQ ID NO. 7.
[0134] S52. The designed gRNA and the pPIC9k plasmid containing the gRNA expression cassette were ligated at 37°C using a one-step cloning method.
[0135] S53. The reactants from S52 were transformed into competent E. coli DH5α using the CaCl2 heat shock method. The transformed E. coli were plated on LB agar plates containing kanamycin and cultured for 16 h. The pPIC9k plasmid containing the gRNA expression cassette was screened using kanamycin (plasmid map shown). Figure 3 Escherichia coli colonies (as shown);
[0136] S54. Extract the pPIC9k plasmid containing the gRNA expression cassette from the Escherichia coli colonies obtained in S53. Transform the obtained plasmid into the Pichia pastoris recombinant strain I described in S4 using electroporation. Select transformants carrying the pPIC9k plasmid containing the gRNA expression cassette and successfully knocking out YPS1 by sequencing using G418 antibiotic. Culture the colonies that successfully knocked out the YPS1 protease gene in antibiotic-free YPD for one day to remove the plasmid and verify by plate printing method to obtain the GS115 strain with the YPS1 protease gene knocked out, which is the Pichia pastoris recombinant strain II.
[0137] S6. The expression cassette I obtained in S2 was knocked into the Pichia pastoris recombinant strain II obtained in S5 using CRISPR-Cas9 technology, and Pichia pastoris recombinant strain III containing human type III collagen C-terminal telopeptide and propeptide folding fragments was screened out:
[0138] S61. Locate an intron gene sequence in the Pichia pastoris genome on NCBI, and design a gRNA on that gene sequence using the gRNA design website Benchling.
[0139] S62. Using a one-step cloning method, the designed gRNA and the pPIC9k plasmid containing the gRNA expression cassette were ligated at 37°C to ligate the gRNA into the pPIC9k plasmid.
[0140] S63. The plasmid constructed in S62 was transformed into competent Escherichia coli DH5α using the CaCl2 heat shock method. The transformed E. coli were plated on LB plates containing kanamycin and cultured for 16 h. E. coli colonies containing the pPIC9k plasmid containing the gRNA expression cassette were screened using kanamycin.
[0141] S64. After extracting the pPIC9k plasmid containing the gRNA expression cassette from the *E. coli* colonies obtained in S63, the pPIC9k plasmid and the expression cassette I described in S2 were transferred into the *Pichia pastoris* recombinant strain II described in S5 using electroporation. *Pichia pastoris* colonies carrying the pPIC9k plasmid containing the gRNA expression cassette were screened using G418 antibiotic, and sequencing was used to verify whether the human type III collagen expression cassette was successfully knocked in. The successfully knocked-in colonies were cultured in antibiotic-free YPD medium for one day to remove the plasmid, and then verified using a plate printing method. The resulting strain, *Pichia pastoris* recombinant strain III, was obtained with the YPS1 protease knockout fragment containing the C-terminus of human type III collagen, which includes a telopeptide and propeptide fold.
[0142] S7. The expression cassette II obtained in S3 was knocked into the Pichia pastoris recombinant strain III obtained in S6 using CRISPR-Cas9 technology, and co-expression strains were screened and obtained:
[0143] S71. Locate the four intron gene sequences in the Pichia pastoris genome on NCBI, and use the gRNA design webpage Benchling to design one gRNA for each of these gene sequences.
[0144] S72. Using a one-step cloning method, the designed gRNA and the pPIC9k plasmid containing the gRNA expression cassette are ligated at 37°C to ligate the gRNA into the pPIC9k plasmid.
[0145] S73. The plasmid constructed in S72 was transformed into competent Escherichia coli DH5α using the CaCl2 heat shock method. The transformed E. coli were plated on LB plates containing kanamycin and cultured for 16 h. E. coli colonies containing the pPIC9k plasmid containing the gRNA expression cassette were screened using kanamycin.
[0146] S74. After extracting the pPIC9k plasmid containing the gRNA expression cassette from the *E. coli* colonies obtained in S73, the pPIC9k plasmid and each expression cassette II described in S3 were respectively transformed into the recombinant *Pichia pastoris* strain III described in S6 using electroporation. The *Pichia pastoris* colonies carrying the pPIC9k plasmid containing the gRNA expression cassette were screened using G418 antibiotic, and the YPS1 protease knockout transformants encoding the human P4H alpha and beta subunits and TANGO1, Hsp47, and cTAGE5 proteins were verified by sequencing. The successfully knocked-in colonies were cultured in antibiotic-free YPD for one day, and after plasmid removal, they were verified by plate printing method. The recombinant yeast strain expressing recombinant human type III triple-helix collagen as shown in SEQ ID NO. 1 in this embodiment was obtained.
[0147] Example 2
[0148] This embodiment provides a method for producing recombinant human type III triple-helix collagen with the amino acid sequence shown in SEQ ID NO. 1 using the recombinant yeast strain in Example 1.
[0149] Recombinant yeast colonies that have been successfully verified to express recombinant human type III triple-helix collagen as shown in SEQ ID NO. 1 were selected from plates for shake-flask induction of expression: Inoculated into 5 mL YPD containing bleomycin and cultured overnight at 30°C with shaking at 220 rpm, then transferred to 100 mL BMGY liquid medium and cultured at 30°C with shaking at 220 rpm for 16 hours. Afterward, BMMY liquid medium containing 1% methanol was added for 72 hours of induction expression, with 1% methanol added every 24 hours. The fermentation supernatant and bacterial cells were collected at the end of fermentation.
[0150] (1) The bacterial cells were homogenized using a high-pressure homogenizer, and the fermentation supernatant and bacterial cell lysate were diluted to the same ratio. Recombinant human type III collagen in the soluble supernatant of the bacterial cell lysate and the fermentation supernatant were detected by Western blotting and SDS-PAGE, respectively. A pepsin treatment control experiment was performed on all test samples. Pepsin can cleave collagen propeptides, but the triple helix structure is resistant to pepsin degradation; therefore, the pepsin treatment results can serve as one of the necessary criteria for identifying the triple helix structure.
[0151] Pepsin treatment control experiment: The pH of the soluble supernatant of bacterial cell lysate and fermentation supernatant was adjusted to 2, and 0.2 mg / ml of pepsin was added. The mixture was incubated at 37°C for 0–4 hours, and then 100 mM NaOH solution was added to terminate the pepsin digestion reaction. The treated samples were concentrated 40-fold using ultracentrifuge tubes, and the resulting samples were analyzed by Western blotting and SDS-PAGE.
[0152] The results are as follows Figure 4 As shown, both intracellular and extracellular recombinant collagen exhibit resistance to pepsin degradation, and the molecular weight of the single chain of recombinant collagen with C-propeptide cleaved is approximately 56.4 kDa.
[0153] (2) The production of intracellular and extracellular recombinant collagen was determined by an ELISA kit, and the extracellular secretion rate of collagen was calculated using the following formula.
[0154] Extracellular secretion rate (%) = Collagen content in fermentation supernatant / Total collagen content in fermentation supernatant and cell lysate * 100%.
[0155] The results are as follows Figure 5 As shown, most of the recombinant collagen is secreted extracellularly.
[0156] (3) Circular dichroism spectroscopy verification of recombinant human type III triple helix collagen
[0157] The fermentation supernatant after pepsin digestion was ultrafiltered, lyophilized, and reconstituted with PBS solution for circular dichroism spectroscopy. The starting wavelength was set to 190 nm, the ending wavelength to 250 nm, the step size to 1 nm, and the experiment was repeated three times. The acquisition time was 0.5 s / point, and the cuvette width was 0.1 cm. The results are as follows: Figure 6 As shown, collagen has a negative peak at 198nm and a positive peak at 221nm, which is consistent with the CD characteristics of triple-helix collagen.
[0158] As can be seen from the above results, the recombinant yeast strain constructed in Example 1 of the present invention can produce recombinant human type III triple helix collagen with an amino acid sequence as shown in SEQ ID NO. 1.
[0159] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions or improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A recombinant human type III triple-helix collagen, characterized in that, Its amino acid sequence is shown in SEQ ID NO.
1.
2. The gene encoding the recombinant human type III triple-helix collagen as described in claim 1, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.
2.
3. A recombinant yeast strain expressing the recombinant human type III triple-helix collagen of claim 1, characterized in that, The recombinant yeast strain contains an expression cassette expressing the recombinant human type III triple-helix collagen, and also contains expression cassettes expressing the human P4H alpha and beta subunits, as well as TANGO1, Hsp47, and cTAGE5, and knocks out the YPS1 protease.
4. The recombinant yeast strain according to claim 3, characterized in that, The recombinant yeast strain originated from Pichia pastoris.
5. The method for constructing the recombinant yeast strain according to claim 3, characterized in that, Specifically, the following steps are included: S1. Construct a pGAP plasmid containing the Cas9 sequence; S2. Construct expression cassette I containing the folded sequences of human type III collagen and human collagen C-terminal peptide and C-prepeptide, with a promoter, signal peptide and terminator each containing 500bp Pichia pastoris homologous sequences at both ends. S3. Construct expression cassettes II containing human P4H alpha and beta subunits and encoding genes for TANGO1, Hsp47, and cTAGE5, respectively, and each containing a promoter, signal peptide, and terminator with 500 bp Pichia pastoris homologous sequences at both ends. S4. Transform the pGAP plasmid described in S1 into Pichia pastoris and screen out Pichia pastoris recombinant strain I with the Cas9 sequence integrated into its genome. S5. The YPS1 protease gene in the Pichia pastoris recombinant strain I obtained in S4 was knocked out using CRISPR-Cas9 technology, and the Pichia pastoris recombinant strain II with the YPS1 protease gene successfully knocked out was screened out; the nucleotide sequence of the YPS1 protease gene is shown in SEQ ID NO.
5. S6. The expression cassette I obtained in S2 was knocked into the Pichia pastoris recombinant strain II obtained in S5 using CRISPR-Cas9 technology, and Pichia pastoris recombinant strain III containing human type III collagen C-terminal teptide and propeptide folding fragments was screened. S7. The expression cassette II obtained in S3 was knocked into the recombinant Pichia pastoris strain III obtained in S6 using CRISPR-Cas9 technology. The co-expression strains were then screened and obtained.
6. The use of the recombinant yeast strain according to claim 3 or 4 in the production of recombinant human type III triple helix collagen.
7. A method for producing recombinant human type III triple-helix collagen using the recombinant yeast strain according to claim 3 or 4, characterized in that, The recombinant yeast strain was induced to express the recombinant human type III triple helix collagen, and the recombinant human type III triple helix collagen was obtained from the fermentation supernatant.
8. The application of the recombinant human type III triple-helix collagen according to claim 1, characterized in that, include: Applications in the preparation of medical aesthetic products; Applications in the preparation of beauty products; Application in the preparation of soft tissue repair materials; Applications in the preparation of hard tissue repair materials; Applications in the preparation of drug sustained-release carrier materials; Application in the preparation of tissue engineering scaffold materials.
Citation Information
Patent Citations
Yeast recombinant human III-type triple helix collagen and preparation method thereof
CN114480471A
Recombinant III-type humanized triple-helix structure collagen dressing
CN115475277A