Brevibacillus parabrevis S09T2 and application of brevibacillus parabrevis S09T2 in degrading ochratoxin A

Abstract

The invention discloses a brevibacillus parabrevis S09T2 strain and an application of the brevibacillus parabrevis S09T2 strain in degrading ochratoxin A. The brevibacillus parabrevis S09T2 is preserved in the Guangdong Microbial Culture Collection Center on September 26, 2025, and the preservation number of the brevibacillus parabrevis S09T2 is GDMCC No: 67039. The brevibacillus parabrevis S09T2 is preserved in the Guangdong Microbial Culture Collection Center on September 26, 2025. The invention finds that the strain has the capability of efficiently degrading ochratoxin A (OTA) for the first time, and fermentation liquor of the strain can realize the degradation rate of over 93 percent on OTA with the concentration of 5 mu g / mL or 8 mu g / mL within 24 hours. Genome analysis shows that the strain does not contain known virulence genes and drug-resistant genes, has no hemolytic activity and has good biological safety. The further research shows that the intracellular solubles of the strain can significantly degrade OTA in the plumeria rubra lixivium, so that the harm of OTA is reduced, and the strain has a good application prospect.

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, specifically relating to a strain of Bacillus parasiticus (B. parasiticus). Brevibacillus brief Application of S09T2 and its degradation of ochratoxin A. Background Technology

[0002] Ochratoxin A (OTA), with the molecular formula C 20 H 18 ClNO6, composed of a dihydroisocoumarin group linked to L-β-phenylalanine via an amide bond, is a compound produced by Aspergillus spp. ( Aspergillus sp.) and Penicillium (sp.) Penicillium OTA (Toxic Acid Oxytoxin) is a toxic secondary metabolite produced by fungi such as *Sp.*. This toxin is nephrotoxic, hepatotoxic, neurotoxic, and teratogenic, and has been classified as a Group 2B carcinogen by the International Agency for Research on Cancer (IARC). Furthermore, OTA has a wide range of contamination characteristics, commonly found in various agricultural products and processed goods, including grains, coffee, grapes, traditional Chinese medicine herbs, and their byproducts. Due to its stable chemical structure, it is difficult to remove effectively by conventional methods, and it easily accumulates during storage, transportation, and processing, posing a serious threat to human and animal health after being transmitted through the food chain. Therefore, researching OTA removal technologies is of great significance for ensuring national food safety and protecting human and animal health.

[0003] Currently, methods for removing OTA mainly include physical, chemical, and biological methods. While physical methods (such as adsorption and irradiation) and chemical methods (such as oxidation and alkaline hydrolysis) can remove OTA under certain conditions, they often result in problems such as decreased product quality, loss of nutrients, and chemical reagent residues, thus limiting their widespread application in the food and feed industries. In contrast, biological methods, due to their advantages of mild reaction conditions, high specificity, environmental friendliness, and low risk of secondary pollution, are gradually becoming the focus of current OTA removal research. However, existing biological methods still have certain limitations: First, biosorption can only temporarily bind OTA, and this process is reversible, failing to fundamentally eliminate OTA completely. Furthermore, desorption can easily occur under changing environmental conditions, posing potential safety hazards. Second, the number of reported OTA-degrading strains is limited, and their degradation efficiency is relatively low. For example, *Aspergillus oryzae* (… Aspergillus oryzae It requires incubation for more than 4 days to achieve a 93% degradation rate of 5 μg / mL OTA. Some bacteria, such as Bacillus spp. ( Bacillus sp.), Pseudomonas aeruginosa ( Pseudomonas aeruginosa ) and Acinetobacter spp. AcinetobacterWhile the *Sp.* strain achieved a degradation rate of over 99% after co-incubation with OTA for 2 days, the OTA concentration under these experimental conditions was generally below 1 µg / mL, lacking evaluation of its ability to degrade high-concentration OTA. More critically, existing reports largely focus on detecting the endpoint degradation rate of the strains, lacking systematic kinetic studies and failing to clarify the dynamic transformation patterns of OTA during degradation. In particular, the relationship between the concentration changes of OTA and its degradation product OTα during co-culture with the degrading strains is not systematically reported, making it difficult to fully elucidate the degradation mechanism. Furthermore, existing OTA-degrading strains generally lack safety evaluations, may carry virulence and resistance genes, and even pose a potential hemolytic risk, severely limiting their application prospects in food and feed production. Therefore, there is an urgent need to screen and obtain novel OTA-degrading strains with high degradation capacity, clear degradation mechanisms, and safety to achieve rapid and stable removal of OTA, providing a safer, more reliable, and feasible microbial solution for controlling OTA contamination in food and feed systems. Summary of the Invention

[0004] To address the problems existing in the prior art, the purpose of this invention is to provide a strain of Bacillus parasiticus that can efficiently degrade OTA ( Brevibacillus parabrevis S09T2, involving biotechnology and fermentation engineering.

[0005] The first objective of this invention is to provide *Bacillus parashortia* (… Brevibacillus parabrevis S09T2, accession number: GDMCC No: 67039.

[0006] This invention isolates a strain of Bacillus parashortia that can degrade OTA from soil. Brevibacillus brief The strain, named S09T2, was deposited at the Guangdong Provincial Center for Microbial Culture Collection on September 26, 2025, with accession number GDMCC No: 67039.

[0007] A second objective of this invention is to provide the aforementioned *Bacillus parashortia* (… Brevibacillus brief Application of S09T2 in the degradation of ochratoxin A or in the preparation of ochratoxin A biodegrading agents.

[0008] Preferably, it is Bacillus parabrittlesis (B. parabrittlesis) Brevibacillus parabrevis Application of fermentation broth, intracellular lysate or fermentation supernatant of S09T2 in the degradation of ochratoxin A or in the preparation of ochratoxin A biodegrading agents.

[0009] A third object of the present invention is to provide a biological agent containing the aforementioned Bacillus parabrittlesis (B. parabrittlesis). Brevibacillus parabrevis S09T2 is used as the active ingredient.

[0010] Preferably, it is *Bacillus parabrittlesis* (… Brevibacillus parabrevis The fermentation broth, intracellular lysate, or fermentation supernatant of S09T2 are used as active ingredients.

[0011] This invention further discloses a biological detoxifier containing *Bacillus parabregastus* S09T2 or its intracellular lysate. The preparation method of the biological detoxifier includes: activating *Bacillus parabregastus* S09T2 with accession number GDMCC No: 67039, performing multi-stage expansion culture, and collecting the fermentation broth when the cells are in the stationary phase to obtain the biological detoxifier; or centrifuging the fermentation broth, collecting and breaking the cells to obtain a crude enzyme solution to obtain the biological detoxifier.

[0012] The fermentation medium was formulated as follows: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, pH 7.0-7.2. The fermentation conditions were: 37℃, shaking at 160 r / min for 24 h.

[0013] A fourth object of the present invention is to provide a method for degrading ochratoxin A, comprising the following steps: using the above-mentioned Bacillus parabrittlesis (… Brevibacillus parabrevis Samples treated with S09T2 or the above-mentioned biological agents.

[0014] Preferably, the sample treatment conditions are a temperature of 30-55°C and a pH of 6-8.

[0015] Preferably, the sample is frangipani.

[0016] The fifth objective of this invention is to provide a method for identifying the aforementioned Bacillus parashortia (Bacillus parashortia). Brevibacillus brief The primer set for S09T2 is 5'-CCCCTCCCCTTTGGTGAATC-3' and 5'-TGCTCTGGAAAAGAGAGCCG-3'.

[0017] The sixth object of the present invention is to provide a method for identifying the above-mentioned Bacillus parashortia ( Brevibacillus brief The method for detecting S09T2 includes the following steps: PCR amplification of the test bacteria using the above primer set. If an 828 bp product is amplified, it is Bacillus parabrachii S09T2; if no 828 bp product is amplified, it is not Bacillus parabrachii S09T2.

[0018] The beneficial effects of this invention are as follows: the *Bacillus parashortia* obtained by isolation and screening in this invention (… Brevibacillus briefThe fermentation broth of S09T2 achieved a 93% degradation rate of OTA at 8 μg / mL within 24 h. Compared with existing OTA-degrading bacteria, this not only significantly accelerated the degradation rate but also removed higher concentrations of OTA. Further research showed that *Bacillus parabrachium* S09T2 degrades OTA into the non-toxic degradation product OTα through enzymatic action. Furthermore, whole-genome sequencing of *Bacillus parabrachium* S09T2 using Illumina Nextseq 550 and Nanopore MinION sequencing platforms yielded a complete genome map. No known virulence or resistance genes were found, and no hemolysis was observed in the blood plate test, further demonstrating the high reliability of this strain in terms of biosafety. Simultaneously, utilizing the intracellular lysate of this strain to degrade OTA in complex matrices offers advantages such as safety, stability, and no pollution, demonstrating significant application value.

[0019] Bacillus parashortia ( Brevibacillus parabrevis S09T2 was deposited on September 26, 2025, at the Guangdong Provincial Microbial Culture Collection Center (GDMCC), located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Province, 510070, China. The accession number is GDMCC No. 67039. Classification and naming are as follows: Brevibacillus parabrevis . Attached Figure Description

[0020] Figure 1 The images show the colony morphology of Bacillus parashortia S09T2 (A), the microscopic features obtained by observation under an optical microscope after Gram staining (B), the hemolytic test (C), and the phylogenetic tree (D).

[0021] Figure 2 The degradation effect of Bacillus parabromosyne S09T2 on OTA detected by UPLC-MS / MS (A) and the degradation products formed by Bacillus parabromosyne S09T2 after OTA degradation detected by UPLC-HRMS (B).

[0022] Figure 3 The relationship between fermentation time of Bacillus parasiticus S09T2 and the changes in the concentrations of OTA and degradation product OTα is investigated.

[0023] Figure 4 The degradation rate of different concentrations of OTA by the fermentation broth of Bacillus parasiticus S09T2 is shown.

[0024] Figure 5 The degradation rate of OTA by each component of Bacillus parabromosynthesis S09T2 is shown.

[0025] Figure 6 The thermal stability of crude enzyme solution of Bacillus parasiticus S09T2 is measured.

[0026] Figure 7 The pH stability of crude enzyme solution of Bacillus parabromhizobium S09T2.

[0027] Figure 8 This is a validation of the specific recognition target of Bacillus parabrachium S09T2. The PCR product of S09T2 amplified by the specific target primer set 5761_A and 5761_B is 828 bp. Caption: Lane M is the DNA marker, lane 1 is Bacillus parabrachium S09T2, lane 2 is sterile water, and the other lanes are the PCR products of the remaining 88 strains amplified by the specific target primer set. Detailed Implementation

[0028] The following detailed description, in conjunction with the accompanying drawings, will illustrate the present invention in detail. It should be understood that this detailed description is a more comprehensive depiction of certain aspects, characteristics, and embodiments of the invention, and not a limitation thereof. The materials, reagents, etc., used in this invention are all commercially available.

[0029] Example 1: Screening and Identification of OTA-Degrading Strains

[0030] 1. Screening of OTA-degrading strains

[0031] Soil samples were collected from multiple townships in Xunyang City, Ankang City, Shaanxi Province for screening OTA-degrading bacteria. 5 g of soil sample was dissolved in 50 mL of sterile 9 g / L NaCl aqueous solution, shaken at 200 r / min for 1 h to fully dissolve the bacteria, and then allowed to stand for 1 h to separate the soil and solution. The soil suspension was inoculated at a 10% (v / v) in LB broth medium (10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, pH 7.0-7.2) and incubated at 37℃ and 160 r / min for 24 h to obtain a bacterial enrichment solution. The bacterial enrichment solution was inoculated at a volume ratio of 10% into a primary screening medium (0.25 g / L potassium dihydrogen phosphate, 0.25 g / L magnesium sulfate heptahydrate, 0.5 g / L potassium nitrate, 0.5 g / L ammonium sulfate, 0.005 g / L calcium chloride, 0.003 g / L ferric chloride hexahydrate, with the remainder being water, pH 7.0, autoclaved at 121℃ for 20 min, followed by the addition of OTA standard solution to a final concentration of 10 μg / mL). The medium was then incubated at 37℃ and 160 r / min for 72 h before the OTA elimination rate was determined. The primary screening medium with the highest OTA elimination rate was serially diluted to 10 μg / mL using sterile PBS. -3 10 -4 10 -5 10 -6100 μL of bacterial suspension was spread onto LB solid medium and incubated at 37°C for 24 h. Strains with different morphological characteristics, colors, and sizes were picked from the plates for streak purification. The obtained single colonies were inoculated into LB liquid medium containing 1 μg / mL OTA and incubated at 37°C and 160 r / min for 3 days. The OTA content in the medium was then measured, and the degradation rate was calculated (using the UPLC-MS / MS detection method in Example 2, OTA degradation rate (%) = (initial OTA concentration - post-cultivation OTA concentration) / initial OTA concentration × 100%). Finally, a strain with the highest OTA degradation efficiency was obtained, numbered S09T2. Figure 1 A).

[0032] 2. Identification of the strain and safety assessment based on whole-genome sequencing

[0033] (1) The main morphological characteristics of strain S09T2 are: round, pale yellow, glossy, with smooth and regular edges; Gram-positive bacteria; rod-shaped; with spores. See attached image for colony morphology diagram. Figure 1 A; Morphological photographs observed under a Gram-stained optical microscope are attached. Figure 1 B.

[0034] (2) Genomic DNA was extracted from strain S09T2, and the whole genome of the strain was sequenced using Illumina Nextseq 550 second-generation sequencing and Nanopore PromethION 2i third-generation sequencing platforms. For second-generation sequencing, the library was constructed using the QIAseq FX DNA Library UDI D Kit (96) (QIAGEN, GERMANY), and sequencing was performed using the NextSeq 550 Reagent Kit v2 (300-cycle) (illumina, USA). For third-generation sequencing, the library was constructed using the RapidBarcoding Sequencing Kit (Nanopore, UK), and then sequencing was performed using R10 microarrays (Nanopore, UK). The data were quality controlled using Trimmomatic (v0.39-2) and Filtlong (v0.2.1) software, and then assembled using Unicycler (v0.5.0) software. The assembled strain's genome was assessed for quality control using Quast (v5.0) software, and virulence and resistance genes were identified and annotated using Abricate (v1.0.1) software. The completed genome of strain S09T2 was obtained through sequencing. The genome size was 6.12 Mb, with a (G+C) content of 52.31%. The genome contained 5582 CDS, 43 tRNAs, 11 rRNAs, and 1 tmRNA, but no plasmids. Abricate software comparisons with VFDB (VirulenceFactor Database), ARG-Annot (Antibiotic Resistance Gene-ANNOTation), CARD (the Comprehensive Antibiotic Research Database), and Resfinder databases showed no virulence or resistance genes. Strain S09T2 was inoculated onto blood agar plates and incubated at 37°C for 48 h to observe its hemolytic activity. Results are attached. Figure 1 C, Positive control Staphylococcus aureus Hemolysis was observed around the ATCC6538 colony, but not around the S09T2 colony, suggesting that strain S09T2 does not pose a risk of hemolysis and has a certain degree of safety.

[0035] (3) The 16S rRNA gene sequence of strain S09T2 was amplified by polymerase chain reaction (PCR), with a full length of 1406 bp. Homologous sequence searches were then performed in the NCBI database, and homologous sequences were downloaded for phylogenetic analysis. The sequencing results are shown in SEQ ID NO.1. The phylogenetic tree is attached. Figure 1 As shown in D. The results indicate that strain S09T2 was identified as *Bacillus parashortia* (…). Brevibacillus parabrevis ).

[0036] Bacillus parashortia ( Brevibacillus parabrevis S09T2 was deposited on September 26, 2025, at the Guangdong Provincial Microbial Culture Collection Center (GDMCC), located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Province, 510070, China. The accession number is GDMCC No. 67039. Classification and naming are as follows: Brevibacillus parabrevis .

[0037] Example 2: Detection methods for OTA and OTα

[0038] UPLC-MS / MS detection method:

[0039] Specifically, add 900 μL of acetonitrile (containing 0.1% formic acid by volume) to 100 μL of the solution containing the OTA concentration to be determined, vortex for 30 s, freeze at -20℃ for 2 h, add 40 mg of octadecylsilane-bonded silica gel and 40 mg of anhydrous magnesium sulfate, centrifuge at 12000 r / min for 10 min, take the supernatant and filter it through a 0.22 μm filter membrane, and analyze it by UPLC-MS / MS or store the sample at 4℃.

[0040] Chromatographic conditions: MicroPulite HSS T3 column (100 mm × 2.10 mm, 1.8 μm), mobile phase A was ultrapure water (containing 0.1% formic acid by volume), mobile phase B was acetonitrile, elution gradient: 0–5 min, mobile phase B linearly increased from 5% to 90%; 5–8 min, mobile phase B was 90%; 8–8.01 min, mobile phase B decreased from 90% to 5%; 8.01–10 min, mobile phase B was 5%; injection volume was 2 μL; flow rate was 0.3 mL / min; column temperature was 50℃.

[0041] Mass spectrometry conditions: Electrospray ionization (ESI) source, negative ion scanning mode, ion spray voltage -4500 V; ion source temperature 550 °C; curtain gas 30 psi; nebulizer gas (GS1) 55 psi; auxiliary heating gas (GS2) 60 psi; collision gas (nitrogen) 9 psi. MS / MS parameters for OTA and OTα are shown in Table 1.

[0042]

[0043] UPLC-HRMS detection method:

[0044] The sample preparation method is the same as the UPLC-MS / MS detection method described above.

[0045] Chromatographic conditions: MicroPulite HSS T3 column (100 mm × 2.10 mm, 1.8 μm), mobile phase A was ultrapure water (containing 0.1% formic acid by volume), mobile phase B was acetonitrile, elution gradient: 0–5 min, mobile phase B linearly increased from 5% to 90%; 5–8 min, mobile phase B was 90%; 8–8.01 min, mobile phase B decreased from 90% to 5%; 8.01–10 min, mobile phase B was 5%; injection volume was 2 μL; flow rate was 0.3 mL / min; column temperature was 50℃.

[0046] Mass spectrometry conditions: Electrospray ionization (ESI) source, positive and negative ion scanning mode, scan range m / z 70-1000. ESI source parameters were set as follows: sheath gas flow rate 50 Arb, auxiliary gas flow rate 10 Arb, capillary temperature 320°C, full MS resolution 30000, MS / MS resolution 15000, collision energy 30 / 50 / 70, spray voltage 3.5 kV (positive) or −2.5 kV (negative). Data analysis and compound identification were performed using Xcalibur 4.1 software.

[0047] Example 3: Degradation ability of Bacillus parabrachii S09T2 on OTA

[0048] 1. The degradation ability of Bacillus parabrachii S09T2 on OTA

[0049] The purified *Bacillus parabrittlesis* S09T2 single strain was inoculated into LB liquid medium and activated by incubation at 37°C and 160 r / min for 24 h. The activated bacterial solution was then inoculated into OTA-LB medium at a volume ratio of 1% and incubated at 37°C and 160 r / min for 72 h; the OTA-LB medium without S09T2 inoculation served as the control group. The OTA content in the control and experimental groups was determined using the UPLC-MS / MS detection method described in Example 2, and the degradation rate was calculated. The experiment was repeated at least three times.

[0050] OTA-LB medium preparation method: Add a certain volume of OTA labeling solution (1 mg / mL) to LB liquid medium and dissolve it completely so that the final concentration of OTA in the medium is 1 μg / mL.

[0051] OTA degradation rate (%) = (OTA concentration in control group - OTA concentration in experimental group) / OTA concentration in control group × 100%

[0052] Test results: From the attached Figure 2As shown in A, the retention time of OTA was 4.97 min as detected by UPLC-MS / MS. After Bacillus parasiticus S09T2 reacted with 1 μg / mL OTA for 72 h, the degradation rate of OTA reached 99%. A new peak appeared at 3.92 min, which may be a degradation product of OTA.

[0053] 2. Analysis of OTA degradation products

[0054] The purified single bacterial strain was inoculated into LB medium and incubated at 37°C and 160 r / min for 24 h to activate it. The activated bacterial solution was then inoculated into OTA-LB medium at a volume ratio of 1% and incubated at 37°C and 160 r / min for 72 h. Degradation products were detected using the UPLC-HRMS detection method described in Example 2.

[0055] Test results: From the attached Figure 2 According to B, the retention time of the standard OTα was 4.70 min as detected by UPLC-HRMS, and the mass numbers of the major fragments detected by secondary mass spectrometry were 255.00697 / 211.01674 / 166.99070 / 123.00074. After checking the relative molecular weight and secondary fragments, it was found that the degradation product of Bacillus parasiticus S09T2 after its interaction with OTA was OTα.

[0056] 3 sets of degradation kinetic curves of OTA by Bacillus shortbread S09T2

[0057] The activated Bacillus parasiticus S09T2 bacterial suspension was inoculated into OTA-LB medium at a volume ratio of 1% and cultured at 37°C and 160 r / min. The contents of OTA and OTα in the OTA-LB medium at 0 h, 4 h, 8 h, 12 h, 16 h, 24 h, 32 h, 40 h, 48 h, 56 h, 64 h, and 72 h were determined by the UPLC-MS / MS detection method described in Example 2.

[0058] Test results: From the attached Figure 3 It is known that Bacillus parabrachii S09T2 can convert OTA to OTα at a 1:1 ratio. After reacting with 1 μg / mL OTA for 72 h, OTA is almost completely converted to OTα.

[0059] 4. Degradation rate of OTA at different concentrations by Bacillus parabrachii S09T2 fermentation broth

[0060] Equal volumes of different concentrations of OTA were added to the fermentation broth of *Bacillus parabrachium breve* S09T2 cultured in LB liquid medium at 37℃ and 160 r / min for 24 h, resulting in final concentrations of 1, 2, 5, 8, and 10 μg / mL. The culture was maintained at 37℃ and 160 r / min, and the OTA content in the medium was measured at 0 h, 24 h, and 48 h to calculate the degradation rate of OTA by *Bacillus parabrachium breve* S09T2.

[0061] Test results: From the attached Figure 4 It was found that the degradation rate of OTA at 5 μg / mL and 8 μg / mL using the fermentation broth of Bacillus parasiticus S09T2 was over 93% within 24 h. After co-incubation for 48 h, efficient degradation of different concentrations of OTA (1, 2, 5, 8, and 10 μg / mL) was achieved, with degradation rates all exceeding 99%.

[0062] Example 4: OTA degradation capacity of various components of Bacillus parabrachium S09T2

[0063] Inoculate *Bacillus parasiticus* S09T2 at a volume ratio of 1% into 50 mL LB liquid medium and incubate at 37℃ and 160 r / min for 48 h. After fermentation, the fermentation culture (fermentation broth) is retained for later use.

[0064] 1. OTA degradation capacity of fermentation broth

[0065] Take 1 mL of fermentation broth. Add OTA standard solution (1 mg / mL), mix thoroughly with the fermentation broth (final OTA concentration is 1 μg / mL), incubate at 37℃ and 160 r / min for 48 h, then determine the OTA content and calculate the OTA degradation rate.

[0066] 2. OTA degradation capacity of fermentation supernatant

[0067] Take 10 mL of fermentation broth and centrifuge at 12000 r / min (4℃) for 10 min to separate the extracellular supernatant and cell pellet. Add 1 mL of extracellular supernatant to OTA standard solution (1 mg / mL) and mix thoroughly (final OTA concentration is 1 μg / mL). Incubate at 37℃ and 160 r / min for 48 h, then determine the OTA content and calculate the OTA degradation rate.

[0068] 3. The ability of intracellular lysates to degrade OTA

[0069] The bacterial cell pellet was resuspended in an equal volume of 1×PBS buffer, washed twice, and then resuspended again in an equal volume of 1×PBS buffer. 20 mL of the bacterial suspension was taken and subjected to ultrasonic disruption in an ice-water bath (operating conditions: 600 W, 5 s operation, 5 s pause, total time 30 min). The disrupted cell suspension was centrifuged at 12000 r / min (4℃) for 20 min, and the supernatant was filtered through a 0.22 μm filter to obtain the intracellular lysate. OTA standard solution (1 mg / mL) was added and thoroughly mixed with the intracellular lysate (final OTA concentration 1 μg / mL). The mixture was incubated at 37℃ and 160 r / min for 48 h, after which the OTA content was measured, and the OTA degradation rate was calculated.

[0070] 4. OTA degradation ability of inactivated bacteria

[0071] Take 10 mL of fermentation broth, centrifuge at 12000 r / min for 10 min, remove the supernatant, and resuspend the bacterial cells in an equal volume of 1×PBS buffer. Wash twice and resuspend in an equal volume of 1×PBS buffer. Place the washed bacterial suspension in an autoclave and sterilize at 121℃ and 0.1 MPa for 20 min. After cooling, obtain the inactivated bacterial solution. Take 1 mL of the inactivated bacterial solution and add OTA standard solution (1 mg / mL). Mix thoroughly with the inactivated bacterial solution (final OTA concentration is 1 μg / mL). Incubate at 37℃ and 160 r / min for 48 h, then determine the OTA content and calculate the OTA degradation rate.

[0072] 1×PBS phosphate buffered saline solution: sodium chloride 8.0 g / L, potassium dihydrogen phosphate 0.2 g / L, disodium hydrogen phosphate 1.15 g / L, potassium chloride 0.2 g / L, balance water, pH 7.2-7.4.

[0073] Test results: as attached Figure 5 It can be seen that the intracellular lysate of Bacillus parabrachii S09T2 is the main OTA degradation component, with a degradation rate of 99.3±0.3%; the fermentation supernatant is the minor OTA degradation component, with a degradation rate of 43.5±0.9%.

[0074] Example 5: Study on the thermal stability of crude enzyme solution of Bacillus parabrachii S09T2

[0075] To evaluate the thermostability of the crude enzyme solution of *Bacillus parabrachium brevis* S09T2 on the degradation of OTA under different temperature conditions, the intracellular lysate of *Bacillus parabrachium brevis* S09T2 described in Example 4 was used as the crude enzyme solution. The protein content in the crude enzyme solution was quantified using the BCA method, and then diluted to 0.2 mg / mL. Subsequently, OTA was added to the crude enzyme solution to a final concentration of 1 μg / mL. The reaction mixture was incubated at 2℃, 30℃, 37℃, 40℃, 50℃, 60℃, 70℃, and 80℃ for 6 hours, respectively. After incubation, the OTA content was measured, and the OTA degradation rate was calculated.

[0076] Test results: as attached Figure 6 It can be seen that the crude enzyme solution of S09T2 has certain thermal stability, and the degradation rate of OTA is above 60% within the range of 30-50℃. After co-incubation with 1 μg / mL OTA at 50℃ for 6 h, the degradation rate can reach 98%.

[0077] Example 6: pH stability study of crude enzyme solution of Bacillus parabrachii S09T2

[0078] The pH stability of the crude enzyme solution of *Bacillus parabrittlesis* S09T2 was further investigated. Protein content was determined using the BCA method, and the crude enzyme solution was concentrated to a protein concentration of 4 mg / mL using a 3KD ultrafiltration tube. 50 μL of the concentrated crude enzyme solution was mixed with 950 μL of buffer solutions at different pH values ​​to achieve a protein concentration of 0.2 mg / mL. The buffer solutions included three or two 0.1 mol / L systems: citrate-phosphate buffer (pH 3.0, pH 4.0, pH 5.0), sodium phosphate buffer (pH 6.0, pH 7.0, pH 8.0), and glycine-NaOH buffer (pH 9.0, pH 10.0), with OTA added to each to a final concentration of 1 μg / mL. All reaction mixtures were incubated at 37°C for 6 hours. After incubation, the OTA content was measured, and the degradation rate was calculated.

[0079] Test results: as attached Figure 7 It is known that the crude enzyme solution of Bacillus parabromhizobium S09T2 can function under neutral conditions and has the ability to degrade OTA at pH 6-8.

[0080] Example 7: Removal capacity of crude Bacillus parabrachii S09T2 enzyme solution for OTA in frangipani extract

[0081] 1. Prepare intracellular lysate of Bacillus parashortia S09T2 according to the method in Example 4.

[0082] 2. Collect frangipani flowers contaminated with OTA, grind them using a grinder and pass them through a 20-mesh sieve, then dry and store them at room temperature. Take 1 g of frangipani flowers into a 50 mL centrifuge tube and add 10 mL of water. Incubate in a 70℃ water bath for 30 min, then sonicate (frequency 40 kHz, power 250 W) for 30 min. Centrifuge at 3500 r / min for 5 min, then transfer the supernatant to a new centrifuge tube to obtain frangipani flower extract.

[0083] 3. Mix the intracellular lysate from step 1 with the frangipani extract from step 2 at a 1:1 volume ratio. The control group consisted of frangipani extract with an equal volume of 1×PBS. Each group was in triplicate. After incubating overnight at 37°C, the mixture was dried using a nitrogen blower, reconstituted with 1 mL of methanol (containing 0.1% formic acid by volume), sonicated (frequency 40 kHz, power 250 W) for 30 min, centrifuged at 8000 r / min for 5 min, and the supernatant was filtered through a 0.22 μm filter membrane and placed in a sample vial. The OTA content was determined using UPLC-MS / MS.

[0084]

[0085] Detection results: As shown in Table 2, after incubation at 37°C overnight with the intracellular lysate of Bacillus parabrachii S09T2 and frangipani extract, the OTA in the frangipani extract was significantly degraded, with a degradation rate of 67.3±6.4%. This demonstrates that the crude intracellular enzyme solution of Bacillus parabrachii S09T2 has the ability to degrade trace amounts of OTA in complex matrices.

[0086] Example 8: Specific recognition target of Bacillus parabrachium S09T2

[0087] To further protect *Bacillus parabrachium* S09T2, specific recognition sequences for this strain were identified. Complete genome sequences of *Bacillus parabrachium* and *Bacillus brevis* were downloaded from the NCBI database. Protein annotation of the genomes of all strains was performed using Prokka (v1.11), followed by pan-genome analysis using Roary (v3.11.2) software to obtain core and non-core gene sets for each strain, allowing for precise screening of protein-coding genes unique to *Bacillus parabrachium* S09T2. The obtained candidate specific gene protein sequences were aligned to the NCBI Non-Redundant Protein Database (NR), and sequences homologous to those of other strains were removed, yielding the unique specific target sequence SEQ ID NO.2 for *Bacillus parabrachium* S09T2.

[0088]

[0089] Polymerase chain reaction (PCR) and agarose gel electrophoresis were used to verify the effectiveness of *Bacillus parabrittlesis* S09T2 in specifically recognizing the target sequence. The PCR primer sequences are shown in Table 3.

[0090] The PCR reaction system was prepared as follows: 10 μL of 2× Hieff® Ultra-Rapid II HotStart PCR MasterMix (Yeasen Biotechnology, catalog number: 10167ES08); 1 μL of 5761_A; 1 μL of 5761_B; 8 μL of ddH2O; and a suitable amount of single colonies of the strains shown in Table 4 were picked as templates (ddH2O was used as the negative control).

[0091] PCR reaction conditions: 95℃, 5 min; 95℃, 15 s, 59℃, 20 s; 72℃, 1 s, 30 cycles; 72℃, 5 min; 4℃, ∞.

[0092] Verification of PCR products was performed using agarose gel electrophoresis, as shown in the attached figure. Figure 8 As shown in Table 4, except for *Bacillus parabrachium* S09T2, which showed a single specific band at 828 bp, other strains did not exhibit a single band at 828 bp. This reveals that the primer pair 5761_A and 5761_B can specifically distinguish *Bacillus parabrachium* S09T2 from other strains.

[0093] ;

[0094] Note: N represents the blank control, "-" indicates that no target band appeared, and "+" indicates that the target band appeared.

[0095] The above embodiments are merely preferred embodiments of the present invention, intended to better illustrate the technical solutions of the present invention, and should not be considered as limiting the scope of implementation of the present invention. Although the present invention has been described in detail with reference to specific embodiments, those skilled in the art can still make several changes or equivalent improvements without departing from the basic concept and essence of the present invention, and these should all be covered within the protection scope of the present invention.

[0096] SEQ ID NO.1 (16S rRNA gene sequence of Bacillus parashortia S09T2)

[0097]

[0098] SEQ ID NO.2 (Specific target sequence of Bacillus parabrachium S09T2)

[0099] TCAAGCGGTATTTTGTGATTTGGTTGCTGCCGCTTGTTGTGCTGCAAGCTTTCTTTCGGCAGCCGCAAGCAATACCGTATAAGCCATTTCCAAGCGCTCTTTTGCTCGGATAGTTTGGATCGTTGACAGGATAGTTTGGAGGCAACGTGACAATCACTTTACGCATTTTCTA CCCCTCCCCTTTGGTGAATCATTATGTGTGCGTGCTTGTTCAAAATGACTGAACATTACTAGGGCCATTCCAGCATCTGAAAATCTTTGGATGTGACTCCCAAGGAACTGATGATCCACAGTGCTGTTTTGCCTCGTGGTGAATATGGCTTGCTGGCCTCGAATCGTTGTACGACGGAAACGGAGACGCCTGCTCTGTCAGCCAGCTGCTTTTGGGTTAATCCCAACTGCTTTCGTCGGTTGCGGACGAATTTGGAAACCATCAATGTTAATCCGTCCCTTCAACAGGATTTTTCATCACTTTGCAGAATCTGTTTGTCGGAAGAACGTGTACTTTGGCGAGTGGCGTTCTTCTGATGTCGGAAAAGGAGGAGGTGATAAGAGTGATCGCTACTTACCTGATTGCTTTTAAACTTAATGACTCATCGACTAAGTACAGCAATCTGAAATTTGAGATTGAATCCCTGGGCAACTCTATTGAGGTGCTTGACAACCTTTACTTGGTTAAGACAGATATGAAGGTTGATGAAATTTCCTTTAACATCAAACAAGCGCTTCATGATAAAGATGAGTTGTTTGTAATAAGTTGTGGGGATGACTTCCAAGGACATGTCAGGACATCTGTTTGGGATTGGCTGGACGCAAATCAAACGGCCTAGAACACAACTTAGCGTGTTGACGCCCCTCTTTTTCTTGCTCTGTCAATGGGTAGTACGACCCCAGGTGCATGTTTTCCGCCCACGTCATGAACAGGGACCGCACCACTTCATTCTTGATGGTGTGTACCACTTCAGCCGCCGTATTGTCGG C GGCTCTCTTTTCCAGAGCA GCACCGATCTCTTCCCGCACGATCTCACGAACACGCGTTTCAGTTAGTTGCAT。

Claims

1. Bacillus parashortia ( Brevibacillus parabrevis S09T2, accession number: GDMCC No: 67039.

2. The *Bacillus parashortia* as described in claim 1 ( Brevibacillus parabrevis Application of S09T2 in the degradation of ochratoxin A or in the preparation of ochratoxin A biodegrading agents.

3. The application according to claim 2, characterized in that, is Bacillus parashortia ( Brevibacillus parabrevis Application of fermentation broth, intracellular lysate or fermentation supernatant of S09T2 in the degradation of ochratoxin A or in the preparation of ochratoxin A biodegrading agents.

4. A biological agent, characterized in that, The *Bacillus parashortia* as described in claim 1 ( Brevibacillus parabrevis S09T2 is used as the active ingredient.

5. The biological agent according to claim 4, characterized in that, It is Bacillus parashortia ( Brevibacillus parabrevis The fermentation broth, intracellular lysate, or fermentation supernatant of S09T2 are used as active ingredients.

6. A method for degrading ochratoxin A, characterized in that, Includes the following steps: using the *Bacillus parashortia* as described in claim 1 (… Brevibacillus parabrevis The sample is treated with the biological agent as described in claim 4 or S09T2.

7. The method according to claim 6, characterized in that, The conditions for processing the samples were a temperature of 30-55℃ and a pH of 6-8.

8. The method according to claim 6 or 7, characterized in that, The sample was frangipani.

9. A method for identifying the *Bacillus parashortia* as described in claim 1 (… Brevibacillus parabrevis The primer set of S09T2 is characterized by, The values ​​are 5'-CCCCTCCCCTTTGGTGAATC-3' and 5'-TGCTCTGGAAAAGAGAGCCG-3'.

10. A method for identifying the *Bacillus parashortia* as described in claim 1 (… Brevibacillus parabrevis The method of S09T2 is characterized in that, The procedure includes the following steps: performing PCR amplification on the test bacteria using the primer set described in claim 9; if an 828 bp product is amplified, it is Bacillus parabrachii S09T2; if no 828 bp product is amplified, it is not Bacillus parabrachii S09T2.

Images