SiRNA for targeted regulation and control of FXI gene expression, modifier, conjugate and application of siRNA, modifier and conjugate

Abstract

The present disclosure provides siRNAs, modifiers, conjugates and uses thereof for targeted regulation of Factor 11 of coagulation (FXI) gene expression. A series of siRNAs are designed based on an FXI messenger ribonucleic acid (mRNA) sequence, alternate modification is carried out, and modification is carried out by utilizing a group of specific modification templates. Cellular and animal experiment results show that some alternately modified and specific template modified oligonucleotide sequences can significantly inhibit the expression of the FXI gene, and can be used for developing anticoagulant drugs.

Description

TECHNICAL FIELD

[0001] The present disclosure belongs to the field of biological medicine, and particularly relates to siRNA, modifiers, conjugates targeting the regulation of FXI gene expression and uses thereof, such as in the regulation of FXI gene expression or in the anticoagulation. BACKGROUND

[0002] The coagulation cascade is completed through the endogenous coagulation pathway and the exogenous coagulation pathway. Among them, the endogenous coagulation pathway includes coagulation factors FXI and FXII. In the classic model, after contacting collagen, RNA or polyphosphates, FXII is activated, FXIIa further activates downstream FXI to produce FXIa, and through downstream coagulation factors such as FIX and FX, finally generates thrombin through the common pathway, which starts the formation of fibrin and activates FXI, forming a positive feedback to amplify the coagulation process. Thrombosis is mainly triggered by the endogenous pathway.

[0003] The exogenous coagulation pathway is usually initiated by tissure factor (TF), which activates FVII, and then activates the common pathway, and plays an important role in the process of hemostasis. When the blood vessel is damaged, FVII or FVIIa in the blood binds with tissure factor TF from the outside of the blood vessel, and the FVIIa-TF complex converts FX into FXa, and then FXa converts a limited amount of prothrombin into thrombin. In the process of hemostasis, FXI is converted into FXIa by thrombin, and then FXIa activates FIX and its downstream pathway to cause blood clotting, but the overall effect is relatively small. In summary, the important molecule FXI of the endogenous coagulation pathway plays an important role in the physiological process of regulating thrombus formation, but almost does not participate in the process of bleeding and other cases mainly regulated by the exogenous pathway, and thus can be used as a new target for antithrombotic therapy.

[0004] Among the currently marketed anticoagulants, vitamin K antagonists (VKA) mainly inhibit prothrombin and FX, heparin and oral anticoagulants (DOAC) mainly inhibit FXa and thrombin. These drugs may all inhibit the process of thrombus formation while inhibiting the hemostatic function related to the exogenous coagulation pathway, thus there is a certain risk of bleeding during treatment. In contrast, the target FXI in this study has little effect on the process of hemostasis, but plays a fundamental role in the process of thrombus formation, so it can effectively separate the processes of hemostasis and thrombus formation, and thus can reduce the risk of bleeding while anticoagulation. In addition, the fully modified siRNA drug coupled with GalNAc has good long-acting properties, can achieve once-dose-per-half-year, and has a sustained therapeutic effect, which will significantly improve patient compliance. SUMMARY

[0005] Problems to be solved by the invention:

[0006] Among the currently clinically used anticoagulants, vitamin K antagonists mainly inhibit prothrombin and FX, heparin and oral anticoagulants (DOACs) mainly inhibit FXa and thrombin. These drugs can all inhibit hemostatic function related to the extrinsic coagulation pathway while inhibiting thrombus formation, thus there is a certain risk of bleeding during treatment. In addition, many anti-coagulation small molecule inhibitors under development need to be administered daily, and patient compliance is low. Thirdly, for patients with impaired renal function, drugs metabolized by the kidneys have a greater impact on renal function. Therefore, there is an urgent need to develop anticoagulants that can reduce the risk of bleeding and improve patient compliance.

[0007] Solution:

[0008] The present disclosure designs a series of siRNA sequences targeting the FXI mRNA sequence, and modifies the specific templates, and couples N-acetylgalactosamine (GalNAc).

[0009] The present disclosure screens some alternative modification and specific modification sequences with significant inhibitory effect on FXI gene expression by modifying the designed siRNA sequences.

[0010] In one aspect, the present disclosure provides a siRNA duplex comprising an oligonucleotide duplex consisting of a sense strand and an antisense strand.

[0011] In another aspect, the present disclosure provides a conjugate for reducing the expression of FXI, comprising the above-mentioned siRNA duplex, and a conjugate group connected thereto.

[0012] In another aspect, the present disclosure provides a nucleic acid protein composition comprising the double-stranded region of the above-mentioned siRNA duplex or the antisense strand of the double-stranded region, and a nuclease.

[0013] In another aspect, the present disclosure provides a recombinant vector comprising a nucleic acid molecule encoding the above-mentioned siRNA duplex.

[0014] In some embodiments, the vector backbone of the recombinant vector is selected from a recombinant virus-derived circular RNA vector, a tRNA, a rRNA scaffold, and a chimeric tRNA / pre-miRNA vector.

[0015] In another aspect, the present disclosure provides a recombinant cell that synthesizes and secretes the above-mentioned siRNA duplex.

[0016] In some embodiments, the recombinant cell is selected from a sulfur-oxidizing Rhodopseudomonas and a ribonuclease III-deficient Corynebacterium glutamicum.

[0017] In another aspect, the present disclosure provides a method for preparing a siRNA duplex, comprising culturing the recombinant cell described above, or chemical synthesis.

[0018] In another aspect, the present disclosure provides a pharmaceutical composition comprising the siRNA duplex described above, the conjugate described above, or the nucleic acid protein composition described above, and a pharmaceutically acceptable carrier.

[0019] In another aspect, the present disclosure provides a method for inhibiting FXI gene expression, comprising contacting the siRNA duplex described above, the conjugate described above, the nucleic acid protein composition described above, or the pharmaceutical composition described above with a target cell.

[0020] In some embodiments, the method is for non-diagnostic or non-therapeutic purposes.

[0021] In some embodiments, the method is in vivo or in vitro.

[0022] In another aspect, the present disclosure provides use of the siRNA duplex described above, the conjugate described above, the nucleic acid protein composition described above, or the pharmaceutical composition described above in the preparation of a medicament for treating a disease associated with FXI gene expression.

[0023] The disease associated with FXI gene expression is selected from the group consisting of overexpression of FXI protein, pathogenic mutation of FXI gene, abnormal metabolism of FXI protein, and disease caused by abnormal interaction of FXI with another substance.

[0024] In some embodiments, the disease associated with FXI gene expression is selected from the group consisting of deep vein thrombosis, venous or arterial thrombosis, ischemic stroke, pulmonary embolism, myocardial infarction, stroke, Alzheimer's disease, and thrombotic disease associated with chronic kidney disease or end-stage kidney disease.

[0025] In another aspect, the present disclosure provides use of the siRNA duplex described above, the conjugate described above, the nucleic acid protein composition described above, or the pharmaceutical composition described above for treating a disease associated with FXI gene expression, such as stroke prevention in atrial fibrillation, dialysis in end-stage kidney disease, and anticoagulation in knee joint replacement.

[0026] In another aspect, the present disclosure provides a method for treating a disease associated with FXI gene expression, comprising administering to a subject in need thereof an effective amount of the siRNA duplex described above, the conjugate described above, the nucleic acid protein composition described above, or the pharmaceutical composition described above.

[0027] In another aspect, the present disclosure provides use of the siRNA duplex described above, the conjugate described above, the nucleic acid protein composition described above, or the pharmaceutical composition described above in the preparation of a medicament for treating cardiovascular and cerebrovascular diseases.

[0028] In another aspect, the present disclosure provides the above-mentioned siRNA duplex, the above-mentioned conjugate, the above-mentioned nucleic acid protein composition, or the above-mentioned pharmaceutical composition for use in treating cardiovascular and cerebrovascular diseases.

[0029] In another aspect, the present disclosure provides a method for treating cardiovascular and cerebrovascular diseases, comprising administering to a subject in need thereof an effective amount of the above-mentioned siRNA duplex, the above-mentioned conjugate, the above-mentioned nucleic acid protein composition, or the above-mentioned pharmaceutical composition.

[0030] Inventive Effects:

[0031] The beneficial effects achieved by the present disclosure are at least as follows:

[0032] (1) The sequence modified by alternating fluorine and oxygen and the template disclosed in the present disclosure can significantly inhibit the expression level of target gene FXI in HepG2 cells. The inhibition rate is significantly higher than that of the high-activity sequence in the published patent.

[0033] (2) The siRNA conjugate coupled with GalNAc conjugate group G101 of the present disclosure shows a high inhibition rate on the expression of target gene FXI in mouse in vivo experiments, and the duration is at least 49 days.

[0034] (3) The siRNA conjugate coupled with GalNAc conjugate group G101 of the present disclosure shows a high inhibition effect on the expression of target gene FXI and FXI activity in cynomolgus monkey in vivo experiments, and a prolongation effect on APTT (activated partial thromboplastin time), and the duration is at least 84 days.

[0035] (4) Certain basic sequences, using various modified templates, have a high inhibition rate on target gene FXI. DETAILED DESCRIPTION

[0036] In order to make the present disclosure easier to understand, some terms are defined first. In addition, it should be noted that whenever a range of values or a range of values for a parameter is listed, the purpose is to indicate that the intermediate values of the cited values and the range are also intended to be part of the present disclosure.

[0037] The articles "a" and "an" as used herein mean one or more than one (i.e., at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element, e.g., multiple elements.

[0038] The term "including" as used herein is intended to mean "including, but not limited to" and is used interchangeably with the phrase "including but not limited to".

[0039] The term "or" as used herein is intended to mean "and / or" and is used interchangeably with the term "and / or", unless the context clearly indicates otherwise.

[0040] As used herein, the term "about" or "approximately," as applied to one or more of the values of a target value, refers to a value that is similar to the stated reference value. In certain embodiments, unless otherwise stated or otherwise evident from context, the term "approximately" or "about" means a range falling within 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less of the stated reference value in either direction (greater than or less than) unless such number would exceed 100% of a possible value.

[0041] As used herein, "FXI" refers to the gene encoding coagulation factor XI or the protein expressed by the gene.

[0042] The term "FXI gene" can be a wild-type FXI gene, or a mutant of the FXI gene in which sequence variations exist. Numerous sequence variations in the FXI gene have been identified and can be found, for example, in the NCBI dbSNP and UniProt (see, e.g., ncbi.nlm.nih.gov / snp).

[0043] "G", "C", "A", and "U" each generally represent a nucleotide comprising, as a base, guanine, cytosine, adenine, and uracil, respectively. "T" and "dT" are used interchangeably herein and refer to a deoxyribonucleotide in which the nucleobase is thymine, such as deoxyribothymine, 2'-deoxythymidine, or thymidine. However, it will be understood that the term "ribonucleotide" or "nucleotide" or "deoxyribonucleotide" can also refer to a modified nucleotide (as described further below) or an alternative substituent moiety. The skilled artisan will be well aware that guanine, cytosine, adenine, and uracil can be replaced by other moieties without substantially altering the base pairing properties of an oligonucleotide, including a nucleotide having such a substituent moiety. For example, without limitation, a nucleotide comprising inosine as its base can pair with a nucleotide containing adenine, cytosine, or uracil. Thus, a nucleotide comprising uracil, guanine, or adenine can be replaced in a nucleotide sequence of the disclosure by a nucleotide comprising, for example, inosine. Sequences comprising such substituent moieties are suitable for use in, including but not limited to, double-stranded ribonucleic acids, double-stranded ribonucleic acid modifications, double-stranded ribonucleic acid conjugates, pharmaceutical compositions, and methods of the disclosure, among others.

[0044] The terms "complementary," "fully complementary," and "substantially complementary" can be used herein to refer to base pairing between the sense strand and the antisense strand of an siRNA, or between the antisense strand of an siRNA and a target sequence, as will be understood from the context of their use. In some aspects herein, a first nucleotide sequence can be considered complementary to a second nucleotide sequence if the first nucleotide sequence exhibits at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% degree of sequence complementarity with the second nucleotide sequence. In an exemplary embodiment, 18 of 20 nucleobases of a first nucleotide sequence pair with the corresponding region of a second nucleotide sequence, achieving 90% complementarity. The terms "double-stranded ribonucleic acid," "double-stranded RNA (dsRNA) molecule," "dsRNA," "ribonucleic acid duplex" can be used interchangeably and specifically refer to a complex of ribonucleic acid molecules having a double-stranded structure comprising two antiparallel, complementary or substantially complementary nucleic acid strands having "sense" and "antisense" orientation with respect to a target gene, e.g., FXI gene. In some embodiments, double-stranded ribonucleic acid (dsRNA) triggers the degradation of a target RNA, e.g., mRNA, through a post-transcriptional gene silencing mechanism, referred to herein as RNA interference or RNAi.

[0045] In the present context, in some cases, also "siRNA duplex", "double stranded RNAi agent" typically refers to the technical meaning as defined above. As is well known in the art, the term "siRNA duplex", "double stranded RNAi agent", "RNAi agent", "small interfering ribonucleic acid" or "siRNA" refers to a small interfering ribonucleic acid RNAi molecule. It is a class of double-stranded RNA molecules, also known in the art as short interfering RNA or silencing RNA. The siRNA typically comprises a sense strand (also referred to as a passenger strand) and an antisense strand (also referred to as a guide strand), wherein each strand is 17 to 30 nucleotides in length, typically 19 to 25 nucleotides in length, wherein the antisense strand is complementary (such as at least 95% complementary, such as fully complementary) to a target nucleic acid (suitably a mature mRNA sequence), and the sense strand is complementary to the antisense strand, such that the sense strand and the antisense strand form a duplex or duplex region. The sense strand and the antisense strand of the siRNA can form a blunt end duplex, or can form a duplex with a 3' overhang, e.g. 1, 2 or 3 nucleotides in length, similar to the product of Dicer, which can form a RISC substrate in vivo. Efficient extended versions of the Dicer substrate have been described in US 8349809 and US 8513207, hereby incorporated by reference. In some embodiments, both the sense strand and the antisense strand have a 3' overhang of 2 nucleotides in length. Thus, the length of the duplex region can be, e.g. 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides, such as 19, 20, 21, 22 or 23 nucleotides in length.

[0046] Also, in the present context, "siRNA" in some cases also refers to "base sequence". In the present context, "base sequence" in some cases specifically refers to an siRNA duplex wherein each nucleotide in the double stranded ribonucleic acid is an unmodified nucleotide, also appearing throughout the text as "motif", "siRNA motif" and the like. Thus, in the present context, "siRNA", "base sequence", "motif", "siRNA motif" can be used interchangeably, and their meaning also includes the respective nucleotide sequence order of the siRNA duplex referred to. In the present context, the skilled person is able to clearly understand from the context the exact technical meaning referred to. Further, the 5' terminal nucleotide of the antisense strand of the motif can or can not be linked to a 5' phosphate group or a 5' phosphate derivative group.

[0047] In the present context, "siRNA modifier" refers to a double-stranded ribonucleic acid comprising at least one modified nucleotide, in some cases also appearing as "double-stranded ribonucleic acid modifier". In the present context, different modifications of the siRNA motif are made to produce the corresponding siRNA modifier. For example, in some embodiments, the motif is modified with an alternating modification pattern to produce an alternatingly modified siRNA modifier. In other embodiments, the motif is modified with a specific modification pattern to produce a specific modification pattern modified siRNA modifier. In yet other embodiments, the motif is modified with an off-target protection modification pattern in the present context to produce an off-target protection modified siRNA modifier. In some cases, a plurality of different modification patterns can be used to modify the same siRNA motif to produce the corresponding siRNA modifier with a plurality of modification patterns.

[0048] In the present context, "siRNA conjugate" refers to a double-stranded ribonucleic acid conjugate or a conjugate of a double-stranded ribonucleic acid modifier resulting from linking a conjugate group to a double-stranded ribonucleic acid or a double-stranded ribonucleic acid modifier. Preferably, "siRNA conjugate" refers to a conjugate of a double-stranded ribonucleic acid modifier.

[0049] In some cases in the present context, "siRNA" refers not only to the unmodified siRNA duplex (or siRNA motif) described above, but also to the corresponding siRNA modifier and / or siRNA conjugate, e.g. in contexts relating to therapeutic methods, therapeutic agents, etc. including but not limited to, siRNA generically refers to at least one of a siRNA motif, a siRNA modifier and / or a siRNA conjugate. The specific technical meaning will be clear to the skilled person in the light of the context.

[0050] The term "antisense strand" refers to the strand of a double-stranded ribonucleic acid (e.g. an RNA duplex in the present context) comprising a region that is substantially complementary to a sequence defined herein (e.g. a target sequence). The term "region of complementarity" as used herein refers to a region on the antisense strand that is substantially complementary to a sequence defined herein (e.g. a target sequence). When the region of complementarity is not perfectly complementary to the target sequence, mismatches can be in the internal region of the molecule or at the terminal region. Generally, the most tolerated mismatches are at the terminal region, e.g. within 5, 4, 3, 2 or 1 nucleotides of the 5' and / or 3' terminus.

[0051] The term "sense strand" as used herein refers to the strand of a double-stranded ribonucleic acid comprising a region that is substantially complementary to a region of the antisense strand as the term is defined herein.

[0052] The term "alternating modification" refers to the use of 2'-methoxy (2'-OMe) and 2'-fluoro (2'-F) modifications on the nucleotides in the order of the nucleotide sequence of the double-stranded ribonucleic acid. For example, for the antisense strand of an siRNA, the odd-numbered positions (i.e., positions 1, 3, 5, 7, 11, 13, 15, 17, 19, 21, 23) are modified with 2'-methoxy and the even-numbered positions (i.e., positions 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22) are modified with 2'-fluoro. For the sense strand complementary to the antisense strand, the corresponding positions on the sense strand that are 2'-methoxy modified on the antisense strand are modified with 2'-fluoro and the positions on the sense strand that are 2'-fluoro modified on the antisense strand are modified with 2'-methoxy.

[0053] For RNA interference (RNAi), the inhibition of a target gene is achieved by the AGO2 protein loading the antisense strand of an siRNA and forming a silencing complex (RISC) that cleaves the mRNA transcript of the gene. The loading of the silencing complex (RISC) requires the 5' end of the antisense strand to be phosphorylated (5'-phosphate). The 5' end phosphorylation can occur naturally in the cell by the cleavage and polyadenylation factor I subunit 1 (Clp1) or it can be achieved by chemical synthesis. The term "natural 5' end phosphorylation" or "simple direct 5' end phosphorylation" refers to the 5' end phosphorylation of the antisense strand of an siRNA being completed in the cellular environment and not by chemical synthesis.

[0054] In the present context, a "conjugate group" is a GalNAc derivative attached to an oligonucleotide. In some cases, a conjugate group comprises a targeting group (also referred to as a ligand), optionally further comprising a linker, e.g. a GalNAc derivative attached to an oligonucleotide via a bivalent, trivalent or tetravalent branched linker arm, respectively, and further e.g. a GalNAc derivative attached to an oligonucleotide via a monovalent linker arm. In most cases, "ligand" and "conjugate group" have the meaning well known in the art.

[0055] The term "inhibit", as used herein, can be used interchangeably with "reduce", "silence", "down-regulate", "suppress" and other similar terms, and includes inhibition at any level. In the present context, "inhibit" in some cases refers to the meaning "reduce", and the skilled person will be aware of the specific meaning referred to depending on the context.

[0056] As used herein, the phrase "inhibiting expression of FXI" includes inhibiting expression of any FXI gene (such as, for example, a mouse FXI gene, a rat FXI gene, a monkey FXI gene, or a human FXI gene) as well as variants (e.g., naturally occurring variants) or mutants of FXI genes. Thus, the FXI gene can be a wild-type FXI gene, a mutant FXI gene, or a transgenic FXI gene in the context of a genetically manipulated cell, cell population, or organism.

[0057] "Inhibiting expression of a FXI gene" includes inhibition of a FXI gene at any level, such as at least partial inhibition of expression of a FXI gene, such as inhibition of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.

[0058] Expression of a FXI gene can be assessed based on any variable level associated with FXI gene expression, such as FXI mRNA level or FXI protein level. Inhibition of FXI gene expression can be assessed by a decrease in the absolute or relative level of one or more of these variables compared to a control level. The control level can be any type of control level utilized in the art, such as a pre-dose baseline level or a level determined from a similar untreated or control (e.g., buffer control or inert agent control) treated subject, cell, or sample.

[0059] In some instances herein, the meaning of "modulating" can be the same as "inhibiting"; accordingly, "modulating LPA gene expression" can mean "inhibiting LPA gene expression". The specific technical meaning will be clear to one of skill in the art in context.

[0060] As used herein, "patient" or "subject" is intended to include a human or non-human animal, preferably a mammal, such as a monkey. More preferably, the subject or patient is a human.

[0061] As used herein, "FXI-associated disease" is intended to include any disease associated with the FXI gene or protein. Such a disease can be caused, for example, by overproduction of the FXI protein, by mutation of the FXI gene, by abnormal cleavage of the FXI protein, by abnormal interactions between FXI and other proteins or other endogenous or exogenous agents. Exemplary FXI-associated diseases include deep vein thrombosis, venous or arterial thrombosis, ischemic stroke, pulmonary embolism, myocardial infarction, stroke, Alzheimer's disease, thrombotic disease including thrombosis associated with chronic kidney disease or end-stage renal disease.

[0062] As used herein, "therapeutically effective amount" is intended to include the amount of an RNAi agent that, when administered to a patient for treating an FXI-associated disease, is sufficient to effect treatment as measured by attenuation, amelioration, or maintenance of the existing disease or one or more symptoms of the disease. The "therapeutically effective amount" can vary depending on the RNAi agent, how the agent is administered, the disease and its severity, and the history, age, weight, family history, genetic makeup, stage of the pathological process mediated by FXI expression, type of prior or concomitant treatments, if any, and other individual parameters of the patient to be treated.

[0063] As used herein, "prophylactically effective amount" refers to an amount of an RNAi agent that, when administered to a subject who does not yet experience or exhibit symptoms of an FXI-associated disease, but who can be predisposed to the disease, is sufficient to prevent or ameliorate the disease or one or more symptoms of the disease. Ameliorating the disease includes slowing the progression of the disease or reducing the severity of the disease that develops later. The "prophylactically effective amount" can vary depending on the RNAi agent, how the agent is administered, the degree of risk of the disease, and the history, age, weight, family history, genetic makeup, type of prior or concomitant treatments, if any, and other individual parameters of the patient to be treated.

[0064] A "therapeutically effective amount" or "prophylactically effective amount" also includes the amount of an RNAi agent that produces some desired local or systemic effect at a reasonable benefit / risk ratio applicable to any treatment. The RNAi agents used in the methods of the disclosure can be administered in an amount sufficient to produce a reasonable benefit / risk ratio applicable to such treatment.

[0065] As used herein, the term "sample" includes analogous fluids, cells or tissues isolated from a subject, as well as a collection of fluids, cells or tissues present in a subject. Examples of biological fluids include blood, serum and serosal fluids, plasma, cerebrospinal fluid, ocular fluid, lymphatic fluid, urine, saliva, and the like. Tissue samples can include samples from a tissue, organ or local region. For example, a sample can be derived from a particular organ, organ portion, or fluids or cells within these organs. In certain embodiments, a sample can be derived from a liver (e.g., the entire liver or certain segments of the liver, or certain types of cells in the liver, e.g., hepatocytes). In preferred embodiments, a "sample derived from a subject" refers to blood or plasma drawn from the subject. In other embodiments, a "sample derived from a subject" refers to liver tissue (or sub-constituents thereof) derived from the subject.

[0066] In this document, any reference to any nucleotide position of any strand of an siRNA motif, siRNA modifier, siRNA conjugate, siRNA duplex, etc. is intended to refer to the 5' to 3' direction, unless otherwise specified.

[0067] In one aspect, the present disclosure provides an siRNA duplex targeting the regulation of FXI gene expression, comprising a sense strand and an antisense strand forming a region of reverse complementarity, the antisense strand comprising at least 15, 16, 17, 18, or 19 contiguous nucleotides that are complementary to a target sequence of nucleotide sequence TTTCAGGATGATTTTCTTATATCAAGT (SEQ ID NO: 773) or ACTTCAGTTTCTGGTGAATGT (SEQ ID NO: 774).

[0068] The above-mentioned target sequence is derived from Homo sapiens Coagulation factor XI (F11), transcript variant 1, Accession Number NM_000128.4 in the NCBI database.

[0069] In some embodiments, the antisense strand comprises a fragment of at least 15, 16, 17, 18, or 19 contiguous nucleotides in the sequence as shown in any one of SEQ ID NOs: 114-118, 121-123, and 139, or a modified fragment thereof.

[0070] In some embodiments, the region of reverse complementarity has a length of 17-21 bp, e.g., 20 or 21 bp.

[0071] In some embodiments, the sense strand comprises a fragment of at least 15, 16, 17, 18, or 19 contiguous nucleotides in the sequence as shown in any one of SEQ ID NOs: 8-12, 15-17, and 33, or a modified fragment thereof.

[0072] In some embodiments, the sense and antisense strands independently comprise 19-23 nucleotides in length; preferably, the sense strand comprises 19-21 nucleotides, and the antisense strand comprises 21-23 nucleotides.

[0073] In some embodiments, the siRNA duplex comprises any one or a combination of at least two of the following oligonucleotide duplexes, optionally each independently comprising at least one modified nucleotide:

[0074] (1) the sense strand has a sequence as set forth in SEQ ID NO: 8 or a fragment thereof; and the antisense strand has a sequence as set forth in SEQ ID NO: 114 or a fragment thereof;

[0075] (2) the sense strand has a sequence as set forth in SEQ ID NO: 9 or a fragment thereof; and the antisense strand has a sequence as set forth in SEQ ID NO: 115 or a fragment thereof;

[0076] (3) the sense strand has a sequence as set forth in SEQ ID NO: 10 or a fragment thereof; and the antisense strand has a sequence as set forth in SEQ ID NO: 116 or a fragment thereof;

[0077] (4) the sense strand has a sequence as set forth in SEQ ID NO: 11 or a fragment thereof; and the antisense strand has a sequence as set forth in SEQ ID NO: 117 or a fragment thereof;

[0078] (5) the sense strand has a sequence as set forth in SEQ ID NO: 12 or a fragment thereof; and the antisense strand has a sequence as set forth in SEQ ID NO: 118 or a fragment thereof;

[0079] (6) the sense strand has a sequence as set forth in SEQ ID NO: 15 or a fragment thereof; and the antisense strand has a sequence as set forth in SEQ ID NO: 121 or a fragment thereof;

[0080] (7) the sense strand has a sequence as set forth in SEQ ID NO: 16 or a fragment thereof; and the antisense strand has a sequence as set forth in SEQ ID NO: 122 or a fragment thereof;

[0081] (8) the sense strand has a sequence as set forth in SEQ ID NO: 17 or a fragment thereof; and the antisense strand has a sequence as set forth in SEQ ID NO: 123 or a fragment thereof;

[0082] (9) the sense strand has the sequence of SEQ ID NO: 33, or a fragment thereof; and the antisense strand has the sequence of SEQ ID NO: 139, or a fragment thereof.

[0083] In some embodiments, the siRNA duplex is an RNAi agent for inhibiting expression of a FXI gene.

[0084] In some embodiments, the sense strand differs by 1-3 nucleotides from any one of SEQ ID NOs: 8-12, 15-17, and 33.

[0085] In some embodiments, the antisense strand differs by 1-3 nucleotides from any one of SEQ ID NOs: 114-118, 121-123, and 139.

[0086] In some embodiments, the sense strand has the same number of nucleotides as the antisense strand or a different number of nucleotides than the antisense strand.

[0087] In some embodiments, the sense strand has 19 nucleotides and the antisense strand has 19 nucleotides.

[0088] In some embodiments, the sense strand has 19 nucleotides and the antisense strand has 21 nucleotides.

[0089] In some embodiments, the sense strand has 20 nucleotides and the antisense strand has 20 nucleotides.

[0090] In some embodiments, the sense strand has 20 nucleotides and the antisense strand has 22 nucleotides.

[0091] In some embodiments, the sense strand has 21 nucleotides and the antisense strand has 21 nucleotides.

[0092] In some embodiments, the sense strand has 21 nucleotides and the antisense strand has 23 nucleotides.

[0093] In some embodiments, the sense strand has 23 nucleotides and the antisense strand has 23 nucleotides.

[0094] In some embodiments, the sense strand and the antisense strand each independently comprise at least one modified nucleotide.

[0095] In some embodiments, the at least one modified nucleotide is selected from any one or a combination of at least two of the following group: a deoxy-nucleotide, a 3'-terminal deoxy-thymine (dT) nucleotide, a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, a non-locked nucleotide, a conformationally restricted nucleotide, a restricted ethyl nucleotide, an abasic nucleotide, a 2'-amino-modified nucleotide, a 2'-O-allyl-modified nucleotide, a 2'-C-alkyl-modified nucleotide, a 2'-hydroxyl-modified nucleotide, a 2'-methoxyethyl modified nucleotide, a 2'-O-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, a nucleotide comprising a non-natural base, a tetrahydropyran modified nucleotide, a 1,5-anhydrohexitol modified nucleotide, a cyclohexenyl modified nucleotide, a nucleotide comprising a phosphorothioate group, a nucleotide comprising a methylphosphonate group, a nucleotide comprising a 5'-phosphate, and a nucleotide comprising a 5'-phosphate mimic.

[0096] In some embodiments, at least one strand comprises a 3' overhang of at least 1 nucleotide.

[0097] In some embodiments, at least one strand comprises a 3' overhang of at least 2 nucleotides.

[0098] In some embodiments, the double-stranded region of the siRNA duplex is 15-30 pairs of nucleotides in length.

[0099] In some embodiments, the double-stranded region of the siRNA duplex is 17-25 pairs of nucleotides in length.

[0100] In some embodiments, the double-stranded region of the siRNA duplex is 19-23 pairs of nucleotides in length.

[0101] In some embodiments, the double-stranded region of the siRNA duplex is 21 pairs of nucleotides in length.

[0102] In some embodiments, each strand has 15-30 nucleotides.

[0103] In some embodiments, each strand has 19-25 nucleotides.

[0104] In some embodiments, the modification at the 2' position of the ribose of the nucleotide of the sense strand and the antisense strand is a modification selected from the group consisting of a 2'-methoxy modification, a 2'-methoxyethyl modification, a 2'-fluoro modification, a 2'-benzyloxy modification, a 2'-methylcarbonylamino modification, and a 2'-pyridyloxy modification.

[0105] In some embodiments, the modification at the 2' position of the ribose of the nucleotide is selected from any one or a combination of several of a 2'-methoxy modification, a 2'-methoxyethyl modification, a 2'-fluoro modification, a 2'-benzyloxy modification, a 2'-methylcarbonylamino modification, and a 2'-pyridyloxy modification.

[0106] In some embodiments, the modification at the 2' position of each ribose sugar of the nucleotides is selected from the group consisting of 2'-methoxy modification and 2'-fluoro modification.

[0107] In some embodiments, the modification at the 2' position of each ribose sugar of the nucleotides is selected from the group consisting of 2'-methoxy modification and 2'-fluoro modification.

[0108] In some embodiments, the modification at the 2' position of each ribose sugar of the nucleotides is selected from the group consisting of 2'-methoxy modification and 2'-fluoro modification.

[0109] In some embodiments, the modification at the 2' position of each ribose sugar of the nucleotides is selected from the group consisting of 2'-methoxy modification and 2'-fluoro modification.

[0110] In some embodiments, the modification at the 2' position of each ribose sugar of the nucleotides is selected from the group consisting of 2'-methoxy modification and 2'-fluoro modification.

[0111] In some embodiments, the nucleotides are connected to each other by 3',5'-phosphodiester linkages.

[0112] In some embodiments, the nucleotides are connected to each other by 3',5'-phosphodiester linkages.

[0113] In some embodiments, the 3' end and / or 5' end of the sense strand and / or the antisense strand of the siRNA modification is connected to the first 1-2 nucleotides by a 3',5'-phosphodiester linkage, for example, in some embodiments, a chiral pure 3',5'-phosphodiester linkage is formed. In some embodiments, the first 1-4 nucleotides at the 5' end of the sense strand and / or the first 1-4 nucleotides at the 3' end of the antisense strand can comprise 1, 2, or 3 3',5'-phosphodiester linkages.

[0114] In some embodiments, both the 3' and 5' terminal ends of the sense strand have 3', 5'- phosphorothioate linkages between the first and second nucleotides and between the second and third nucleotides from the 5' terminal end; and both the 3' and 5' terminal ends of the antisense strand have 3', 5'- phosphorothioate linkages between the first and second nucleotides and between the second and third nucleotides from the 5' terminal end. In some specific embodiments, the sense strand and / or the antisense strand has fluorine-oxygen alternating modifications.

[0115] In some embodiments, the siRNA duplex comprises any one or a combination of at least two of the following oligonucleotide duplexes consisting of a sense strand and an antisense strand pair:

[0116] (1) the sense strand has the sequence of SEQ ID NO: 220; the antisense strand has the sequence of SEQ ID NO: 326;

[0117] (2) the sense strand has the sequence of SEQ ID NO: 221; the antisense strand has the sequence of SEQ ID NO: 327;

[0118] (3) the sense strand has the sequence of SEQ ID NO: 222; the antisense strand has the sequence of SEQ ID NO: 328;

[0119] (4) the sense strand has the sequence of SEQ ID NO: 223; the antisense strand has the sequence of SEQ ID NO: 329;

[0120] (5) the sense strand has the sequence of SEQ ID NO: 224; the antisense strand has the sequence of SEQ ID NO: 330;

[0121] (6) the sense strand has the sequence of SEQ ID NO: 227; the antisense strand has the sequence of SEQ ID NO: 333;

[0122] (7) the sense strand has the sequence of SEQ ID NO: 228; the antisense strand has the sequence of SEQ ID NO: 334;

[0123] (8) the sense strand has the sequence of SEQ ID NO: 229; the antisense strand has the sequence of SEQ ID NO: 335;

[0124] (9) the sense strand has a sequence as set forth in SEQ ID NO: 245; the antisense strand has a sequence as set forth in SEQ ID NO: 351.

[0125] In some embodiments, the oligonucleotide has alternating fluorine and oxygen modifications or template modifications.

[0126] In some embodiments, the 5' position carbon atom of the 5' terminal nucleotide sugar of the modified antisense strand is phosphorylated, including but not limited to the following 5' phosphorylation groups: 5'-vinylphosphonate group (5'-E-VP), 5'-methylphosphonate group (5'-MP), 5'-C-methylphosphate group, 5'-phosphorothioate group (5'-PS) and 5'-phosphate group (5'-P), the modified nucleotide structure is shown as follows:

[0127] ;

[0128] wherein R is hydrogen, hydroxyl, amine, C 1-4 alkyl, aryl, C 1-4 alkoxy, C 1-4 alkylcarbonylamino or halogen;

[0129] The base is selected from any one of adenine, guanine, cytosine, thymine and uracil.

[0130] In some embodiments, the antisense strand of the siRNA modification has any one of the following modification patterns A~H:

[0131]

[0132]

[0133] and / or, the sense strand is modified with any one of the following modification patterns a-c:

[0134]

[0135] wherein 2'-OMe represents 2'-methoxy; 2'-F represents 2'-fluoro; 2'-Deoxy represents 2'-deoxy; PS represents a phosphorothioate linkage between the nucleotide at this position and its right adjacent nucleotide from the 5' end; EVP represents 5'-vinyl-(E)-phosphonate.

[0136] In some embodiments, the antisense strand is modified with modification pattern A, and the sense strand is modified with modification pattern a.

[0137] In some embodiments, the antisense strand is modified with modification pattern B, and the sense strand is modified with modification pattern a.

[0138] In some implementations, the antisense chain is modified by modifier C, and the justice chain is modified by modifier a.

[0139] In some implementations, the antisense chain is modified by modifier C, and the justice chain is modified by modifier b.

[0140] In some implementations, the antisense chain is modified by modifier D, and the justice chain is modified by modifier b.

[0141] In some implementations, the antisense chain is modified by modifier E, and the justice chain is modified by modifier b.

[0142] In some implementations, the antisense chain is modified by modifier F, and the justice chain is modified by modifier b.

[0143] In some implementations, the antisense chain is modified by the modifier G, and the justice chain is modified by the modifier b.

[0144] In some implementations, the antisense chain is modified with the modifier H, and the justice chain is modified with the modifier c.

[0145] In some implementations, the antisense strand of the siRNA modifier has any one of the following modifications A' to G':

[0146]

[0147]

[0148]

[0149] And / or, the justice chain is modified in the following manner: a' or b':

[0150]

[0151] Where 2'-OMe represents 2'-methoxy; 2'-F represents 2'-fluoro; 2'-Deoxy represents 2'-deoxy; PS indicates that the nucleotide at the 5' end is connected to the adjacent nucleotide on its right by a thiophosphate bond; and EVP represents 5'-vinyl-(E)-phosphonate.

[0152] In some implementations, the antisense chain is modified by the modifier A', and the justice chain is modified by the modifier a'.

[0153] In some implementations, the antisense chain is modified by modifier B', and the justice chain is modified by modifier a'.

[0154] In some embodiments, the antisense strand is modified with modification pattern C and the sense strand is modified with modification pattern a.

[0155] In some embodiments, the antisense strand is modified with modification pattern C and the sense strand is modified with modification pattern b.

[0156] In some embodiments, the antisense strand is modified with modification pattern D and the sense strand is modified with modification pattern b.

[0157] In some embodiments, the antisense strand is modified with modification pattern E and the sense strand is modified with modification pattern b.

[0158] In some embodiments, the antisense strand is modified with modification pattern F and the sense strand is modified with modification pattern b.

[0159] In some embodiments, the antisense strand is modified with modification pattern G and the sense strand is modified with modification pattern b.

[0160] In some embodiments, the siRNA duplex comprises any one or a combination of at least two of the following oligonucleotide duplexes consisting of the sense and antisense strand pair:

[0161] (1) the sense strand has the sequence as shown in SEQ ID NO: 426; and the antisense strand has the sequence as shown in SEQ ID NO: 552;

[0162] (2) the sense strand has the sequence as shown in SEQ ID NO: 427; and the antisense strand has the sequence as shown in SEQ ID NO: 553;

[0163] (3) the sense strand has the sequence as shown in SEQ ID NO: 429; and the antisense strand has the sequence as shown in SEQ ID NO: 555;

[0164] (4) the sense strand has the sequence as shown in SEQ ID NO: 430; and the antisense strand has the sequence as shown in SEQ ID NO: 556;

[0165] (5) the sense strand has the sequence as shown in SEQ ID NO: 431; and the antisense strand has the sequence as shown in SEQ ID NO: 557;

[0166] (6) the sense strand has the sequence as shown in SEQ ID NO: 435; and the antisense strand has the sequence as shown in SEQ ID NO: 561;

[0167] (7) the sense strand has the sequence set forth in SEQ ID NO: 439; and the antisense strand has the sequence set forth in SEQ ID NO: 565;

[0168] (8) the sense strand has the sequence set forth in SEQ ID NO: 440; and the antisense strand has the sequence set forth in SEQ ID NO: 566;

[0169] (9) the sense strand has the sequence set forth in SEQ ID NO: 442; and the antisense strand has the sequence set forth in SEQ ID NO: 568;

[0170] (10) the sense strand has the sequence set forth in SEQ ID NO: 443; and the antisense strand has the sequence set forth in SEQ ID NO: 569;

[0171] (11) the sense strand has the sequence set forth in SEQ ID NO: 444; and the antisense strand has the sequence set forth in SEQ ID NO: 570;

[0172] (12) the sense strand has the sequence set forth in SEQ ID NO: 445; and the antisense strand has the sequence set forth in SEQ ID NO: 571;

[0173] (13) the sense strand has the sequence set forth in SEQ ID NO: 446; and the antisense strand has the sequence set forth in SEQ ID NO: 572;

[0174] (14) the sense strand has the sequence set forth in SEQ ID NO: 447; and the antisense strand has the sequence set forth in SEQ ID NO: 573;

[0175] (15) the sense strand has the sequence set forth in SEQ ID NO: 448; and the antisense strand has the sequence set forth in SEQ ID NO: 574;

[0176] (16) the sense strand has the sequence set forth in SEQ ID NO: 449; and the antisense strand has the sequence set forth in SEQ ID NO: 575;

[0177] (17) the sense strand has the sequence set forth in SEQ ID NO: 450; and the antisense strand has the sequence set forth in SEQ ID NO: 576;

[0178] (18) the sense strand has the sequence as shown in SEQ ID NO: 454; and the antisense strand has the sequence as shown in SEQ ID NO: 580;

[0179] (19) the sense strand has the sequence as shown in SEQ ID NO: 455; and the antisense strand has the sequence as shown in SEQ ID NO: 581;

[0180] (20) the sense strand has the sequence as shown in SEQ ID NO: 456; and the antisense strand has the sequence as shown in SEQ ID NO: 582;

[0181] (21) the sense strand has the sequence as shown in SEQ ID NO: 468; and the antisense strand has the sequence as shown in SEQ ID NO: 594;

[0182] (22) the sense strand has the sequence as shown in SEQ ID NO: 471; and the antisense strand has the sequence as shown in SEQ ID NO: 597;

[0183] (23) the sense strand has the sequence as shown in SEQ ID NO: 477; and the antisense strand has the sequence as shown in SEQ ID NO: 603;

[0184] (24) the sense strand has the sequence as shown in SEQ ID NO: 478; and the antisense strand has the sequence as shown in SEQ ID NO: 604;

[0185] (25) the sense strand has the sequence as shown in SEQ ID NO: 479; and the antisense strand has the sequence as shown in SEQ ID NO: 605;

[0186] (26) the sense strand has the sequence as shown in SEQ ID NO: 480; and the antisense strand has the sequence as shown in SEQ ID NO: 606;

[0187] (27) the sense strand has the sequence as shown in SEQ ID NO: 529; and the antisense strand has the sequence as shown in SEQ ID NO: 655;

[0188] (28) the sense strand has the sequence as shown in SEQ ID NO: 530; and the antisense strand has the sequence as shown in SEQ ID NO: 656;

[0189] (29) the sense strand has the sequence of SEQ ID NO: 532; and the antisense strand has the sequence of SEQ ID NO: 658.

[0190] In some embodiments, the antisense strand described above has the 2ndto 8thnucleotides from the 5' end each independently being a modified nucleotide, which is UNA or GNA, or the antisense strand described above has the 2ndto 8thnucleotides from the 5' end each independently being DNA, wherein UNA and GNA have the following structures:

[0191]

[0192] wherein the base is selected from any one of adenine, guanine, cytosine, thymine, and uracil.

[0193] In some embodiments, the 3' end of the sense strand or the antisense strand described above is an inverted modified nucleotide, or the 6thor 7thfrom the 5' end of the sense strand is an inverted modified nucleotide, wherein the modified nucleotide is selected from the group consisting of dAinV, dTinV, dGinV, and dCinV, which have the following structures:

[0194]

[0195] In some embodiments, the siRNA duplex comprises any one or a combination of at least two of the following oligonucleotide duplexes consisting of the pairing of the sense strand and the antisense strand:

[0196] (1) the sense strand has the sequence of SEQ ID NO: 677; and the antisense strand has the sequence of SEQ ID NO: 686;

[0197] (2) the sense strand has the sequence of SEQ ID NO: 678; and the antisense strand has the sequence of SEQ ID NO: 687;

[0198] (3) the sense strand has the sequence of SEQ ID NO: 683; and the antisense strand has the sequence of SEQ ID NO: 693;

[0199] (4) the sense strand has the sequence of SEQ ID NO: 680; and the antisense strand has the sequence of SEQ ID NO: 689.

[0200] The double-stranded ribonucleic acid, double-stranded ribonucleic acid modification of the present disclosure can be optionally linked to one or more conjugate groups to form a double-stranded ribonucleic acid conjugate. The conjugate group can be attached to the sense strand, the antisense strand, or both strands at the 3' end, the 5' end, or both ends. For example, the conjugate group can be linked to the sense strand. In preferred embodiments, the conjugate group is linked at the 3' end of the sense strand. In one embodiment, the conjugate group has any GalNAc structure.

[0201] The present disclosure provides a siRNA conjugate comprising a siRNA duplex as described in the present disclosure, and a conjugate group linked to the siRNA duplex.

[0202] In some embodiments, the conjugate group is linked at the 3'-end or 5'-end of the sense strand, preferably at the 3'-end.

[0203] In some embodiments, the conjugate group is one or more GalNAc or its derivatives attached with a bivalent or trivalent branch connecting arm.

[0204] Typically, the conjugate group comprises at least one pharmaceutically acceptable targeting group, or further comprises a linker, and the siRNA, the linker, and the targeting group are sequentially linked. In some embodiments, the targeting group is 1-6. In some embodiments, the targeting group is 2-4. In some embodiments, the targeting group is 3. The conjugate group can be covalently or non-covalently linked to the siRNA molecule, and the linkage site can be at the 3' end or 5' end of the siRNA sense strand, at the 5' end of the antisense strand, or in the internal sequence of the siRNA. In some embodiments, the linkage site is at the 3' end of the siRNA sense strand.

[0205] In some embodiments, the pharmaceutically acceptable targeting group can be a conventional ligand in the field of siRNA administration, such as various ligands described in WO2009082607A2, which is incorporated by reference in its entirety.

[0206] In some embodiments, each ligand is independently selected from a ligand capable of binding to a cell surface receptor. In some embodiments, at least one ligand is a ligand capable of binding to a liver cell surface receptor. In some embodiments, at least one ligand is a ligand capable of binding to a mammalian cell surface receptor. In some embodiments, at least one ligand is a ligand capable of binding to a human liver cell surface receptor. In some embodiments, at least one ligand is a ligand capable of binding to a hepatic surface asialoglycoprotein receptor (ASGPR). The classes of such ligands are known to those skilled in the art, and their function is generally to bind to a specific receptor on the surface of the target cell, mediating delivery of the siRNA linked to the ligand to the target cell.

[0207] In some embodiments, the pharmaceutically acceptable targeting group in the siRNA conjugate can be galactose or N-acetylgalactosamine, wherein the galactose or N-acetylgalactosamine molecule can be monovalent, divalent, trivalent, or tetravalent. That is, after the siRNA molecule forms a siRNA conjugate with the conjugation group containing a galactose or N-acetylgalactosamine molecule as the targeting group, the molar ratio of the siRNA molecule to the galactose or N-acetylgalactosamine molecule in the siRNA conjugate is 1:1, 1:2, 1:3, or 1:4. In some embodiments, when the siRNA is conjugated with the conjugation group containing N-acetylgalactosamine, the N-acetylgalactosamine molecule is trivalent.

[0208] The targeting group can be linked to the siRNA molecule via a suitable linker, which can be selected by one skilled in the art according to the specific type of the targeting group. The classes of such linkers, targeting groups, and the manner of linking to the siRNA can be found in the disclosure of WO2015006740A2, which is incorporated by reference in its entirety.

[0209] In some embodiments, the structure of the conjugation group is, for example:

[0210] ,

[0211] wherein X is a hydroxyl protecting group selected from acetyl, benzoyl, or isobutyryl, or H; Y is an amine protecting group selected from formyl, acetyl, propionyl, n-butyryl, or isobutyryl, or H; n is an integer from 0 to 20; q, r, and s are independently an integer from 1 to 7.

[0212] In some embodiments, the structure of the conjugation group is, for example:

[0213] .

[0214] In some embodiments, the structure of the conjugation group is, for example:

[0215]

[0216] wherein X is oxygen, -N(Y)- or sulfur;

[0217] Y is C 1-4 alkyl or C 6-10 aryl;

[0218] R1is oxygen or sulfur;

[0219] R2is hydrogen, -NH2, C 1-4 alkyl, C 6-10 aryl, C 1-4 alkoxy or halogen;

[0220] A is -(CH2) a -, -(CH2CH2O) b -, -((CH2) c NHCO) d - or -((CH2) c CONH) d -, wherein a is an integer from 1 to 15, b is an integer from 1 to 7, c is an integer from 1 to 7, and d is an integer from 1 to 5;

[0221] B is -(CH2) e -, wherein e is an integer from 0 to 7;

[0222] L is -CONH- or -NHCO-;

[0223] X1is -(CH2) f - or -(CH2CH2O) f CH2-, and f is an integer from 1 to 5;

[0224] X2is -(CH2) g -, and g is an integer from 1 to 6;

[0225] X3is oxygen or sulfur;

[0226] Y1is 0 or 1;

[0227] Y2is 0, 1 or 2;

[0228] X4is CH2when Y3is 1; CH when Y3is 2; and carbon when Y3is 3;

[0229] m is an integer from 0 to 4;

[0230] n is an integer from 0 to 4.

[0231] In some embodiments, the conjugate group has, for example, any of the following structures:

[0232] ,

[0233] ,

[0234] ,or

[0235] .

[0236] In some embodiments, the siRNA conjugate has, for example, any of the following structures:

[0237] ,

[0238] ,

[0239] ,

[0240] ,and

[0241] .

[0242] In some embodiments, the conjugating group has, for example, the following structure:

[0243]

[0244] Where X is oxygen, -N(Y)-, or sulfur;

[0245] Y is C 1-4 Alkyl or C 6-10 Aromatic group;

[0246] R1 is oxygen or sulfur;

[0247] R2 represents hydrogen, -NH2, or C. 1-4 Alkyl, C 6-10 Aryl, C 1-4 Alkoxy or halogen;

[0248] A is -(CH2) a -、-(CH2CH2O) b -、-((CH2) c NHCO) d -or-((CH2) c CONH) d - where a is an integer from 1 to 15, b is an integer from 1 to 7, c is an integer from 1 to 7, and d is an integer from 1 to 5;

[0249] B is -(CH2) e -, where e is an integer between 0 and 7;

[0250] L is -CONH- or -NHCO-;

[0251] X1is -(CH2) f - or -(CH2CH2O) f CH2-, f is an integer from 1 to 5;

[0252] X2is -(CH2) g -, g is an integer from 1 to 6;

[0253] X3is oxygen or sulfur;

[0254] Y1is 0 or 1;

[0255] Y2is 0, 1, or 2;

[0256] X4is CH2when Y3is 1; CH when Y3is 2; and carbon when Y3is 3;

[0257] m is an integer from 0 to 4;

[0258] n is an integer from 0 to 4;

[0259] q is an integer from 0 to 4.

[0260] In some embodiments, the conjugate group has, for example, any one of the following structures:

[0261] , , , , and .

[0262] In some embodiments, the siRNA conjugate of the present disclosure has, for example, any one of the following structures:

[0263] ,

[0264] ,

[0265] ,

[0266] , or

[0267] .

[0268] In some embodiments, the conjugate group is G101.

[0269] In some embodiments, the siRNA conjugate comprises any one or a combination of at least two of the following oligonucleotide duplexes, pairing of a sense strand and an antisense strand:

[0270] (1) the sense strand has the sequence of SEQ ID NO: 695; and the antisense strand has the sequence of SEQ ID NO: 732;

[0271] (2) the sense strand has the sequence of SEQ ID NO: 706; and the antisense strand has the sequence of SEQ ID NO: 743;

[0272] (3) the sense strand has the sequence of SEQ ID NO: 707; and the antisense strand has the sequence of SEQ ID NO: 744;

[0273] (4) the sense strand has the sequence of SEQ ID NO: 708; and the antisense strand has the sequence of SEQ ID NO: 745;

[0274] (5) the sense strand has the sequence of SEQ ID NO: 710; and the antisense strand has the sequence of SEQ ID NO: 747;

[0275] (6) the sense strand has the sequence of SEQ ID NO: 713; and the antisense strand has the sequence of SEQ ID NO: 750;

[0276] (7) the sense strand has the sequence of SEQ ID NO: 714; and the antisense strand has the sequence of SEQ ID NO: 751;

[0277] (8) the sense strand has the sequence of SEQ ID NO: 715; and the antisense strand has the sequence of SEQ ID NO: 752;

[0278] (9) the sense strand has the sequence of SEQ ID NO: 719; and the antisense strand has the sequence of SEQ ID NO: 756;

[0279] (10) the sense strand has the sequence of SEQ ID NO: 720; and the antisense strand has the sequence of SEQ ID NO: 757;

[0280] (11) the sense strand has the sequence of SEQ ID NO: 721; and the antisense strand has the sequence of SEQ ID NO: 758;

[0281] (12) the sense strand has the sequence of SEQ ID NO: 722; and the antisense strand has the sequence of SEQ ID NO: 759;

[0282] (13) the sense strand has the sequence as shown in SEQ ID NO: 723; and the antisense strand has the sequence as shown in SEQ ID NO: 760;

[0283] (14) the sense strand has the sequence as shown in SEQ ID NO: 724; and the antisense strand has the sequence as shown in SEQ ID NO: 761;

[0284] (15) the sense strand has the sequence as shown in SEQ ID NO: 725; and the antisense strand has the sequence as shown in SEQ ID NO: 762;

[0285] (16) the sense strand has the sequence as shown in SEQ ID NO: 728; and the antisense strand has the sequence as shown in SEQ ID NO: 765;

[0286] (17) the sense strand has the sequence as shown in SEQ ID NO: 729; and the antisense strand has the sequence as shown in SEQ ID NO: 766.

[0287] The present disclosure also provides a nucleic acid protein complex comprising the double-stranded region or the antisense strand of the double-stranded region of the aforementioned siRNA duplex or siRNA conjugate, and a nuclease.

[0288] In the present disclosure, the term "nucleic acid protein complex" refers to the siRNA binding with Argonaute protein (AGO) to form an induced silencing complex (RISC). The siRNA is then dissociated into a sense strand and an antisense strand. The sense strand is degraded, and the antisense strand (guide strand) RISC binds to the target mRNA homologous to the siRNA through base pairing. RISC has the function of a nuclease, and the siRNA guides RISC to cut the homologous single-stranded mRNA, resulting in the loss of function of the mRNA, i.e., the inability to translate into a protein, that is, to "silence" the gene.

[0289] The present disclosure also provides a recombinant vector comprising a nucleic acid molecule encoding the siRNA as disclosed.

[0290] In some embodiments, the vector backbone of the recombinant vector is selected from the group consisting of a recombinant virus-like derived circular RNA vector, a tRNA, a rRNA scaffold, and a chimeric tRNA / pre-miRNA vector.

[0291] The present disclosure also provides a recombinant cell comprising the aforementioned siRNA or recombinant vector.

[0292] In some embodiments, the recombinant cell is selected from the group consisting of a Sulfurospirillum sp. and a ribonuclease III deficient C. glutamicum.

[0293] As used herein, a "recombinant vector" is preferably a vector comprising regulatory sequences operably linked to a nucleotide sequence encoding the sense strand comprised in the nucleic acid molecule of the present application. A "recombinant cell" is a cell in which at least one recombinant vector has been introduced that can express the nucleic acid molecule or at least one strand of this nucleic acid molecule.

[0294] The present disclosure also provides a method of preparing the siRNA of the present disclosure, the method comprising culturing the aforementioned recombinant cell, or directly obtaining the siRNA using a chemical synthesis and mixing approach.

[0295] The present disclosure also provides a pharmaceutical composition comprising the siRNA duplex or the corresponding siRNA conjugate described herein, and a pharmaceutically acceptable carrier.

[0296] In one embodiment, provided herein is a pharmaceutical composition comprising an siRNA as described herein and a pharmaceutically acceptable carrier. The pharmaceutical composition comprising the siRNA can be used to treat a disease or disorder associated with the expression or activity of the FXI gene, such as hypertension. Such pharmaceutical compositions are formulated based on the delivery model. One example is a composition formulated for systemic administration by parenteral delivery, for example, by subcutaneous injection (S.C.) delivery. Another example is a composition formulated for direct delivery to the brain parenchyma, for example, by infusion into the brain, for example, by continuous pump infusion.

[0297] The pharmaceutical composition comprising the siRNA of the present disclosure can be, for example, a solution with or without a buffer or a composition containing a pharmaceutically acceptable carrier. Such compositions include, for example, aqueous or crystalline compositions, liposome formulations, micelle formulations, emulsions, and gene therapy vectors.

[0298] In the methods of the present disclosure, the siRNA can be administered in a solution. A free siRNA can be administered in a non-buffered solution, for example, in physiological saline or in water. Alternatively, the free siRNA can also be administered in a suitable buffered solution. The buffered solution can include acetate, citrate, prolamine, carbonate, or phosphate, or any combination thereof. In a preferred embodiment, the buffered solution is phosphate buffered saline (PBS). The pH and the osmolality of the buffer comprising the siRNA can be adjusted such that it is suitable for administration to a subject.

[0299] In some embodiments, the buffered solution further comprises an agent for controlling the osmolality of the solution, such that the osmolality is maintained at a desired value, e.g., at the physiological value of human blood plasma. Solutes that can be added to the buffered solution to control the osmolality include, but are not limited to, proteins, peptides, amino acids, non-metabolizable polymers, vitamins, ions, sugars, metabolites, organic acids, lipids, or salts. In some embodiments, the agent for controlling the osmolality of the solution is a salt. In certain embodiments, the agent for controlling the osmolality of the solution is sodium chloride or potassium chloride.

[0300] The pharmaceutical compositions of the present disclosure can be administered in a dosage sufficient to inhibit expression of the FXI gene. Generally, a suitable dosage of the siRNA of the present disclosure is in the range of about 0.001 to about 200.0 milligrams per kilogram of body weight of the recipient per day, typically in the range of about 1 to 50 mg per kilogram of body weight per day. For example, the siRNA (e.g., dsRNA) can be administered at about 0.01, 0.05, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 20.5, 21, 21.5, 22, 22.5, 23, 23.5, 24, 24.5, 25, 25.5, 26, 26.5, 27, 27.5, 28, 28.5, 29, 29.5, 30, 31, 32, 33, 34, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or about 50 mg / kg per single dose.

[0301] The pharmaceutical composition can be administered once a day, or multiple times at different intervals from 1 to 365 days, or the siRNA can be administered in two, three or more sub-doses at appropriate intervals throughout the year, or even continuously by using a controlled release formulation using continuous infusion or delivery. In this case, the siRNA contained in each sub-dose must be correspondingly less so as to achieve the total daily dose. Dose units can also be compounded for delivery over several days, for example using conventional sustained release formulations that provide a sustained release of siRNA over a period of several days. Sustained release formulations are well known in the art and are particularly useful for delivering agents at a particular site, and can be used with the agents of the present disclosure. In this embodiment, the dose unit comprises a corresponding plurality of daily doses.

[0302] In other embodiments, a single dose of the pharmaceutical composition can be sustained for a long duration, such that subsequent doses are administered at intervals of no more than 3, 4, or 5 days or at intervals of no more than 1, 2, 3, or 4 weeks. In some embodiments of the disclosure, a single dose of the pharmaceutical composition of the disclosure is administered once a week. In other embodiments of the disclosure, a single dose of the pharmaceutical composition of the disclosure is administered once a month.

[0303] Those of skill in the art will appreciate that certain factors can influence the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or condition, previous treatments, the general health and / or age of the subject, and other existing diseases. In addition, treatment of a subject with a therapeutically effective dose of the composition can include a single treatment or a series of treatments. Effective doses and in vivo half-lives of the various siRNAs encompassed by the present disclosure can be estimated using conventional methods or based on in vivo testing using appropriate animal models.

[0304] The pharmaceutical compositions of the disclosure can be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration can be topical (e.g., through a skin patch), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizers; intratracheal; intranasal; epidermal and transdermal, oral or parenteral. Parenteral administration includes subcutaneous, intracutaneous, intradermal, intramuscular, intraperitoneal or intravenous injection or infusion; subdermal, e.g., via implantation devices; or intracranial, e.g., intracerebral, intrathecal or intraventricular, administration.

[0305] The siRNAs for use in the compositions and methods of the disclosure can be formulated for delivery in a membranous molecular assembly, e.g., a liposome or a micelle. As used herein, the term "liposome" refers to a vesicle composed of amphiphilic lipids arranged in a bilayer that has an external membrane formed of lipophilic material and an aqueous interior located inside. The lipophilic material separates the aqueous interior from the aqueous exterior, which typically does not include the siRNA composition, although in some examples it can. Liposomes are useful for transferring and delivering active ingredients to a site of action. Because the liposome membrane is structurally similar to a biological membrane, when a liposome is administered to a tissue, the liposome bilayer fuses with the bilayer of the cell membrane. As fusion of the liposome with the cell proceeds, the internal aqueous contents, including the siRNA, are delivered into the cell, where the siRNA can specifically bind to a target RNA and can mediate RNA interference (RNAi).

[0306] Liposomes comprising siRNA can be prepared by a variety of methods. In one example, the lipid components of the liposome are dissolved in a detergent such that micelles are formed with the lipid components. For example, the lipid components can be amphiphilic cationic lipids or lipid conjugates. The detergent can have a high critical micelle concentration and can be non-ionic. Exemplary detergents include cholate, CHAPS, octyl glucoside, deoxycholate, and lauroyl sarcosine. The siRNA preparation is then added to the micelles comprising the lipid components. The cationic groups on the lipids interact with the siRNA and condense around the siRNA to form liposomes. After condensation, the detergent is removed, e.g., by dialysis, to obtain the corresponding liposomal preparation of siRNA.

[0307] siRNAs, e.g., siRNA duplexes of the disclosure, can be fully encapsulated in a lipid formulation, e.g., an LNP or other nucleic acid-lipid particle.

[0308] As used herein, the term "LNP" refers to a stable nucleic acid-lipid particle. LNPs contain a cationic lipid, a non-cationic lipid, and a lipid that prevents the particles from aggregating, e.g., a PEG-lipid conjugate. LNPs are extremely useful for synthetic applications because they exhibit extended circulation lifetimes following intravenous (i.v.) injection and accumulate at distal sites, e.g., at sites physically separate from the site of administration.

[0309] In one embodiment, the mass ratio of lipid to siRNA duplex is about 1 : 1 to about 50: 1, about 1 : 1 to about 25: 1, about 3 : 1 to about 15: 1, about 4: 1 to about 10: 1, about 5: 1 to about 9: 1, or about 6: 1 to about 9: 1.

[0310] In some preferred embodiments, the lipid nanoparticle comprises a cationic lipid, a neutral lipid, a structural lipid, and a polymeric conjugated lipid.

[0311] In some preferred embodiments, the cationic lipid is a compound of structure (I), or an N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer thereof, wherein G1is C 1～6 alkylene; G2is C 2～8 alkylene; G3is C 1～3 alkylene; L1is C 6～15 linear alkyl; L2is C 12～25 branched alkyl. For example, YK-009 of structure (I-I), and the like (see patent CN114044741B, the entire contents of which are incorporated herein by reference, including in particular the general formulae and specific compounds therein, and the like).

[0312] (I)

[0313] (I-I)

[0314] In some preferred embodiments, the cationic lipid is a compound of structure (II), or an N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer thereof, wherein: G1is C 2~8 alkylene; G2is C 2~8 alkylene; L1is -C(O)O- or -OC(O)-; L2is -C(O)O- or -OC(O)-; R1is C 6~25 linear or branched alkyl; R2is C 6~25 linear or branched alkyl; G3is HO(CH2)2- or HO(CH2)3-; G4is HO(CH2)2- or HO(CH2)3-; L is (CH2)2- or -(CH2)3- or -(CH2)4-. For example, YK-401 of structure (II-I), YK-402 of structure (II-II), YK-407 of structure (II-III), and the like (see patent CN115784921B, the entire contents of which are incorporated herein by reference, including in particular the general formulae and specific compounds therein, and the like).

[0315] (II)

[0316] (II-I)

[0317] (II-II)

[0318] (II-III)

[0319] In some preferred embodiments, the cationic lipid is a compound of structure (III), or an N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer thereof, wherein: G1is C 1~6 alkylene; G2is C 2~8 alkylene; R1is C 6~20 linear or branched alkyl; R2is C 12~25 branched alkyl; G3is: HO(CH2)2N(CH3)(CH2)2-, HO(CH2)2N(CH2CH3)(CH2)2-, (HO(CH2)2)2N(CH2)2-, CH3O(CH2)2N(CH3)(CH2)2-, (CH3)2N(CH2)3SC(O)O(CH2)2-, (CH3)2N(CH2)3SC(O)-, CH3NH(CH2)2N(CH3)(CH2)2-, or CH3CH2NH(CH2)2-. For example, YK-201 of structure (III-I), YK-202 of structure (III-II), and the like (see patent CN115677518B, the entire contents of which are incorporated herein by reference, including in particular the general formulae and specific compounds therein, and the like).

[0320] (III)

[0321] (III-I)

[0322] (III-II)

[0323] In some preferred embodiments, the cationic lipid is a compound of structure (IV), or an N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer thereof, wherein G1is C 1~8 alkylene; G2is C 2~8 alkylene; R1is C 6~25 linear or branched alkyl; R2is C 12~25 linear or branched alkyl; G3is: HO(CH2)2N(R3)CH2CH(OH)CH2-, wherein R3is -CH3or -CH2CH3or -CH2CH2OH . For example, YK-305 of structure (IV-I), YK-310 of structure (IV-II), and the like (see patent CN115745820B, the entire contents of which are incorporated herein by reference, including in particular the general formulae and specific compounds therein, and the like).

[0324] (IV)

[0325] (IV-I)

[0326] (IV-II)

[0327] In some preferred embodiments, the cationic lipid is a compound of structure (V), or an N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer thereof, wherein G 1 and G 2 each independently is unsubstituted C6-C 10 alkylene; G 3 is unsubstituted C1-C 12 alkylene; R 1 and R 2 each independently is C6-C 24 alkyl or C6-C 24 alkenyl; R 3 is OR 5 , N, -C(=O)OR 4 , -OC(=O)R 4 , or -NR 5 C(=O)R 4 ; R 4 is C1-C 12 alkyl; and R 5 is H or C1-C6 alkyl; for example, ALC0315 of structure (V-I), and the like (see patent CN108368028B, the entire contents of which are incorporated herein by reference, including therein general formulas and specific compounds, etc.).

[0328] (V)

[0329] (V-I)

[0330] In some preferred embodiments, the cationic lipid is a compound of structure (V), or an N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer thereof, wherein R4is selected from -(CH2) n Q and -(CH2) n CHQR; Q is selected from the group consisting of -OR, -OH, -O(CH2) nN(R)2, -OC(O)R, -CX3, -CN, -N(R)C(O)R, -N(H)C(O)R, -N(R)S(O)2R, -N(H)S(O)2R, -N(R)C(O)N(R)2, -N(H)C(O)N(R)2, -N(H)C(O)N(H)(R), -N(R)C(S)N(R)2, -N(H)C(S)N(R)2, -N(H)C(S)N(H)(R), -N(R)S(O)2R8, and heterocycle; n is 1, 2, or 3; for example, SM102 of the structure of formula (VI-I) (see patent application CN110520409A, the entire contents of which are incorporated herein by reference, including in particular the general formulae and specific compounds therein, etc.).

[0331] (VI)

[0332] (VI-I)

[0333] In some preferred embodiments, the cationic lipid is a compound of the structure of formula (VII), or an N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer thereof (see patent CN102625696B, DLIN-MC3-DMA (as shown in formula (VII)), the entire contents of which are incorporated herein by reference, including in particular the general formulae and specific compounds therein, etc.),

[0334] (VII).

[0335] In some more preferred embodiments, the cationic lipid is selected from any one or a combination of at least two of the group consisting of YK-009, YK-407, YK-305, ALC0315, SM102, and DLIN-MC3-DMA.

[0336] In some preferred embodiments, the molar ratio of the cationic lipid to the neutral lipid is 1:1 to 10:1.

[0337] In some preferred embodiments, the molar ratio of the cationic lipid to the structural lipid is 1:1 to 5:1.

[0338] In some preferred embodiments, the molar ratio of the cationic lipid, the neutral lipid, the structural lipid, and the polymer-conjugated lipid is (25-65):(5-25):(25-70):(0.5-5).

[0339] In some preferred embodiments, the molar ratio of the cationic lipid, the neutral lipid, the structural lipid, and the polymer-conjugated lipid is (25-65):(5-25):(25-45):(0.5-5).

[0340] In some more preferred embodiments, the molar ratio of the cationic lipid, the neutral lipid, the structural lipid, and the polymer-conjugated lipid is 50:10:38.5:1.5 or 49:10:39.5:1.5.

[0341] In some preferred embodiments, the neutral lipid is selected from any one or a combination of at least two of the group consisting of phosphatidylcholine, phosphatidylethanolamine, sphingomyelin, ceramide, sterol, and derivatives thereof.

[0342] In some more preferred embodiments, the neutral lipid is selected from any one or a combination of at least two of the group consisting of 1,2-dilinoleoyl-sn-glycero-3- phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn- glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2- distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-didodecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3- phosphocholine (18:0 Diether PC), 1-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3- phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2- dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2- didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0 PE), 1,2-distearoyl-sn- glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2- dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3- phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl- sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), dipalmitoyl phosphatidylglycerol (DPPG), palmitoyloleoyl phosphatidyl ethanolamine (POPE), distearoyl-phosphatidyl-ethanolamine (DSPE), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoyl phosphoethanolamine (DMPE), 1-stearoyl-2-oleoyl-stearoylethanolamine (SOPE), 1-stearoyl-2-oleoyl- phosphatidylcholine (SOPC), sphingomyelin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid, palmitoyloleoyl phosphatidylcholine, lysophosphatidylcholine, lysophosphatidylethanolamine (LPE), and mixtures thereof.

[0343] In some more preferred embodiments, the neutral lipid is DOPE and / or DSPC.

[0344] In some preferred embodiments, the structural lipid is selected from any one or at least two in combination of the group consisting of: cholesterol, non-sterols, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, ursolic acid, a-tocopherol, corticosteroids.

[0345] In some more preferred embodiments, the structural lipid is cholesterol.

[0346] In some preferred embodiments, the polymeric conjugated lipid is selected from any one or at least two in combination of the group consisting of: PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol.

[0347] In some more preferred embodiments, the polymeric conjugated lipid is selected from any one or at least two in combination of the group consisting of: distearoylphosphatidylethanolamine polyethylene glycol 2000 (DSPE-PEG2000), dimyristoylglycerol-3-methoxypolyethylene glycol 2000 (DMG-PEG2000), and methoxypolyethylene glycol bimatiryl acetamide (ALC-0159).

[0348] Examples of pharmaceutical compositions of the present disclosure include, but are not limited to, aqueous formulations, emulsion formulations, and liposome-containing formulations. These compositions can be produced from a variety of components, examples of which include, but are not limited to, preformed liquids, self-emulsifying solids, and self-emulsifying semi-solids. For example, preferred are formulations that target the liver when treating liver disorders, such as liver cancer.

[0349] Pharmaceutical formulations of the present disclosure, which can conveniently be presented in unit dosage form, can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with a liquid carrier or a finely divided solid carrier or both, and then, if necessary, shaping the product.

[0350] The compositions of the present disclosure can be formulated into any of a number of possible dosage forms, such as, but not limited to, tablets, capsules, gelatin capsules, liquid syrups, soft capsules, suppositories, and enemas. The compositions of the present disclosure can also be formulated as suspensions in aqueous, non-aqueous, or mixed media. Aqueous suspensions can further contain substances which increase the viscosity of the suspension, such substances including, for example, sodium carboxymethylcellulose, sorbitol, and / or dextran. The suspension can also contain stabilizers.

[0351] Certain compositions of the present disclosure also incorporate a carrier compound into the formulation. As used herein, "carrier compound" or "carrier" can refer to a nucleic acid or its analog that is inert (i.e., not biologically active per se) but is considered a nucleic acid in vivo processes, e.g., by degrading or facilitating removal from circulation of biologically active nucleic acids, to reduce bioavailability of biologically active nucleic acids. Co-administration of a nucleic acid and a carrier compound, typically with the latter in excess, can result in a substantial reduction in the amount of nucleic acid recovered in the liver, kidney, or other peripheral reservoirs, presumably due to competition for a common receptor between the carrier compound and the nucleic acid. For example, co-administration with polyinosinic acid, dextran sulfate, polycytidylic acid, or 4-acetamido-4' isothiocyanatostilbene-2,2'-disulfonic acid can reduce recovery of partially phosphorothioated dsRNA in liver tissue (Miyao et al., DsRNA Res. Dev., 1995, 5, 115-121; Takakura et al., DsRNA & Nucl. Acid Drug Dev., 1996, 6, 177-183).

[0352] A "pharmaceutical carrier" or "excipient" in contrast to a carrier compound, is a pharmaceutically acceptable solvent, suspending agent or other vehicle with which a nucleic acid or nucleic acids is administered to an animal. The excipient can be liquid or solid and is selected with the aim of providing an appropriate vehicle for the active ingredient in dosage form. Typical pharmaceutical carriers include, but are not limited to, binders (e.g., pregelatinized corn starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylate, or dibasic calcium phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silicon dioxide, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oil, corn starch, polyethylene glycol, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulfate, etc.).

[0353] Pharmaceutically acceptable organic or inorganic excipients that are suitable for parenteral administration, that do not cause toxic reactions with nucleic acids, can also be used to formulate compositions of the disclosure. Suitable pharmaceutically acceptable carriers include but are not limited to: water, saline, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous parlecyl, hydroxymethylcellulose, polyvinylpyrrolidone, etc.

[0354] Formulations for topical administration of nucleic acids can include sterile or non-sterile aqueous solutions, non-aqueous solutions, or nucleic acid solutions in liquid or solid oil bases. These solutions also can include buffers, diluents, and other suitable additives. Pharmaceutically acceptable organic or inorganic excipients that are suitable for parenteral administration, that do not cause toxic reactions with nucleic acids, can be used.

[0355] Suitable pharmaceutically acceptable excipients include but are not limited to: water, saline, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous parlecyl, hydroxymethylcellulose, polyvinylpyrrolidone, etc.

[0356] The disclosure also provides methods for treating or preventing diseases and conditions that can be modulated by down-regulating FXI gene expression. For example, deep vein thrombosis, venous or arterial thrombosis, ischemic stroke, pulmonary embolism, myocardial infarction, stroke, Alzheimer's disease, thrombotic diseases associated with chronic kidney disease or end-stage renal disease.

[0357] The siRNAs of the disclosure can be administered to a subject using any mode of administration known in the art, including but not limited to subcutaneously, intravenously, intramuscularly, intraocularly, intrabronchially, intrapleurally, intraperitoneally, intraarterially, translymphatically, trans cerebrospinal, and any combination thereof. In preferred embodiments, the agents are administered subcutaneously.

[0358] In additional embodiments, the siRNA is administered in combination with an additional therapeutic agent. The siRNA and the additional therapeutic agent can be administered in combination in the same composition, e.g., parenterally, or the additional therapeutic agent can be administered as part of a separate composition or by another method described herein.

[0359] Examples of additional therapeutic agents include agents known to treat thrombotic diseases or agents known to treat cardiovascular and cerebrovascular diseases, including, for example, anticoagulants, antiplatelet agents, and thrombolytic agents for acute myocardial infarction and pulmonary embolism, and other agents. Among them, the anticoagulants include warfarin, heparin, low molecular weight heparin (e.g., enoxaparin), direct oral anticoagulants (e.g., dabigatran, rivaroxaban, apixaban, and edoxaban); the antiplatelet agents include aspirin, clopidogrel, ticagrelor, and prasugrel; the thrombolytic agents for acute myocardial infarction and pulmonary embolism include alteplase, tenecteplase, and streptokinase; and the other agents include fondaparinux and bivalirudin.

[0360] In one embodiment, the siRNA is administered to a patient and subsequently an additional therapeutic agent is administered to the patient (or vice versa). In another embodiment, the siRNA and the additional therapeutic agent are administered simultaneously.

[0361] The following examples are intended to illustrate the present disclosure but not to limit the scope of the present disclosure. If not specifically mentioned, the technical means used in the examples are the conventional means well known to those skilled in the art, and the raw materials used are commercially available.

[0362] Nucleotide abbreviations used herein are as follows:

[0363] A = adenosine-3'-phosphate

[0364] Am = 2'-methoxyadenosine-3'-phosphate

[0365] Ams = 2'-methoxyadenosine-3'-phosphorothioate

[0366] Af = 2'-fluoroadenosine-3'-phosphate

[0367] Afs = 2'-fluoroadenosine-3'-phosphorothioate

[0368] dA = 2'-deoxyadenosine-3'-phosphate

[0369] dAs = 2'-deoxyadenosine-3'-phosphorothioate

[0370] G = guanosine-3'-phosphate

[0371] Gm = 2'-methoxyguanosine-3'-phosphate

[0372] Gms = 2'-methoxyguanosine-3'-phosphorothioate

[0373] Gf = 2'-fluoroguanosine-3'-phosphate

[0374] Gfs = 2'-fluoroguanosine-3'-phosphorothioate

[0375] dG = 2'-deoxyguanosine-3'-phosphorothioate

[0376] dGs = 2'-deoxyguanosine-3'-phosphorothioate

[0377] C = cytidine-3'-phosphorothioate

[0378] Cm = 2'-methoxy cytidine-3'-phosphorothioate

[0379] Cms = 2'-methoxy cytidine-3'-phosphorothioate

[0380] Cf = 2'-fluorocytidine-3'-phosphorothioate

[0381] Cfs = 2'-fluorocytidine-3'-phosphorothioate

[0382] dC = 2'-deoxycytidine-3'-phosphorothioate

[0383] dCs = 2'-deoxycytidine-3'-phosphorothioate

[0384] U = uridine-3'-phosphorothioate

[0385] Um = 2'-methoxy uridine-3'-phosphorothioate

[0386] Ums = 2'-methoxy uridine-3'-phosphorothioate

[0387] Uf = 2'-fluorouridine-3'-phosphorothioate

[0388] Ufs = 2'-fluorouridine-3'-phosphorothioate

[0389] dT = 2'-deoxyadenosine-3'-phosphorothioate

[0390] dTs = 2'-deoxyadenosine-3'-phosphorothioate

[0391] AmsEVP = 5'-vinyl-(E)-phosphonate-2'-methoxyadenosine-3'- phosphorothioate

[0392] UmsEVP = 5'-vinyl-(E)-phosphonate-2'-methoxyuridine-3'- phosphorothioate

[0393] dAinV = (3'-3' linkage) 2'-deoxyadenosine-3'-phosphorothioate

[0394] dTinV = (3'-3' linkage) 2'-deoxythymidine-3'-phosphorothioate

[0395] Agna = adenosine-diol nucleic acid

[0396] Cgna = cytidine-diol nucleic acid

[0397] Ggna = Guanosine-diol nucleic acid

[0398] Tgna = Thymidine-diol nucleic acid

[0399] Ugna = Uridine-diol nucleic acid

[0400] The code rules for siRNA motifs (or motif), siRNA modifiers, siRNA conjugates, etc. herein are exemplified as follows:

[0401] The motif is an unmodified RNA sequence. For sequences with 20 / 22 bases in the sense / antisense strand, respectively, compared to 21 / 23 bases in the sense / antisense strand, respectively, the "s" is added to the motif number to distinguish, e.g. compound B00211s.

[0402] The sequence with 2'-methoxy (2'-OMe) and 2'-fluoro (2'-F) alternating modification is denoted by "-AL" after the motif number. For example, the code for the modified B00211 with alternating modification is B00211-AL.

[0403] For siRNA modifiers as exemplified in Table 7 of Example 1, the modification is performed using the modification templates disclosed herein, DV25P, DV26P, DV27P, DV29P, DV32P, DV34P, DV39P, DV40P, DV25SP, DV26SP, DV27SP, DV29SP, DV32SP, DV34SP, DV39SP and DV40SP, respectively, the corresponding code rules are: the first letter of the code for the corresponding siRNA motif of the siRNA modifier is changed from "B" to "C", and the corresponding template name is added after the number. For example, the sequence of B00211 modified using the DV25P template is C00211-DV25P.

[0404] For siRNA modifiers as exemplified in Table 8 of Example 1, the modification involves the use of the modification templates disclosed herein, and at the same time, the use of off-target prevention and / or inverted modification is possible, the corresponding code rules are: the first letter of the code for the corresponding motif of the siRNA modifier is changed from "B" to "C", and the corresponding template name and / or off-target prevention / inverted modification name (if present) is added in sequence after the code. For example, for the motif B00211, the code for the modifier obtained after the use of the DV25P template modification and the use of inverted modification InV is C00211-DV25PInVG101.

[0405] For siRNA conjugates as appeared in Table 8 of Example 1, the modification templates disclosed herein are employed, and at the same time, off-target protection or inverted modification mode can be further employed, and for siRNA modification with inverted modification on the sense strand, the conjugate group is attached at the 5' end of the sense strand; for siRNA modification without inverted modification, the conjugate group is attached at the 3' end of the sense strand. The code rule is that the first letter of the code of the corresponding motif is changed from "B" to "D", and the code is followed by the name of the corresponding template and the name of the off-target protection / inverted modification (if present), and the name of the conjugate group such as "G103", "G101" etc. is added at the end. For example, for motif B00211, the code of the conjugate obtained after employing DV25P template modification and inverted modification InV, and attaching conjugate group G101 is D00211-DV25PInVG101. See the following table for code examples.

[0406] Code examples of siRNA duplexes (motifs, modifications, conjugates) in the present disclosure

[0407]

[0408] Examples

[0409] Other objects, features and advantages of the present disclosure will become apparent from the following detailed description. It is to be understood, however, that the detailed description and specific examples, while indicating specific embodiments of the present disclosure, are given by way of illustration only, since various changes and modifications within the spirit and scope of the present disclosure will become apparent to those skilled in the art from this detailed description.

[0410] The experimental techniques and experimental methods used in the present examples are all conventional techniques and methods, and for example, the experimental methods not specifically mentioned in the following examples are generally performed according to the conditions described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. The materials, reagents, etc. used in the examples can be obtained through commercial channels, unless otherwise specified.

[0411] As understood by those skilled in the art, in various embodiments of the present disclosure, when the subject in the experiment is an siRNA conjugate, the experimental data and results of inhibition rate, IC 50 , IC 40 of the siRNA conjugate can correspondingly reflect the inhibition rate, IC 50 , IC 40and the like. There is no obstacle to understanding for those skilled in the art.

[0412] Example 1: Sequence design

[0413] 1. Basic sequence

[0414] According to the human FXI mRNA sequence (NM_000128.4), 106 siRNA motifs were designed (Table 1). Among them, APC is the basic sequence siFXIg1 of the most active compound siFXIg1M1SP in the patent CN113227376B, which is used as a positive control in this study. ANC is a nonsense sequence, which is used as a negative control.

[0415] Table 1 siRNA motif

[0416]

[0417]

[0418]

[0419] 2. siRNA modification

[0420] 2.1 Fluorine-oxygen alternating modification

[0421] To improve the inhibition rate and stability, the siRNA motifs in Table 1 are modified by 2'-methoxy (2'-OMe) and 2'-fluoro (2'-F) alternately, and 3', 5'-phosphorothioate bonds are introduced between the nucleotides at the 5' end and / or the 3' end. The rule of the alternately modified in the present disclosure is: for the sequence with odd number of nucleotides in the sense strand, the corresponding alternately modified siRNA modifier has 2'-F modified nucleotides at the odd positions and 2'-OMe modified nucleotides at the even positions in the sense strand; but for the sequence with even number of nucleotides in the sense strand, the corresponding alternately modified siRNA modifier has 2'-OMe modified nucleotides at the odd positions and 2'-F modified nucleotides at the even positions in the sense strand; the odd positions have 2'-OMe modified nucleotides and the even positions have 2'-F modified nucleotides in the antisense strand; in addition, the 3', 5'-phosphorothioate bonds are introduced between the 1st and 2nd nucleotides and between the 2nd and 3rd nucleotides at the 5' end of the sense strand; the 3', 5'-phosphorothioate bonds are introduced between the 1st and 2nd nucleotides and between the 2nd and 3rd nucleotides at the 5' end of the antisense strand, and the 3', 5'-phosphorothioate bonds are introduced between the 1st and 2nd nucleotides and between the 2nd and 3rd nucleotides at the 3' end of the antisense strand. The alternately modified siRNA modifier designed according to the rule is represented by adding "-AL" after the original basic sequence number. The alternately modified siRNA modifier is the modifier with the number APC-AL obtained by alternately modifying the motifs B00202~B00217, B00302~B00312, B00401~B00410, B00701~B00709, B02601~B02609, B05001~B05008, B05201~B05208, B06401~B06411, B07401~B07408, B07501~B07506 and B07901~B07908 in Table 1 by fluorine-oxygen alternation, which is the siRNA modifier obtained by alternately modifying the siRNA motif siFXIg1M1SP with the highest activity shown in the patent CN113227376B, and is used as a positive control in the present study. The modifier with the number ANC-AL is the siRNA modifier obtained by alternately modifying the siRNA motif ANC in Table 1 by fluorine-oxygen alternation, and is used as a negative control in the present study.

[0422] Table 2 siRNA modifier modified by fluorine-oxygen alternation

[0423]

[0424]

[0425]

[0426]

[0427]

[0428]

[0429]

[0430]

[0431]

[0432] 2.2 Modified siRNA with modified template

[0433] 2.2.1 Modified template

[0434] The modified templates of the present disclosure include DV25P, DV26P, DV27P, DV29P, DV32P, DV34P, DV39P, DV40P, DV25SP, DV26SP, DV27SP, DV29SP, DV32SP, DV34SP, DV39SP and DV40SP. DV22 is an Advanced ESC template disclosed in prior art (fluorinated sites: antisense strand 2, 6, 14 and 16, sense strand 7, 9, 10 and 11). The modified templates are shown in Tables 3-6. The modification rules are as follows:

[0435] For siRNA motif with 21 / 23 bases in length for antisense and sense strands respectively, any one of the modification modes shown in Table 3 and Table 4 is used for the antisense and sense strands respectively.

[0436] For siRNA motif with 20 / 22 bases in length for antisense and sense strands respectively, any one of the modification modes shown in Table 5 and Table 6 is used for the antisense and sense strands respectively.

[0437] The siRNA modified template with modification mode A and a for antisense and sense strands respectively is named as DV25P;

[0438] The siRNA modified template with modification mode B and a for antisense and sense strands respectively is named as DV26P;

[0439] The siRNA modified template with modification mode C and a for antisense and sense strands respectively is named as DV27P;

[0440] The siRNA modified template with modification mode C and b for antisense and sense strands respectively is named as DV29P;

[0441] The siRNA modified template with modification mode D and b for antisense and sense strands respectively is named as DV32P;

[0442] The siRNA modified template with antisense and sense strands modified by modification pattern E and b respectively is designated as DV34P;

[0443] The siRNA modified template with antisense and sense strands modified by modification pattern F and b respectively is designated as DV39P;

[0444] The siRNA modified template with antisense and sense strands modified by modification pattern G and b respectively is designated as DV40P;

[0445] The prior art published modified template DV22 with antisense and sense strands modified by modification pattern H and c respectively;

[0446] The siRNA modified template with antisense and sense strands modified by modification pattern A' and a' respectively is designated as DV25SP;

[0447] The siRNA modified template with antisense and sense strands modified by modification pattern B' and a' respectively is designated as DV26SP;

[0448] The siRNA modified template with antisense and sense strands modified by modification pattern C' and a' respectively is designated as DV27SP;

[0449] The siRNA modified template with antisense and sense strands modified by modification pattern C' and b' respectively is designated as DV29SP;

[0450] The siRNA modified template with antisense and sense strands modified by modification pattern D' and b' respectively is designated as DV32SP;

[0451] The siRNA modified template with antisense and sense strands modified by modification pattern E' and b' respectively is designated as DV34SP;

[0452] The siRNA modified template with antisense and sense strands modified by modification pattern F' and b' respectively is designated as DV39SP;

[0453] The siRNA modified template with antisense and sense strands modified by modification pattern G' and b' respectively is designated as DV40SP.

[0454] Table 3. Antisense strand modification pattern (21 / 23 nt)

[0455]

[0456]

[0457] where 2'-OMe indicates 2'-methoxy; 2'-F indicates 2'-fluoro; 2'-Deoxy indicates 2'-deoxy; PS indicates a phosphorothioate linkage between the nucleotide at this position and its right-hand neighbor, starting from the 5' end; and EVP indicates a 5'-vinyl-(E)-phosphonate.

[0458] Table 4. Sense strand modification patterns (21 / 23 nt)

[0459]

[0460] where 2'-OMe indicates 2'-methoxy; 2'-F indicates 2'-fluoro; 2'-Deoxy indicates 2'-deoxy; PS indicates a phosphorothioate linkage between the nucleotide at this position and its right-hand neighbor, starting from the 5' end; and EVP indicates a 5'-vinyl-(E)-phosphonate.

[0461] Table 5. Antisense strand modification patterns (20 / 22 nt)

[0462]

[0463]

[0464]

[0465] where 2'-OMe indicates 2'-methoxy; 2'-F indicates 2'-fluoro; 2'-Deoxy indicates 2'-deoxy; PS indicates a phosphorothioate linkage between the nucleotide at this position and its right-hand neighbor, starting from the 5' end; and EVP indicates a 5'-vinyl-(E)-phosphonate.

[0466] Table 6. Sense strand modification patterns (20 / 22 nt)

[0467]

[0468] where 2'-OMe indicates 2'-methoxy; 2'-F indicates 2'-fluoro; PS indicates a phosphorothioate linkage between the nucleotide at this position and its right-hand neighbor, starting from the 5' end; and EVP indicates a 5'-vinyl-(E)-phosphonate.

[0469] 2.2.2 siRNA modifications modified by the modified templates of the present disclosure

[0470] The siRNA motifs B00209, B00210, B00211, B00211s, B00212, B00214, B00215, B00216, B00217s, B00301, B00304, B00307, B00311, B00312, B00403, B00404, B00410 and B05202 were modified using the modification templates in 2.2.1, as shown in Table 7. Natural 5' end phosphorylation or simple direct 5' end phosphorylation can occur dephosphorylation in cells. Direct 5' end phosphorylated oligonucleotide chains can appear 90% dephosphorylated after circulating in blood for 2 hours, and completely disappear after 24 hours. The 5' end phosphorylation design (5'-E-VP) uses E-vinyl phosphonate to replace the bridging oxygen, which has improved phosphorylation effect and stability. The antisense strands of the modification templates in this disclosure all contain 5'-E-VP phosphorylation design. The APC-SL sequence in Table 7 is the most active compound siFXIg1-M1SP displayed in the patent CN113227376B, and its modification method is the modification template in the original patent, which is used as a positive control in this example.

[0471] Table 7. siRNA modification

[0472]

[0473]

[0474]

[0475]

[0476]

[0477]

[0478]

[0479]

[0480]

[0481]

[0482]

[0483]

[0484]

[0485]

[0486]

[0487]

[0488]

[0489]

[0490] 2.3 Off-target and inverted siRNA modifications

[0491] The following six off-target designs and three inverted designs were performed on the siRNA modifications of the modified templates described in Section 2.2.2 above.

[0492] To effectively prevent the attack of nucleases on the ends of the sequence, the siRNA modification C00211-DV25P was modified by inverting the ends of the oligonucleotide sequence from the natural 3'-5' to 3'-3' and / or 5'-5'. This study attempted to modify the 3' end of the sense strand (InV, as shown in Table No. 2 below), modify the 3' end of the sense strand and remove the overhang of the antisense strand (InVs, as shown in Table No. 3 below), and modify the 3' end of the antisense strand (AInV, as shown in Table No. 4 below).

[0493] To weaken the off-target effect, the sequence C00211-DV25P was designed for off-target prevention using the seed region GNA replacement (7+ and 6+, as shown in Table Nos. 7-8 below) and DNA replacement (d7B and d7B5, as shown in Table Nos. 9-10 below) modification schemes mentioned above, and the seed region 6 or 7 nucleotide inverted modification (6InV and 7InV, as shown in Table Nos. 5-6 below) was also attempted.

[0494] Table 8. siRNA modifications with off-target and inverted modifications

[0495]

[0496]

[0497] 2.4 siRNA conjugates

[0498] For siRNA modifiers containing inverted modifications in the sense strand, the conjugate group is linked to the 5' end of the sense strand; for siRNA modifiers not containing inverted modifications, the conjugate group is linked to the 3' end of the sense strand. DPC-SL10 is the most active L10-siFXIg1M1SP shown in patent CN113227376B, which is modified in the same way as the modification template in the patent, and L10 is linked to the 3' end of the sense strand in this study, which is used as a positive control. The capital letter P in the sequence of the sequence indicates that the nucleotide adjacent to the left of the letter P is a 5'-phosphonucleotide.

[0499] Table 9 Conjugate sequences

[0500]

[0501]

[0502]

[0503]

[0504]

[0505] Example 2. Synthesis of siRNA compounds

[0506] 2.1. Synthesis of siRNA modifiers with alternating fluorine and oxygen modifications

[0507] Table 2 shows siRNA modifiers with alternating fluorine and oxygen modifications. For example, the siRNA with sequence number B00202-AL has the following base sequence:

[0508] Sense strand: 5'- CUUAUUAAGAAUUGCAGCAAA -3' (SEQ ID NO: 1)

[0509] Antisense strand: 5'- UUUGCUGCAAUUCUUAAUAAGGG -3' (SEQ ID NO: 107)

[0510] Both the odd-numbered positions of the sense strand and the even-numbered positions of the antisense strand are modified with 2'-F, and the other positions are modified with 2'-OMe. In addition, there are 3', 5'-phosphorothioate bonds between the 1st and 2nd nucleotides and between the 2nd and 3rd nucleotides at the 5' end of the sense strand; there are 3', 5'-phosphorothioate bonds between the 1st and 2nd nucleotides and between the 2nd and 3rd nucleotides at the 5' end of the antisense strand, and there are 3', 5'-phosphorothioate bonds between the 1st and 2nd nucleotides and between the 2nd and 3rd nucleotides at the 3' end of the antisense strand.

[0511] Instrument and reagent: Genesee 192 P model DNA / RNA automatic synthesizer, its solid phase carrier is a general carrier of cross-linked polystyrene beads, model Primer support 5G Unylinker 350 (cytiva manufacturer).

[0512] Preparation method:

[0513] According to the monomer concentration of 0.15 M, the following nucleotide monomer solutions are prepared with acetonitrile: DMT-A-OMe phosphoramidite monomer (formula 1), DMT-C-OMe phosphoramidite monomer (formula 2), DMT-G-OMe phosphoramidite monomer (formula 3) and DMT-U-OMe phosphoramidite monomer (formula 4), DMT-A-F phosphoramidite monomer (formula 5), DMT-C-F phosphoramidite monomer (formula 6), DMT-G-F phosphoramidite monomer (formula 7) and DMT-U-F phosphoramidite monomer (formula 8).

[0514]

[0515]

[0516]

[0517] Preparation by the following steps:

[0518] By solid phase phosphoramidite method, the nucleotide monomers are connected one by one in the order of nucleotide arrangement from 3'-5' direction. Each connection of a nucleotide monomer includes four reactions of deprotection, coupling, oxidation or sulfurization, and hydroxyl protection. Among them, when the phosphate ester is used to connect two nucleotides, the connection of the next nucleotide monomer includes four reactions of deprotection, coupling, oxidation, and hydroxyl protection. When the phosphorothioate is used to connect two nucleotides, the connection of the next nucleotide monomer includes four reactions of deprotection, coupling, sulfurization, and hydroxyl protection. The specific process is as follows:

[0519] (1) Deprotection

[0520] 3% dichloroacetic acid toluene solution is used as deprotection reagent to remove DMT protecting group, and then acetonitrile is used for cleaning.

[0521] (2) Coupling

[0522] 0.25 M 5-ethylthiotetrazole is used as activator for coupling of acetonitrile solution of each nucleotide monomer, and then acetonitrile is used for washing.

[0523] (3) Oxidation / Sulfurization

[0524] Oxidation: Oxidation was performed using 0.05 M iodine in pyridine / water (90 / 10) as oxidant, followed by washing with acetonitrile.

[0525] Sulfurization: Sulfurization was performed using 3% hydorxanthone in pyridine as sulfurizing agent, followed by washing with acetonitrile.

[0526] (4) Hydroxyl protection

[0527] Hydroxyl protection was performed using 10% acetic anhydride in tetrahydrofuran (CAP A) tetrahydrofuran / pyridine / methylimidazole 74 / 10 / 16 (v / v / v) (CAP B) as hydroxyl protection reagent, followed by washing with acetonitrile.

[0528] The above operations were repeated and the above steps were performed in a set nucleotide arrangement sequence to obtain a sense strand product or an antisense strand product with a specific sequence arrangement.

[0529] (5) Deprotection of the DMT protecting group of the last nucleotide was performed using 3% dichloroacetic acid in toluene as deprotection reagent, followed by washing with acetonitrile.

[0530] (6) Ammonolysis and purification

[0531] The reacted solid support was transferred to a reactor, concentrated ammonia water (25%-28%, mass percentage) was added, and ammonolysis was performed at 60°C for 12 h. The system was then cooled to room temperature, and the mixture was transferred to a filter tank for filtration. The filter cake was rinsed with a mixture of purified water and ethanol, the filtrates were combined, and the mixture was passed through a chromatography column, concentrated, and lyophilized to obtain a 2'-OMe and 2'-F modified single-stranded product.

[0532] (7) Removal of TBDMS

[0533] DMSO and triethylamine hydrofluoric acid were added to the obtained product, and reaction was performed at 60°C for 2 h. Then, an aqueous ammonium acetate solution was added to the reaction solution, and the mixture was shaken and mixed. Anhydrous ethanol was added, the mixture was shaken and mixed, and then crystallization was performed at -20°C for 8 h to 12 h. After centrifugation, the supernatant was discarded, and the precipitate was rinsed with anhydrous ethanol to obtain a non-modified single-stranded product.

[0534] (8) Annealing

[0535] The purified sense strand and antisense strand were mixed at a molar ratio of 1:1, heated to 95°C and maintained for 3 min, and then slowly cooled to room temperature to form an siRNA duplex.

[0536] Other sequences listed in Table 2 were synthesized according to the above method.

[0537] 2.2 Synthesis of siRNA modification of the template modification of the present disclosure

[0538] For siRNA modifiers in 2.2.2 of Example 1, siRNA modifiers were synthesized according to 2.1 of Example 2, using a monomer containing a phosphonate group at the 5' end, such as a vinyl-(E)-phosphonate-A-OMe phosphoramidite monomer (Formula 9) or a vinyl-(E)-phosphonate-U-OMe phosphoramidite monomer (Formula 10), at the synthesis of the base at the 5' end of the antisense strand (the last base), the structure of which is shown as follows:

[0539] Formula 9 Formula 10

[0540] For siRNA modifiers of DV39P template modification sequence, siRNA sequence was synthesized according to 2.1 of Example 2, using a DNA monomer DMT-dA phosphoramidite monomer (Formula 11), DMT-dT phosphoramidite monomer (Formula 12), DMT-dC phosphoramidite monomer (Formula 13) or DMT-dG phosphoramidite monomer (Formula 14) at the synthesis of the 2nd, 6th, 14th nucleotide from the 5' end of the antisense strand; for siRNA modifiers of DV40P template modification, any of the above four monomers was used at the synthesis of the 2nd, 6th, 14th nucleotide from the 5' end of the antisense strand and the 16th nucleotide from the 5' end of the sense strand, the exemplary structures of which are shown as follows:

[0541] Formula 11 Formula 12 Formula 13

[0542] Formula 14

[0543] 2.3 Synthesis of siRNA modifiers with inverted modification

[0544] For siRNA modifiers with inverted modification, siRNA modifiers were synthesized according to 2.1 of Example 2, using a DNA monomer dA(Bz)-CE-Reverse (dAinV), dT(Bz)-CE-Reverse (dTinV), dC(Bz)-CE-Reverse (dCinV) or dG(Bz)-CE-Reverse (dGinV) at the synthesis of the terminal nucleotide of the sense or antisense strand, the structure of which is shown as follows:

[0545]

[0546] 2.4 Synthesis of siRNA conjugates

[0547] For the conjugate of the 3' end of the sense strand in Table 9 connected with the GalNAc conjugation group G101 (the structure of which is as follows), the method for connecting the oligonucleotide with G101 refers to the preparation method in Example 3 of the patent application CN116854754A.

[0548]

[0549] wherein the oligonucleotide forms a conjugate with the conjugation group G101 as shown below:

[0550] .

[0551] The sequence number containing G101 indicates that the sequence is connected with the conjugation group G101. L10 is the conjugation group of the positive reference (the most active siFXIg1-M1SP shown in CN113227376B). L10 indicates that the sequence is connected with the conjugation group L10. The structure of L10 is as follows:

[0552]

[0553] Example 3: In vitro experiment of siRNA on the inhibition of FXI gene expression

[0554] 3.1. Inhibition of FXI gene expression by motif and alternating modification of siRNA

[0555] After the siRNA motif and 2'-OMe and 2'-F alternating modification siRNA modifiers synthesized in Example 2 were transfected into HepG2 cells by lipid nanoparticles (LNP), the inhibition of each siRNA on the target gene FXI was detected by qPCR technology and ELISA.

[0556] 3.1.1. qPCR detection of FXI mRNA expression inhibition rate

[0557] HepG2 cell lines were cultured in 10% fetal bovine serum DMEM culture medium (supplemented with 100x penicillin, 100x streptomycin 10 μL / mL) and placed in a cell incubator at 37°C containing 5% CO2.

[0558] Before transfecting the siRNA into the cells, Lipofectamine RNAiMAX (Invitrogen, 13778150) and Opti-MEM were mixed at a ratio of 2:98 and vortexed to prepare the transfection mixture. The siRNA compound was diluted with Opti-MEM to the appropriate concentration. For single concentration point transfection, the siRNA preparation concentration was 960 pM. 55 μL of siRNA solution diluted with Opti-MEM was added to 55 μL of transfection mixture at a ratio of 1:1 (v / v).

[0559] For the blank control group, 55 μL of the prepared transfection mixture was added to 55 μL of Opti-MEM. After vortex mixing, it was allowed to stand at room temperature for 15 min.

[0560] The prepared transfection reagent was added to the 24-well cell culture plate (100 μL per well), so that the final siRNA concentration per well was 80 pM. 500 μL of cell suspension (cell density was 1.5 x 10 5 / mL) was added. After mixing with the cross method, it was placed in a 37°C, 5% CO2 cell incubator for 48 h.

[0561] After 48 h of transfection, RNA extraction was first performed according to the instructions of the RNA extraction kit (RNeasy Mini Kit, QIAGEN, 74106), then RNA was reverse transcribed into cDNA using the reverse transcription kit FastKing RT Kit (with gDNase) (TIANGEN, KR116-02), and finally qPCR was performed using the TB Green® Premix Ex Taq™ (Tli RNaseH Plus) kit (Takara, RR420W(L x 5)) to quantitatively detect the FXI mRNA expression level. The amplification primers in the qPCR experiment are shown in Table 10. The qPCR reaction program was as follows: heating at 95°C for 30 s, then entering the cycle mode, heating at 95°C for 5 s, then heating at 60°C for 34 s, for a total of 40 cycles.

[0562] Table 10 qPCR amplification primers

[0563]

[0564] The FXI mRNA expression rate (%) was calculated as follows:

[0565] Expression rate = (FXI mRNA expression amount / blank control group FXI mRNA expression amount) x 100%;

[0566] FXI gene expression inhibition rate = 100% - expression rate (%). The results are shown in Table 11.

[0567] 3.1.2. ELISA detection of FXI protein expression inhibition rate

[0568] For the siRNA with a higher inhibition rate detected by qPCR, in order to detect its inhibition effect on the target gene FXI at the protein level, the human Factor XI ELISA kit (Thermo Fisher, EH118RB) was used to detect the ELISA of the cell culture medium supernatant after 48 h of siRNA transfection.

[0569] The ELISA data was processed to normalize to the transfection reagent control group (relative expression to the transfection reagent control group = protein expression of each sample FXI / protein expression of the transfection reagent control group sample FXI), and the results are shown in Table 11.

[0570] Table 11. Inhibition rate of siRNA motifs and siRNA modified by alternating fluorine and oxygen modification on target gene FXI in HepG2

[0571]

[0572]

[0573]

[0574] The inhibition rate in this example is the average of 3 experiments, and is shown in Table 11. The qPCR experiment results show that among the 106 siRNA modified by alternating 2'-OMe and 2'-F modification, 49 of them have an inhibition rate on FXI gene expression of more than 60%, 34 of them have an inhibition rate of 40-60%, and 23 of them have an inhibition rate of less than 40%, and the inhibition rate of positive sample APC-AL is 59%. In the ELISA experiment, the inhibition rate of positive sample APC-AL is 46%, and among the 27 detected siRNAs, 25 of them have a higher inhibition rate than the positive sample.

[0575] 3.2. Inhibition effect of template modified siRNA modified material on FXI gene expression

[0576] The siRNA modified material of the present disclosure modified by the template synthesized in Example 2 (the sequence is shown in Table 7) was transfected into HepG2 cells by lipid nanoparticles (LNP), and the inhibition rate on the target gene FXI was detected by qPCR technology and ELISA.

[0577] The experimental steps are basically the same as those in 3.1, except that the siRNA transfection concentration is 10 pM. The experimental results are shown in Table 12.

[0578] Table 12. Inhibition rate of template modified siRNA modified material in HepG2

[0579]

[0580]

[0581]

[0582]

[0583] As can be seen from Table 12, the siRNA modifier provided by the present disclosure shows excellent inhibitory effect on the FXI gene. In addition, compared with the prior art disclosed Advanced ESC template DV22, the modified siRNA modifier of the modified template of the present disclosure has a stronger effect of inhibiting gene expression.

[0584] 3.3. Inhibition of FXI gene expression by reverse modification and off-target prevention modified modifiers

[0585] The siRNA modifiers obtained by reverse modification and off-target prevention modification synthesized in Example 2 (see Table 8 for sequences) were transfected into HepG2 cells by lipid nanoparticles (LNP) with concentrations of 1.00E+02, 5.00E+01, 2.50E+01, 1.30E+01, 1.60E+00, 2.00E-01, 2.40E-02, 3.10E-03, 3.80E-04, 4.80E-05 and 6.00E-06 nM, respectively. The inhibition of target gene FXI at each concentration point was detected by qPCR technology, and the IC 50 .

[0586] According to the results of IC 50 and the maximum inhibition rate (the highest concentration point of transfection), it was found that the IC 50 values of C00211-DV25P, C00211-DV25PInV, C00211-DV25PInVs, C00211-DV25Pd7B and C00211-DV25P6InV were all less than the IC 50 value of the positive control APC-SL, i.e., the efficacy was better than that of the positive control.

[0587] Example 4: Inhibition of FXI gene expression by siRNA conjugates in humanized mice

[0588] In this example, transgenic mice expressing human FXI gene were used to detect the inhibition of FXI protein expression in vivo by the siRNA conjugates listed in Table 9 by ELISA experiment. The positive control drug was the compound L10-siFXIg1-M1SP with the highest activity shown in the patent CN113227376B.

[0589] 4.1 Inhibition of FXI protein expression in mice by siRNA conjugates

[0590] 6-8 weeks old hFXI transgenic mice (male) were acclimated for about 1 week after entering the feeding facility, and were grouped according to the hFXI baseline and body weight, 6 mice / group, a total of 40 groups, including solvent group (normal saline), negative control group, positive control group and test substance group (Table 14). The dose was 1 mpk, and the administration route was single subcutaneous administration. On days 7, 14, 21, 28, 35, 42 and 49 after administration, the serum hFXI level was detected by ELISA kit, and the inhibition rate of FXI protein expression in mice was calculated.

[0591] Table 13. Serum hFXI protein inhibition rate (%) of high-dose humanized mouse group

[0592]

[0593]

[0594]

[0595] Note: " / " represents that the test has been terminated and not detected.

[0596] As can be seen from Table 13, the experimental results of the high-dose siRNA conjugate administered to the humanized mice show that the inhibition rate of Yangcan DPC-SL10 on day 28 is 61.12%, and the inhibition rate of 14 siRNA conjugates is higher than that of Yangcan, which can inhibit the expression of FXI in vivo within 28 days. Among them, 5 candidate compounds, including D00211-DV34PG101, D00211s-DV25SPG101, D00211-DV25PG101, D00211-DV34PInVG101 and D00216-DV34PG101, have an inhibition rate of more than 80%. On day 49, the inhibition rate of Yangcan DPC-SL10 decreased to 17.40%, and the inhibition rate of 13 siRNA conjugates was higher than that of Yangcan, of which D00211s-DV25SPG101 (70.09%), D00211-DV25PG101 (65.65%), D00211-DV34PG101 (58.22%) and D00216-DV34PG101 (53.33%) have an inhibition rate of more than 50%, showing high pharmacodynamic activity.

[0597] In order to further screen high-activity compounds, 8 sequences with better pharmacodynamic activity in the high-dose mouse experiment (see Table 14) were selected for low-dose experiments with Yangcan DPC-SL10 and the solvent group. The dose of the low-dose group experiment was 0.5 mpk, 8 mice / group, a total of 10 groups.

[0598] Table 14. Serum hFXI protein inhibition rate (%) of low-dose humanized mouse group

[0599]

[0600] As shown in Table 14, in the experiment of administering low-dose siRNA conjugates to humanized mice, the minimum serum FXI inhibition rate of each group appeared on day 7, in which 7 siRNA conjugates (D00211-DV25PG101, D00211-DV25PInVG101, D00211-DV34PG101, D00211-DV34PInVsG101, D00211s-DV25SPG101, D00212-DV32PG101, D00216-DV34PG101) had higher inhibition rates than the positive control DPC-SL10 (63.56%), showing higher pharmacodynamic activity. On day 49, the serum FXI content of the positive control group returned to the baseline (inhibition rate -1.01%), and the inhibition rates of D00211s-DV25SPG101 (55.87%), D00211-DV34PG101 (44.06%), D00211-DV25PG101 (40.69%), D00216-DV34PG101 (23.58%) and D00212-DV32PG101 (22.11%) were significantly higher than those of the positive control, showing higher pharmacodynamic activity.

[0601] 4.2 Prolonged effect of siRNA conjugates on APTT (Activated Partial Thromboplastin Time) of humanized mice

[0602] For the 8 siRNA conjugates and the positive control in Table 15, APTT was detected on D49 in high-dose and low-dose experiments, and the results are shown in Table 15.

[0603] Table 15. APTT detection of humanized mice on D49

[0604]

[0605] Table 15 shows that compared with the solvent group, the APTT of the above-mentioned 8 siRNA conjugates and the positive control was prolonged in the high-dose group experiment, in which the prolongation rates of D00211-DV34PG101, D00211s-DV25SPG101 and D00212-DV32PG101 were all greater than 50%. In the low-dose group experiment, the prolongation rates of D00211-DV25PG101, D00211-DV34PG101 and D00211s-DV25SPG101 were greater than 10%.

[0606] Example 5: Pharmacodynamic effect of siRNA conjugates in cynomolgus monkeys

[0607] The present example evaluates the in vivo efficacy of siRNA in cynomolgus monkeys by detecting serum FXI protein levels, liver FXI mRNA expression, serum FXI activity, and APTT (Activated Partial Thromboplastin Time). The positive control DPC4059-SL10 is compound L10-siFXIf1-M1SP in patent CN113227376B.

[0608] Before administration, the cynomolgus monkeys were grouped according to serum FXI protein content and body weight, taking into account APTT and PT (Prothrombin Time), FXI activity, and other detection indicators. Each group had 3 males (3 per group), and there were 6 groups in total, including 5 siRNA conjugate groups and 1 positive control group. The dose was designed as 1 mg / kg, and the administration volume was 1 mL / kg. Therefore, the administration concentration was set as 1 mg / mL. The day of administration was recorded as D0, and the observation period was 84 days.

[0609] 5.1 Serum FXI content detection

[0610] ELISA was used to detect the FXI protein content in serum before administration (D-1) and after administration (D7, 14, 21, 28, 42, 56, 70, 84), and the inhibition rate was calculated. See Table 16.

[0611] Table 16. Serum FXI protein inhibition rate (%)

[0612]

[0613] Table 16 shows that the 5 siRNA conjugates and the positive control DPC4059-SL10 exhibited inhibition of serum FXI expression in cynomolgus monkeys as early as D7 after administration, and the inhibition rate reached a maximum at D28. The inhibition rates of the 5 siRNA conjugates were higher than that of the positive control. At the end of the experiment (D84), the inhibition rates of all groups were higher than 60%.

[0614] 5.2 Liver FXI mRNA expression detection

[0615] Before administration and at D28, 56, and 84 after administration, liver biopsy was performed on the cynomolgus monkeys, and about 5 mg of tissue was taken each time. Total RNA was extracted, and the FXI mRNA expression level was detected using RT-qPCR, and the inhibition rate was calculated.

[0616] Table 17. Liver FXI mRNA inhibition rate (%)

[0617]

[0618] The above table shows that the D56 groups of FXI mRNA levels are reduced to the lowest level, wherein D00211-DV34PG101, D00216-DV34PG101, D00211-DV34PInVsG101 and D00211s-DV25SPG101 have higher inhibition rate of liver FXI mRNA than the positive control DPC4059-SL10. In D84, the inhibition rate of liver FXI mRNA of the 5 siRNA conjugates is higher than the positive control DPC4059-SL10.

[0619] 5.3 Serum FXI activity detection

[0620] The FXI activity in plasma was detected by semi-automatic coagulation analyzer at D-1 before administration, D7, 14, 21, 28, 42, 63, 77, 84 after administration. Specifically, whole blood was collected in 3.8% sodium citrate anticoagulant tubes, mixed thoroughly (to avoid hemolysis or coagulation), and immediately centrifuged at 2500 g at room temperature for 15 min after collection. The plasma was separated and diluted 10 times with Owren-Koller diluent. Mix 50 µL of FXI-deficient plasma and 50 µL of the sample to be tested, and incubate at 37°C for 1 min. Add 50 µL of APTT reagent, add 1 magnetic bead, and incubate at 37°C for 3 min. Finally, add CaCl2 solution and immediately mix at 37°C to detect the coagulation time. According to the standard curve of FXI activity-coagulation time, the FXI activity and reduction rate were calculated. Table 18 shows that the 5 siRNA conjugates and the positive control treatment group induced a decrease in FXI activity in cynomolgus monkeys at D7, and the decrease lasted until D84.

[0621] Table 18. FXI activity reduction rate (%)

[0622]

[0623] 5.3 APTT and PT detection

[0624] The APTT and PT in plasma were detected by automatic coagulation analyzer at D-1 before administration, D7, 14, 21, 28, 42, 56, 70, 84 after administration, to evaluate the effect of siRNA conjugates on the function of endogenous and exogenous coagulation pathways. Specifically, whole blood was collected in 3.8% sodium citrate anticoagulant tubes, mixed thoroughly (to avoid hemolysis or coagulation), and immediately transferred to the laboratory for detection after collection at room temperature. Centrifuge at 3500 rpm / min for 15 min at room temperature to separate the plasma, and immediately detect APTT and PT on the machine, and calculate the APTT prolongation rate compared to each group of animals before administration (D-1). The detection results are shown in Tables 19-21.

[0625] Table 19. APTT (s)

[0626]

[0627] Table 20. PT (s)

[0628]

[0629] Table 21. APTT prolongation rate relative to pre-dose (D-1)

[0630]

[0631] Table 19 and 21 show that the 5 siRNA conjugates and the positive control can induce prolongation of APTT in cynomolgus monkeys, while having no obvious effect on PT, indicating that the drugs prolong the clotting time by regulating the endogenous coagulation pathway, but have no effect on the exogenous coagulation pathway. Table 21 shows that the 5 siRNA conjugates exhibit prolongation of APTT to varying degrees on D7. From D7 to D42, the APTT prolongation rates of the 5 siRNA conjugates are all higher than that of the positive control DPC4059-SL10. On day 84, the APTT prolongation rates of D00211-DV34PG101 and D00216-DV34PG101 are 49.70% and 48.31%, respectively, showing strong pharmacodynamic activity.

[0632] Example 6: Comparison of the sequences of the present patent sequence and the prior art disclosed sequences

[0633] This example compares the unmodified sequences B00209, B00210, B00211, B00211s, B00212, B00215, B00216 and B00404 of the present disclosure with the similar unmodified sequences disclosed in the prior art in terms of sequence structure and in vitro pharmacodynamic activity.

[0634] 6.1 Comparison of sequence structure

[0635] The prior art disclosed sequences are very similar to the sequences of the present disclosure, and the following table shows the information of the sequences, length, position and terminal mutation, etc.:

[0636] Table 22 Comparison of sequence structure between the prior art disclosed sequences and the sequences of the present disclosure

[0637]

[0638]

[0639] 6.2 Comparison of in vitro pharmacodynamic activity

[0640] The inhibition of target gene FXI expression of unmodified prior art disclosed sequences and unmodified sequences of the present disclosure were compared at in vitro cell level. The specific experimental method was basically the same as 3.1.1, except that the cell transfection experiment was carried out in a 96-well plate, 3000 cells / well, and the final concentration of siRNA transfection was 0.01 nM and 0.10 nM. After 48 h, RNA was extracted, and the inhibition rate of FXI gene expression was detected by qPCR. The results are shown in Table 23. The activity of the unmodified sequence in the present disclosure was significantly improved compared with the similar unmodified sequence of the prior art disclosure.

[0641] Table 23 Comparison of FXI expression inhibition of prior art disclosed sequences and sequences of the present disclosure

[0642]

[0643] Although the specific embodiments of the present disclosure have been described in detail, the above examples and specific embodiments should not be regarded as limiting the present disclosure. Those skilled in the art will understand that various modifications and replacements of those details can be made by those skilled in the art according to all the teachings disclosed herein without departing from the spirit and main points of the present disclosure. The entire scope of the present disclosure is given by the appended claims and any equivalents thereof.

Claims

1. A siRNA double strand, characterized in that, The siRNA duplex comprises a sense strand and an antisense strand forming an inverse complementary double-stranded region, wherein the antisense strand comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides complementary to a target sequence having the nucleotide sequence TTTCAGGATGATTTTCTTATATCAAGT or ACTTCAGTTTCTGGTGAATGT.

2. The siRNA double strand according to claim 1, characterized in that, The antisense strand comprises at least 15, 16, 17, 18, or 19 consecutive nucleotide fragments or modified fragments thereof in any of the sequences shown in SEQ ID NO: 114-118, 121-123, and 139; and / or The positive chain comprises at least 15, 16, 17, 18, or 19 consecutive nucleotide fragments or modified fragments thereof in any of the sequences shown in SEQ ID NO: 8-12, 15-17, and 33.

3. The siRNA double strand according to claim 2, characterized in that, The siRNA duplex comprises any one or a combination of at least two of the following oligonucleotide duplexes composed of selected sense and antisense strands, wherein optionally the sense and antisense strands each independently contain at least one modified nucleotide: (1) The positive chain has a sequence or a fragment thereof as shown in SEQ ID NO: 8; and the negative chain has a sequence or a fragment thereof as shown in SEQ ID NO: 114; (2) The positive chain has a sequence or a fragment thereof as shown in SEQ ID NO: 9; and the negative chain has a sequence or a fragment thereof as shown in SEQ ID NO: 115; (3) The justice chain has a sequence or a fragment thereof as shown in SEQ ID NO: 10; The antisense chain has a sequence or fragment thereof as shown in SEQ ID NO: 116; (4) The justice chain has a sequence or a fragment thereof as shown in SEQ ID NO: 11; The antisense chain has a sequence or fragment thereof as shown in SEQ ID NO: 117; (5) The justice chain has a sequence or a fragment thereof as shown in SEQ ID NO: 12; The antisense chain has a sequence or fragment thereof as shown in SEQ ID NO: 118; (6) The justice chain has a sequence or a fragment thereof as shown in SEQ ID NO: 15; The antisense chain has a sequence or fragment thereof as shown in SEQ ID NO: 121; (7) The justice chain has a sequence or a fragment thereof as shown in SEQ ID NO: 16; The antisense chain has a sequence or fragment thereof as shown in SEQ ID NO: 122; (8) The justice chain has a sequence or a fragment thereof as shown in SEQ ID NO: 17; The antisense chain has a sequence or fragment thereof as shown in SEQ ID NO: 123; (9) The positive chain has a sequence or a fragment thereof as shown in SEQ ID NO: 33; and the negative chain has a sequence or a fragment thereof as shown in SEQ ID NO:

139.

4. The siRNA double strand according to any one of claims 1-3, characterized in that, The nucleotide sequence of the positive strand differs from any of SEQ ID NO: 8-12, 15-17 and 33 by 1-3 nucleotides; and / or The nucleotide sequence of the antisense strand differs from any of the sequences in SEQ ID NO: 114-118, 121-123 and 139 by 1-3 nucleotides.

5. The siRNA double strand according to any one of claims 1-3, characterized in that, The sense or antisense strand comprises at least one modified nucleotide selected from deoxynucleotides, 3'-terminal deoxy-thymidine nucleotides, 2'-O-methyl modified nucleotides, 2'-fluorine modified nucleotides, 2'-deoxy-modified nucleotides, locked nucleotides, non-locked nucleotides, configuration-restricted nucleotides, restricted ethyl nucleotides, base-free nucleotides, 2'-amino-modified nucleotides, 2'-O-allyl-modified nucleotides, 2'-C-alkyl-modified nucleotides, 2'-hydroxy-modified nucleotides, 2'-methoxyethyl-modified nucleotides, 2'-O-alkyl-modified nucleotides, morpholinyl nucleotides, aminophosphates, nucleotides containing non-natural bases, tetrahydropyran-modified nucleotides, 1,5-dehydrohexyl-modified nucleotides, cyclohexenyl-modified nucleotides, nucleotides containing thiophosphate groups, nucleotides containing methylphosphate groups, nucleotides containing 5'-phosphate groups, and nucleotides containing 5'-phosphate mimics; and combinations thereof.

6. The siRNA double strand according to any one of claims 1-3, characterized in that, At least one strand contains a 3' overhang of at least one or at least two nucleotides.

7. The siRNA double strand according to any one of claims 1-3, characterized in that, The sense strand has 21 nucleotides and the antisense strand has 23 nucleotides; or, the sense strand has 20 nucleotides and the antisense strand has 22 nucleotides.

8. The siRNA duplex according to any one of claims 1-3, characterized in that, All nucleotide modifications on the sense and antisense strands are chemical modifications at the 2' position of the nucleotide ribose, wherein the chemical modification at the 2' position of the nucleotide ribose is selected from any one or a combination of several of 2'-methoxy, 2'-methoxyethyl, 2'-fluoro, 2'-deoxy, 2'-benzyloxy, 2'-methylcarbonylamino, and 2'-pyridinemethoxy.

9. The siRNA duplex according to claim 8, characterized in that, The chemical modification at the 2' position of the ribose of each nucleotide is selected from alternating combinations of 2'-methoxy and 2'-fluoro.

10. The siRNA duplex according to claim 8, characterized in that, The chemical modifications at the 2' position of the ribose in each nucleotide are as follows: odd-numbered positions on the antisense strand are all 2'-methoxy modified, and even-numbered positions are all 2'-fluorinated modified; the relative position of the 2'-methoxy modification on the sense and antisense strands is 2'-fluorinated, and the relative position of the 2'-methoxy modification to the 2'-fluorinated modification is 2'-methoxy modified; and / or The 5' end of the sense strand and / or the antisense strand may contain one, two, or three 3',5'-phosphothioester bonds between the first to fourth nucleotides, and the 3' end of the antisense strand may contain one, two, or three 3',5'-phosphothioester bonds between the first to fourth nucleotides.

11. The siRNA double strand according to claim 3, characterized in that, Phosphorylation of the 5' carbon atom of the modified antisense 5'-terminal nucleotide glycoside, wherein the phosphorylation of the 5' carbon atom is selected from the following 5'-phosphorylating groups: 5'-vinylphosphonate group; 5'-methylphosphonate group; 5'-C-methylphosphate group; 5'-thiophosphate group; and 5'-phosphate group, the structures of which are shown below: ； Where R represents hydrogen, hydroxyl, amino, or C. 1-4 Alkyl, aromatic, C 1-4 Alkoxy, C 1-4 Alkyl carbonyl amino or halogen; The bases are selected from adenine, guanine, cytosine, thymine, and uracil.

12. The siRNA duplex according to any one of claims 1-3, characterized in that, The antisense chain and the justice chain are modified in the following ways: (1) The antisense chain has any one of the following modification methods A~H: ； ； And / or, the justice chain adopts any of the following modifications: ； Where 2'-OMe represents 2'-methoxy; 2'-F represents 2'-fluoro; 2'-Deoxy represents 2'-deoxy; PS indicates that the nucleotide at the 5' end is connected to the adjacent nucleotide on its right by a thiophosphate bond; EVP represents 5'-vinyl-(E)-phosphonate; Preferably, the antisense chain is modified by modifier A, and the justice chain is modified by modifier a; or The antisense chain is modified by modifier B, and the justice chain is modified by modifier a; or The antisense chain is modified with the modifier C, and the justice chain is modified with the modifier a; or The antisense chain is modified with modifier C, and the justice chain is modified with modifier b; or The antisense chain is modified by modifier D, and the justice chain is modified by modifier b; or The antisense chain is modified by modifier E, and the justice chain is modified by modifier b; or The antisense chain is modified by the modifier F, and the justice chain is modified by the modifier b; or The antisense chain is modified with the modifier G, and the justice chain is modified with the modifier b; or The antisense chain is modified with the modifier H, and the justice chain is modified with the modifier c. (2) The antisense chain has any of the following modification methods A'~G': ； ； ； And / or, the justice chain is modified in the following manner: a' or b': ； Where 2'-OMe represents 2'-methoxy; 2'-F represents 2'-fluoro; 2'-Deoxy represents 2'-deoxy; PS indicates that the nucleotide at the 5' end is connected to the adjacent nucleotide on its right by a thiophosphate bond; and EVP represents 5'-vinyl-(E)-phosphonate.

13. The siRNA duplex according to claim 12, characterized in that, The antisense chain is modified by modifier A', and the justice chain is modified by modifier a'; or The antisense chain is modified by modifier B', and the justice chain is modified by modifier a'; or The antisense chain is modified by modifier C', and the justice chain is modified by modifier a'; or The antisense chain is modified by modifier C', and the justice chain is modified by modifier b'; or The antisense chain is modified by modifier D', and the justice chain is modified by modifier b'; or The antisense chain is modified by modifier E', and the justice chain is modified by modifier b'; or The antisense chain is modified by modifier F', and the justice chain is modified by modifier b'; or The antisense chain is modified by the modification method G', and the justice chain is modified by the modification method b'.

14. The siRNA double strand according to claim 1, characterized in that, The siRNA duplex comprises any one or a combination of at least two of the following oligonucleotide duplexes composed of sense and antisense strand pairings: (1) The sense chain has the sequence shown in SEQ ID NO: 220; the antisense chain has the sequence shown in SEQ ID NO: 326; (2) The sense chain has the sequence shown in SEQ ID NO: 221; the antisense chain has the sequence shown in SEQ ID NO: 327; (3) The sense chain has the sequence shown in SEQ ID NO: 222; the antisense chain has the sequence shown in SEQ ID NO: 328; (4) The sense chain has the sequence shown in SEQ ID NO: 223; the antisense chain has the sequence shown in SEQ ID NO: 329; (5) The sense chain has the sequence shown in SEQ ID NO: 224; the antisense chain has the sequence shown in SEQ ID NO: 330; (6) The sense chain has the sequence shown in SEQ ID NO: 227; the antisense chain has the sequence shown in SEQ ID NO: 333; (7) The sense chain has the sequence shown in SEQ ID NO: 228; the antisense chain has the sequence shown in SEQ ID NO: 334; (8) The sense chain has the sequence shown in SEQ ID NO: 229; the antisense chain has the sequence shown in SEQ ID NO: 335; (9) The sense chain has the sequence shown in SEQ ID NO: 245; the antisense chain has the sequence shown in SEQ ID NO: 351; (10) The sense chain has the sequence shown in SEQ ID NO: 426; and the antisense chain has the sequence shown in SEQ ID NO: 552; (11) The sense chain has the sequence shown in SEQ ID NO: 427; and the antisense chain has the sequence shown in SEQ ID NO: 553; (12) The sense chain has the sequence shown in SEQ ID NO: 429; and the antisense chain has the sequence shown in SEQ ID NO: 555; (13) The sense chain has the sequence shown in SEQ ID NO: 430; and the antisense chain has the sequence shown in SEQ ID NO: 556; (14) The positive chain has the sequence shown in SEQ ID NO: 431; and the negative chain has the sequence shown in SEQ ID NO: 557; (15) The sense chain has the sequence shown in SEQ ID NO: 435; and the antisense chain has the sequence shown in SEQ ID NO: 561; (16) The sense chain has the sequence shown in SEQ ID NO: 439; and the antisense chain has the sequence shown in SEQ ID NO: 565; (17) The sense chain has the sequence shown in SEQ ID NO: 440; and the antisense chain has the sequence shown in SEQ ID NO: 566; (18) The sense chain has the sequence shown in SEQ ID NO: 442; and the antisense chain has the sequence shown in SEQ ID NO: 568; (19) The sense chain has the sequence shown in SEQ ID NO: 443; and the antisense chain has the sequence shown in SEQ ID NO: 569; (20) The sense chain has the sequence shown in SEQ ID NO: 444; and the antisense chain has the sequence shown in SEQ ID NO: 570; (21) The sense chain has the sequence shown in SEQ ID NO: 445; and the antisense chain has the sequence shown in SEQ ID NO: 571; (22) The sense chain has the sequence shown in SEQ ID NO: 446; and the antisense chain has the sequence shown in SEQ ID NO: 572; (23) The sense chain has the sequence shown in SEQ ID NO: 447; and the antisense chain has the sequence shown in SEQ ID NO: 573; (24) The sense chain has the sequence shown in SEQ ID NO: 448; and the antisense chain has the sequence shown in SEQ ID NO: 574; (25) The sense chain has the sequence shown in SEQ ID NO: 449; and the antisense chain has the sequence shown in SEQ ID NO: 575; (26) The sense chain has the sequence shown in SEQ ID NO: 450; and the antisense chain has the sequence shown in SEQ ID NO: 576; (27) The sense chain has the sequence shown in SEQ ID NO: 454; and the antisense chain has the sequence shown in SEQ ID NO: 580; (28) The sense chain has the sequence shown in SEQ ID NO: 455; and the antisense chain has the sequence shown in SEQ ID NO: 581; (29) The sense chain has the sequence shown in SEQ ID NO: 456; and the antisense chain has the sequence shown in SEQ ID NO: 582; (30) The sense chain has the sequence shown in SEQ ID NO: 468; and the antisense chain has the sequence shown in SEQ ID NO: 594; (31) The sense chain has the sequence shown in SEQ ID NO: 471; and the antisense chain has the sequence shown in SEQ ID NO: 597; (32) The sense chain has the sequence shown in SEQ ID NO: 477; and the antisense chain has the sequence shown in SEQ ID NO: 603; (33) The sense chain has the sequence shown in SEQ ID NO: 478; and the antisense chain has the sequence shown in SEQ ID NO: 604; (34) The sense chain has the sequence shown in SEQ ID NO: 479; and the antisense chain has the sequence shown in SEQ ID NO: 605; (35) The sense chain has the sequence shown in SEQ ID NO: 480; and the antisense chain has the sequence shown in SEQ ID NO: 606; (36) The sense chain has the sequence shown in SEQ ID NO: 529; and the antisense chain has the sequence shown in SEQ ID NO: 655; (37) The sense chain has the sequence shown in SEQ ID NO: 530; and the antisense chain has the sequence shown in SEQ ID NO: 656; (38) The positive chain has a sequence as shown in SEQ ID NO: 532; and the negative chain has a sequence as shown in SEQ ID NO:

658.

15. The siRNA duplex according to claim 3 or 14, characterized in that, The antisense strand has nucleotides 2 through 8 from the 5' end that are each independently modified nucleotides. These modified nucleotides are either unlocking nucleic acids or glycol-modified nucleic acids. Alternatively, the antisense strand has nucleotides 2 through 8 from the 5' end that are each independently DNA. The structures of unlocking nucleic acids and glycol-modified nucleic acids are as follows: ； Wherein, the bases are selected from any one of adenine, guanine, cytosine, thymine, and uracil; and / or The 3' end of the sense strand or the antisense strand is a reverse-modified nucleotide, or the 6th or 7th nucleotide at the 5' end of the sense strand is a reverse-modified nucleotide, wherein the modified nucleotide is selected from dAinV, dTinV, dGinV, and dCinV with the following structures: 。 16. The siRNA duplex according to claim 15, characterized in that, The siRNA duplex comprises any one or a combination of at least two of the following oligonucleotide duplexes composed of sense and antisense strand pairings: (1) The sense chain has the sequence shown in SEQ ID NO: 677; and the antisense chain has the sequence shown in SEQ ID NO: 686; (2) The sense chain has the sequence shown in SEQ ID NO: 678; and the antisense chain has the sequence shown in SEQ ID NO: 687; (3) The sense chain has a sequence as shown in SEQ ID NO: 683; and the antisense chain has a sequence as shown in SEQ ID NO: 693; (4) The positive chain has a sequence as shown in SEQ ID NO: 680; and the negative chain has a sequence as shown in SEQ ID NO:

689.

17. A conjugate for reducing the expression of FXI, characterized in that, The conjugate comprises the siRNA duplex as described in any one of claims 1-16, and the conjugate group attached thereto.

18. The conjugate according to claim 17, characterized in that, The conjugating group is attached to the 3'-end or 5'-end of the positive strand of the oligonucleotide; and / or The conjugating group is a GalNAc derivative attached using a divalent or trivalent branched linker arm.

19. The conjugate according to claim 17, wherein the conjugating group is selected from one of the following conjugating groups: (1) The conjugated group is: ； in, X is a hydroxyl protecting group or H, wherein the hydroxyl protecting group is selected from acetyl, benzoyl or isobutyryl; Y is an amine protecting group or H, wherein the amine protecting group is selected from formyl, acetyl, propionyl, n-butyryl or isobutyryl; n is an integer from 0 to 20; q, r and s are independently integers from 1 to 7; (2) The conjugated group is: ； Where X is oxygen, -N(Y)-, or sulfur; Y is C 1-4 Alkyl or C 6-10 Aryl; R1 is oxygen or sulfur; R2 represents hydrogen, -NH2, or C. 1-4 Alkyl, C 6-10 Aryl, C 1-4 Alkyl or halogen; A is -(CH2) a -、-(CH2CH2O) b -、-((CH2) c NHCO) d -or-((CH2) c CONH) d - where a is an integer from 1 to 15, b is an integer from 1 to 7, c is an integer from 1 to 7, and d is an integer from 1 to 5; B is -(CH2) e -, where e is an integer between 0 and 7; L is either -CONH- or -NHCO-; X1 is -(CH2) f -or-(CH2CH2O) f CH2-, f is an integer from 1 to 5; X2 is -(CH2) g - g is an integer from 1 to 6; X3 is oxygen or sulfur; Y1 is either 0 or 1; Y2 is 0, 1, or 2; When Y3 is 1, X4 is CH2; when Y3 is 2, X4 is CH; when Y3 is 3, X3 is carbon. m is an integer between 0 and 4; n is an integer between 0 and 4; (3) The conjugated group is: ； Where X is oxygen, -N(Y)-, or sulfur; Y is C 1-4 Alkyl or C 6-10 Aryl; R1 is oxygen or sulfur; R2 represents hydrogen, -NH2, or C. 1-4 Alkyl, C 6-10 Aryl, C 1-4 Alkyl or halogen; A is -(CH2) a -、-(CH2CH2O) b -、-((CH2) c NHCO) d -or-((CH2) c CONH) d - where a is an integer from 1 to 15, b is an integer from 1 to 7, c is an integer from 1 to 7, and d is an integer from 1 to 5; B is -(CH2) e -, where e is an integer between 0 and 7; L is either -CONH- or -NHCO-; X1 is -(CH2) f -or-(CH2CH2O) f CH2-, f is an integer from 1 to 5; X2 is -(CH2) g - g is an integer from 1 to 6; X3 is oxygen or sulfur; Y1 is either 0 or 1; Y2 is 0, 1, or 2; When Y3 is 1, X4 is CH2; when Y3 is 2, X4 is CH; when Y3 is 3, X3 is carbon. m is an integer between 0 and 4; n is an integer between 0 and 4; q is an integer between 0 and 4.

20. The conjugate according to claim 19, characterized in that, The conjugating group is: ， ， ， ， ， ， ， , ,or .

21. The conjugate according to any one of claims 17-20, characterized in that, The siRNA duplex comprises any one or a combination of at least two of the following oligonucleotide duplexes composed of sense and antisense strand pairings: (1) The sense chain has the sequence shown in SEQ ID NO: 426; and the antisense chain has the sequence shown in SEQ ID NO: 552; (2) The sense chain has the sequence shown in SEQ ID NO: 427; and the antisense chain has the sequence shown in SEQ ID NO: 553; (3) The sense chain has a sequence as shown in SEQ ID NO: 429; and the antisense chain has a sequence as shown in SEQ ID NO: 555; (4) The sense chain has the sequence shown in SEQ ID NO: 430; and the antisense chain has the sequence shown in SEQ ID NO: 556; (5) The sense chain has the sequence shown in SEQ ID NO: 431; and the antisense chain has the sequence shown in SEQ ID NO: 557; (6) The sense chain has the sequence shown in SEQ ID NO: 435; and the antisense chain has the sequence shown in SEQ ID NO: 561; (7) The sense chain has the sequence shown in SEQ ID NO: 439; and the antisense chain has the sequence shown in SEQ ID NO: 565; (8) The sense chain has a sequence as shown in SEQ ID NO: 440; and the antisense chain has a sequence as shown in SEQ ID NO: 566; (9) The sense chain has the sequence shown in SEQ ID NO: 442; and the antisense chain has the sequence shown in SEQ ID NO: 568; (10) The sense chain has the sequence shown in SEQ ID NO: 443; and the antisense chain has the sequence shown in SEQ ID NO: 569; (11) The sense chain has the sequence shown in SEQ ID NO: 444; and the antisense chain has the sequence shown in SEQ ID NO: 570; (12) The sense chain has the sequence shown in SEQ ID NO: 445; and the antisense chain has the sequence shown in SEQ ID NO: 571; (13) The sense chain has the sequence shown in SEQ ID NO: 446; and the antisense chain has the sequence shown in SEQ ID NO: 572; (14) The sense chain has the sequence shown in SEQ ID NO: 447; and the antisense chain has the sequence shown in SEQ ID NO: 573; (15) The sense chain has the sequence shown in SEQ ID NO: 448; and the antisense chain has the sequence shown in SEQ ID NO: 574; (16) The sense chain has the sequence shown in SEQ ID NO: 449; and the antisense chain has the sequence shown in SEQ ID NO: 575; (17) The sense chain has the sequence shown in SEQ ID NO: 450; and the antisense chain has the sequence shown in SEQ ID NO: 576; (18) The sense chain has the sequence shown in SEQ ID NO: 454; and the antisense chain has the sequence shown in SEQ ID NO: 580; (19) The sense chain has the sequence shown in SEQ ID NO: 455; and the antisense chain has the sequence shown in SEQ ID NO: 581; (20) The sense chain has the sequence shown in SEQ ID NO: 456; and the antisense chain has the sequence shown in SEQ ID NO: 582; (21) The sense chain has the sequence shown in SEQ ID NO: 468; and the antisense chain has the sequence shown in SEQ ID NO: 594; (22) The sense chain has the sequence shown in SEQ ID NO: 471; and the antisense chain has the sequence shown in SEQ ID NO: 597; (23) The sense chain has the sequence shown in SEQ ID NO: 477; and the antisense chain has the sequence shown in SEQ ID NO: 603; (24) The sense chain has the sequence shown in SEQ ID NO: 478; and the antisense chain has the sequence shown in SEQ ID NO: 604; (25) The sense chain has the sequence shown in SEQ ID NO: 479; and the antisense chain has the sequence shown in SEQ ID NO: 605; (26) The sense chain has the sequence shown in SEQ ID NO: 480; and the antisense chain has the sequence shown in SEQ ID NO: 606; (27) The sense chain has the sequence shown in SEQ ID NO: 529; and the antisense chain has the sequence shown in SEQ ID NO: 655; (28) The sense chain has the sequence shown in SEQ ID NO: 530; and the antisense chain has the sequence shown in SEQ ID NO: 656; (29) The positive chain has a sequence as shown in SEQ ID NO: 532; and the negative chain has a sequence as shown in SEQ ID NO:

658.

22. The conjugate according to any one of claims 17-20, characterized in that, The conjugate comprises any one or a combination of at least two of the following oligonucleotide duplexes formed by pairing of sense and antisense strands: (1) The sense chain has a sequence as shown in SEQ ID NO: 695; and the antisense chain has a sequence as shown in SEQ ID NO: 732; (2) The sense chain has a sequence as shown in SEQ ID NO: 706; and the antisense chain has a sequence as shown in SEQ ID NO: 743; (3) The sense chain has the sequence shown in SEQ ID NO: 707; and the antisense chain has the sequence shown in SEQ ID NO: 744; (4) The sense chain has the sequence shown in SEQ ID NO: 708; and the antisense chain has the sequence shown in SEQ ID NO: 745; (5) The sense chain has the sequence shown in SEQ ID NO: 710; and the antisense chain has the sequence shown in SEQ ID NO: 747; (6) The sense chain has the sequence shown in SEQ ID NO: 713; and the antisense chain has the sequence shown in SEQ ID NO: 750; (7) The sense chain has the sequence shown in SEQ ID NO: 714; and the antisense chain has the sequence shown in SEQ ID NO: 751; (8) The sense chain has the sequence shown in SEQ ID NO: 715; and the antisense chain has the sequence shown in SEQ ID NO: 752; (9) The sense chain has the sequence shown in SEQ ID NO: 719; and the antisense chain has the sequence shown in SEQ ID NO: 756; (10) The sense chain has the sequence shown in SEQ ID NO: 720; and the antisense chain has the sequence shown in SEQ ID NO: 757; (11) The sense chain has the sequence shown in SEQ ID NO: 721; and the antisense chain has the sequence shown in SEQ ID NO: 758; (12) The sense chain has the sequence shown in SEQ ID NO: 722; and the antisense chain has the sequence shown in SEQ ID NO: 759; (13) The sense chain has the sequence shown in SEQ ID NO: 723; and the antisense chain has the sequence shown in SEQ ID NO: 760; (14) The sense chain has the sequence shown in SEQ ID NO: 724; and the antisense chain has the sequence shown in SEQ ID NO: 761; (15) The sense chain has the sequence shown in SEQ ID NO: 725; and the antisense chain has the sequence shown in SEQ ID NO: 762; (16) The sense chain has the sequence shown in SEQ ID NO: 728; and the antisense chain has the sequence shown in SEQ ID NO: 765; (17) The positive chain has a sequence as shown in SEQ ID NO: 729; and the negative chain has a sequence as shown in SEQ ID NO:

766.

23. A nucleic acid protein composition, characterized in that, The nucleic acid protein composition comprises the double-stranded region of the siRNA double strand as described in any one of claims 1-16, and a nuclease; Alternatively, the nucleic acid protein composition comprises the antisense strand of the double-stranded region of the siRNA double strand as described in any one of claims 1-16, and a nuclease.

24. A pharmaceutical composition, characterized in that, The composition comprises a double-stranded siRNA according to any one of claims 1-16, a conjugate according to any one of claims 17-22, or a nucleic acid protein composition according to claim 23, and a pharmaceutically acceptable carrier.

25. The use of the siRNA duplex according to any one of claims 1-16, the conjugate according to any one of claims 17-22, the nucleic acid protein composition according to claim 23, or the pharmaceutical composition according to claim 24 in the preparation of a medicament for treating diseases related to FXI gene expression.

26. The use of the siRNA double strand according to any one of claims 1-16, the conjugate according to any one of claims 17-22, the nucleic acid protein composition according to claim 23, or the pharmaceutical composition according to claim 24 in the preparation of anticoagulant drugs.

Images