Application of rice iron-sulfur cluster gene OsISC1 in prevention and control of grain cadmium accumulation

Abstract

The invention discloses an application of a rice iron-sulfur cluster gene OsISC1. The iron-sulfur cluster gene OsISC1 has a sequence as shown in SEQ ID NO. 1. The gene can be used for preventing and controlling cadmium accumulation of rice grains. The biological function of the iron-sulfur cluster gene OsISC1 in rice is found through a large number of experiments, after the gene is knocked out, the cadmium content of grains can be reduced by 80% or above, important agronomic traits such as the rice yield are not affected, and the iron-sulfur cluster gene OsISC1 can be applied to cultivation of rice grains with low cadmium accumulation.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of plant genetic engineering, and particularly relates to application of rice iron-sulfur cluster gene OsISC1 in blocking and controlling grain cadmium accumulation. BACKGROUND

[0002] Cadmium is a heavy metal element harmful to human body, and long-term exposure to high-concentration cadmium environment can easily cause damage to organs such as lung, liver and kidney, accompanied by osteoporosis and cardiovascular diseases (Wang, Jing et al., 2019). et al., 2020). As one of the main food crops in the world, rice has become the main source of dietary cadmium intake for two reasons: first, compared with other foods, nearly half of the world's population mainly eats rice; second, compared with other plants, rice has stronger ability to absorb cadmium in soil and transfer cadmium to grains (Sui et al., 2018). However, surveys show that 2.2%-10% of rice on the market in China has an average cadmium content exceeding the highest limited standard of cadmium content in rice 0.2 mg / kg in China (Wang, Peng et al., 2019). Especially in some southern regions, the cadmium content of some rice produced reaches 0.33-0.69 mg / kg (Xie et al., 2017). The primary cause of rice cadmium pollution in China is the increase in soil cadmium concentration. The latest national soil pollution survey shows that since the 1980s, the soil cadmium concentration in the north, northeast and west of China has increased by 10%-40%, and in the coastal areas and the south, it has increased by 50%. The second reason for rice cadmium pollution is soil acidification. Due to the overuse of nitrogen fertilizer and the intensification of agricultural production, human acidification is also occurring, which significantly improves the solubility of cadmium in soil (Wang, Jing et al., 2019). The third reason for rice cadmium pollution is the genetic diversity among rice varieties, which leads to a large difference in grain cadmium accumulation ability among different varieties (Duan et al., 2017). Rice varieties widely planted in southern China are mostly indica rice, which usually accumulates more heavy metals in grains than japonica rice (Sun et al., 2016). Therefore, we must take action to reduce the cadmium content of rice to protect the health of citizens in China. Although methods such as increasing soil pH and applying organic amendments can significantly reduce the bioavailability of cadmium and other heavy metals, these measures are costly, have a long repair period and are not easy to promote. The currently widely recognized measure by researchers is to use dominant alleles and germplasm resources to breed new rice varieties with low cadmium accumulation.

[0003] In addition to human body, cadmium can also seriously inhibit the growth and development of plants, destroy the normal function of cell membrane, affect photosynthesis, and thus reduce the yield and quality of crops (Zhou et al., 2014). In order to avoid cadmium poisoning, plants have evolved various detoxification mechanisms. First, under cadmium stress, plants can activate the expression of transport and detoxification genes in the body to improve their tolerance. Metallothionein can be formed in plants under cadmium stress, which can complex metal ions through thiol bonds (An et al., 2006). In addition, plants can also enhance the activity of antioxidant enzymes such as superoxide dismutase, peroxidase, catalase, etc. under cadmium stress, so as to remove excess ROS in the body to alleviate the toxicity of cadmium to plants (Dong et al., 2006). At the same time, plants can synthesize sulfhydryl compounds such as cysteine, glutathione (GSH) and plant chelating peptides (PCs) or cell wall components such as pectin and lignin to chelate cadmium in cells, which can be accumulated in the form of complex in vacuoles or cell walls, thereby reducing the cadmium content in the cytoplasm (Cobbett et al., 1998; Seth et al., 2012).

[0004] At present, there are few reports on genes regulating grain cadmium accumulation in rice, and the mining of such genes is of great significance. The use of such genes can effectively reduce the cadmium content in rice, and block cadmium from entering the food chain from the source to protect human health. SUMMARY

[0005] The purpose of the present application is to solve the above-mentioned problems existing in the prior art, and to provide the application of rice iron-sulfur cluster gene OsISC1. The accession number of OsISC1 in GenBank is XM_015766420.

[0006] The technical scheme of the present application is as follows:

[0007] The first purpose of the present application is to provide the application of knocking out rice iron-sulfur cluster gene OsISC1 in blocking and controlling grain cadmium accumulation and / or reducing the cadmium content in rice grains. The genomic nucleotide sequence of the rice iron-sulfur cluster gene OsISC1 is shown in SEQ ID NO. 1.

[0008] Further, the CDS sequence of the rice iron-sulfur cluster gene OsISC1 is shown in SEQ ID NO. 2.

[0009] The second purpose of the present application is to provide a knockout vector for blocking and controlling grain cadmium accumulation. The knockout vector is a recombinant expression vector containing the aforementioned rice iron-sulfur cluster gene OsISC1 or any fragment thereof.

[0010] Further, the knockout vector is a recombinant expression vector containing the iron-sulfur cluster gene OsISC1 target sequence T1 shown in SEQ ID NO. 3 and / or the iron-sulfur cluster gene OsISC1 target sequence T2 shown in SEQ ID NO. 4.

[0011] Further, the knockout vector is a recombinant expression vector containing the iron-sulfur cluster gene OsISC1 target sequence T1 shown in SEQ ID NO. 3 and / or the iron-sulfur cluster gene OsISC1 target sequence T2 shown in SEQ ID NO. 4.

[0012] Further, the sgRNA expression cassette OsU6a-T1-sgRNA containing the iron-sulfur cluster gene OsISC1 target sequence T1 shown in SEQ ID NO. 3 and the sgRNA expression cassette OsU6a-T2-sgRNA containing the iron-sulfur cluster gene OsISC1 target sequence T2 shown in SEQ ID NO. 4 are obtained by amplification using the following steps:

[0013] (1) using the plasmid pYLsgRNA-OsU6a as a template, and using SEQ ID NO. 5 gRT1 and SEQ ID NO. 6 OsU6aT1 as primers, the sgRNA fragment containing the target T1 is amplified; using the plasmid pYL-sgRNA-OsU6b as a template, and using SEQ ID NO. 7 gRT2 and SEQ ID NO. 8 OsU6bT2 as primers, the sgRNA fragment containing the target T2 is amplified;

[0014] (2) using SEQ ID NO. 9 Pps-GGL and SEQ ID NO. 10 Pgs-GG2 as primers to amplify the sgRNA fragment containing the target T1, the sgRNA expression cassette OsU6a-T1-sgRNA is obtained; using SEQ ID NO. 11 Pps-GG2 and SEQ ID NO. 12 Pgs-GGR as primers to amplify the sgRNA fragment containing the target T2, the sgRNA expression cassette OsU6a-T2-sgRNA is obtained.

[0015] A third object of the present application is to provide the use of the aforementioned knockout vector in blocking and controlling the accumulation of cadmium in grains and / or reducing the cadmium content in rice grains.

[0016] Further, the aforementioned knockout vector is introduced into rice to obtain rice in which the iron-sulfur cluster gene OsISC1 is knocked out, thereby blocking and controlling the accumulation of cadmium in grains and reducing the cadmium content in rice grains.

[0017] The beneficial effects of the present application are as follows:

[0018] 1. The present application provides, for the first time, the biological function of iron-sulfur cluster gene OsISC1 in blocking the accumulation of cadmium in rice grains through systematic research.

[0019] 2. The present application provides an effective means for regulating cadmium in rice grains. After knocking out the iron-sulfur cluster gene OsISC1 in rice, the cadmium content in mature rice grains is significantly reduced.

[0020] 3. The present application constructs a knock-out material of the iron-sulfur cluster gene OsISC1.

[0021] 4. Through the application of the iron-sulfur cluster gene OsISC1 provided by the present application, the accumulation of cadmium in grains can be effectively controlled without affecting the main agronomic traits such as yield per plant, effective tillering, and thousand-grain weight of rice, and it can be applied to cultivate rice varieties with low accumulation of cadmium in grains. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 Statistical diagram of cadmium content in each tissue of the iron-sulfur cluster gene OsISC1 knock-out mutant of rice under cadmium treatment; wherein: A: statistical diagram of cadmium content in the roots of wild type CXG seedlings and OsISC1 knock-out mutant seedlings after 5 days of 0.5 μM cadmium treatment; B: statistical diagram of cadmium content in the aboveground parts of wild type CXG seedlings and OsISC1 knock-out mutant seedlings after 5 days of 0.5 μM cadmium treatment.

[0023] Figure 2 Statistical diagram of cadmium content in grains of the iron-sulfur cluster gene OsISC1 knock-out mutant of rice planted in cadmium-contaminated soil in the field.

[0024] Figure 3 Statistical diagram of main agronomic traits of the iron-sulfur cluster gene OsISC1 knock-out mutant of rice under field conditions; wherein:

[0025] A: field growth phenotype of wild type CXG plants and OsISC1 knock-out mutant plants;

[0026] B: comparison of yield per plant of OsISC1 knock-out mutant plants and wild type CXG plants;

[0027] C: comparison of effective tillering of OsISC1 knock-out mutant plants and wild type CXG plants;

[0028] D: comparison of thousand-grain weight of OsISC1 knock-out mutant plants and wild type CXG plants. DETAILED DESCRIPTION

[0029] The present application will be further explained in conjunction with the following examples, but the examples do not limit the present application in any form.

[0030] Example 1

[0031] The preparation of rice iron-sulfur cluster gene OsISC1 knockout mutant is as follows:

[0032] 1) Knock out OsISC1 by using CRISPR / Cas9 gene editing technology. The fragment ACGACGGCGATGGCTTCTGC (SEQ ID NO. 3) in the sequence of the OsISC1 CDS region shown in SEQ ID NO. 2 is selected as the editing target site T1 and the fragment GCTGCAGAACCTGCTGAAGA (SEQ ID NO. 4) is selected as the editing target site T2, and primers for constructing the knockout vector are designed.

[0033] The primer sequences are as follows:

[0034] gRT1: 5'-ACGACGGCGATGGCTTCTGCGTTTTAGAGCTAGAAAT-3' (SEQ ID NO. 5);

[0035] OsU6aT1: 5'-GCAGAAGCCATCGCCGTCGTCGGCAGCCAAGCCAGCA-3' (SEQ ID NO. 6);

[0036] gRT2: 5'-CTGCAGAACCTGCTGAAGAGTTTTAGAGCTAGAAAT-3' (SEQ ID NO. 7);

[0037] OsU6bT2: 5'-TCTTCAGCAGGTTCTGCAGCAACACAAGCGGCAGC-3' (SEQ ID NO. 8).

[0038] 2) The sgRNA fragment containing target T1 is amplified from the plasmid pYLsgRNA-OsU6a using SEQ ID NO. 5 gRT1 and SEQ ID NO. 6 OsU6aT1 as primers; the sgRNA expression cassette fragment containing target T2 is amplified from the plasmid pYL-sgRNA-OsU6b using SEQ ID NO. 7 gRT2 and SEQ ID NO. 8 OsU6bT2 as primers.

[0039] The amplification system is: 10 μl Mix buffer; 2 μl plasmid; 0.5 μl of primer each; 7 μl ddH2O;

[0040] The amplification procedure is: (1) 95℃, 3min; (2) 95℃, 15s; (3) 58℃, 15s; (4) 72℃, 20s; (5) 72℃, 5min; (6) 4℃, 5min; steps (2)-(4) repeat 35 cycles.

[0041] 3) Take the sgRNA expression cassette fragment in 2) as a template, continue to amplify the complete sgRNA expression cassette OsU6a-T1-sgRNA and OsU6a-T2-sgRNA.

[0042] The amplification system is: 10ul Mix buffer; 2ul expression cassette fragment; 0.5ul of primer each; 7ul ddH2O;

[0043] The primers used are respectively:

[0044] Pps-GGL: 5'-ttcagaggtctctctcgactagtatggaatcggcagcaaagg-3'(SEQ ID NO. 9);

[0045] Pgs-GG2: 5'-agcgtgggtctcgtcagggtccatccactccaagctc-3'(SEQ ID NO. 10);

[0046] Pps-GG2: 5'-ttcagaggtctctctgacactggaatcggcagcaaagg-3'(SEQ ID NO. 11);

[0047] Pgs-GGR: 5'-agcgtgggtctcgaccgacgcgtatccatccactccaagctc-3'(SEQ ID NO. 12).

[0048] The sgRNA fragment containing target T1 is amplified by using Pps-GGL shown in SEQ ID NO. 9 and Pgs-GG2 shown in SEQ ID NO. 10 as primers to obtain the complete sgRNA expression cassette OsU6a-T1-sgRNA; the sgRNA expression cassette fragment containing target T2 is amplified by using Pps-GG2 shown in SEQ ID NO. 11 and Pgs-GGR shown in SEQ ID NO. 12 as primers to obtain the complete sgRNA expression cassette OsU6a-T2-sgRNA.

[0049] The amplification procedure is: (1) 95℃, 3min; (2) 95℃, 15s; (3) 58℃, 15s; (4) 72℃, 20s; (5) 72℃, 5min; (6) 4℃, 5min; steps (2)-(4) repeat 35 cycles.

[0050] 4) Assemble sgRNA expression cassettes OsU6a-T1-sgRNA and OsU6a-T2-sgRNA into the BsaI-BsaI restriction sites of pYLCRISPR / Cas9Pubi-H to construct knockout vectors.

[0051] 5) Transform the verified correct knockout vectors of step 4) into rice. The specific transgenic process is as follows: (1) Transform the pYLCRISPR / Cas9Pubi-H plasmid into Agrobacterium (EHA105); (2) Take the seeds of rice variety Changxiang (CXG) as the material, peel the hull, disinfect, and then place on the induction medium to induce callus; (3) Infect the callus with Agrobacterium bacterial solution, then wash with sterile ddH2O three times, and then place on the selection medium to screen out resistant callus; (4) Transfer the resistant callus to the differentiation medium and rooting medium in turn, and obtain transgenic T0 generation plants after induction differentiation and rooting.

[0052] 6) Plant T0 generation plants in the field, sequence to identify whether the coding region of OsISC1 is mutated, select homozygous mutant single plants, and harvest T1 generation seeds.

[0053] The identification primer is:

[0054] CRISPR-OsISC1-F:

[0055] 5'-GGAGTGAGTACGGTGTGCCGAAATCAGACACGAACCCA-3'(SEQ ID NO. 13);

[0056] CRISPR-OsISC1-R:

[0057] 5'-GAGTTGGATGCTGGATGGCCTCTTCTCGCCCTGCTG-3'(SEQ ID NO. 14);

[0058] It is detected that three iron-sulfur cluster gene OsISC1 edited knockout mutants KO-1, KO-2 and KO-3 are obtained in the embodiment.

[0059] Example 2

[0060] The cadmium treatment experiment of the iron-sulfur cluster gene OsISC1 knockout mutants KO-1, KO-2 and KO-3 prepared in Example 1 is carried out, and the specific implementation process is as follows:

[0061] 1) Seed soaking: After rinsing the rice seeds with clean water to remove any empty or shriveled husks floating on the surface, soak them at room temperature for 1 day, then germinate them in a 37℃ biochemical incubator until they show white sprouts. Once the seeds have sprouted white sprouts, sow them on a small black net secured with foam boards around the edges. Place them in a greenhouse for 3 days in the dark.

[0062] 2) Initial culture: After one week of culture under normal light, add 1 / 2 Kimura B nutrient solution and continue culture. Adjust the pH of the nutrient solution to 5.6 and change the nutrient solution every 3 days.

[0063] 3) Cadmium treatment: After culturing for 2 weeks under normal conditions, add the required volume of 0.5 mM cadmium stock solution (1000X) to a newly replaced 1 / 2 Kimura B nutrient solution in a transfer chamber. Shake the treatment solution with a glass rod until the final concentration is 0.5 μM cadCl2. Treat for 5 days, changing the treatment solution every 2 days. Carefully observe the seedling growth during the treatment period.

[0064] 4) Cadmium content determination: After 5 days of treatment, the roots and aboveground parts of each seedling were sampled and dried at 42℃ to constant weight. The dry weight of the sample was weighed and the sample was digested in a graphite furnace. The cadmium content of the sample was determined by ICP-MS.

[0065] The results showed that after treatment with 0.5 μM cadmium, the cadmium content in the roots and shoots of OsISC1 knockout mutant seedlings was not significantly different from that in wild-type CXG seedlings. Figure 1 This embodiment shows that mutation of the iron-sulfur cluster gene OsISC1 does not affect the absorption of cadmium by rice seedlings and its translocation to the aboveground parts.

[0066] Example 3

[0067] The field planting experiment of the iron-sulfur cluster gene OsISC1 knockout mutants KO-1, KO-2 and KO-3 prepared in Example 1 on cadmium-contaminated soil was carried out as follows:

[0068] 1) After germinating wild-type CXG seeds and T1 generation homozygous seeds of mutants KO-1, KO-2 and KO-3 at 37℃ for 3 days, they were sown on a plastic black net suspended on tap water. Cardboard was placed over the black net for shading to promote rooting. After 3 days, the cardboard was removed and the seeds were placed under normal light to grow.

[0069] 2) Two weeks later, the seedlings of wild-type CXG and mutants KO-1, KO-2 and KO-3 were transferred to a black plastic bucket containing 1 / 2 KimuraB nutrient solution and continued to grow for two weeks, during which the nutrient solution was changed every 3 days.

[0070] 3) Select wild-type CXG seedlings with consistent growth and mutants KO-1, KO-2 and KO-3, and transplant them into cadmium-contaminated rice fields. Transplant 6 seedlings of each line, with a spacing of 10cm between each seedling and a row spacing of 15cm. Water and fertilizer management and pest and disease control throughout the rice growth period are the same as in ordinary fields.

[0071] 4) Harvest wild-type CXG plants and mutants KO-1, KO-2 and KO-3 at the rice maturity stage.

[0072] 5) Pick the kernels from the tip of the main panicle of each plant, dry them in an oven, peel off the husks, weigh them, and then burn them in a graphite furnace. Finally, use ICP-MS to determine the cadmium content.

[0073] This example demonstrates that mutation of the iron-sulfur cluster gene OsISC1 significantly reduces the cadmium content of mature rice grains under cadmium-contaminated field conditions. Figure 2 This embodiment shows that mutation of the iron-sulfur cluster gene OsISC1 can inhibit cadmium accumulation in grains and significantly reduce the cadmium content in mature rice grains by more than 80%.

[0074] Example 4

[0075] The statistical analysis of the main agronomic traits of the iron-sulfur cluster gene OsISC1 knockout mutants KO-1, KO-2, and KO-3 under non-cadmium-polluted field conditions prepared in Example 1 is as follows:

[0076] 1) Repeat steps 1-2 of Example 3.

[0077] 2) Select wild-type CXG seedlings with consistent growth and mutants KO-1, KO-2 and KO-3, and transplant them into conventional rice fields. Transplant 6 seedlings of each line, with a spacing of 10cm between each seedling and a row spacing of 15cm. Water and fertilizer management and pest and disease control throughout the rice growth period are the same as in ordinary fields.

[0078] 3) Statistical analysis of the main agronomic traits of wild-type CXG and mutants KO-1, KO-2 and KO-3, including yield per plant, number of effective spikes and thousand-grain weight.

[0079] This example demonstrates that mutations in the iron-sulfur cluster gene OsISC1 do not affect the main agronomic traits of rice. Specifically, the yield per plant, effective tillers, and thousand-grain weight of the OsISC1 knockout mutant plants were not significantly different from those of the wild-type CXG plants. Figure 3 ).

[0080] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

[0081] SEQ ID No.1: OsISC1 genome sequence

[0082]

[0083] SEQ ID No.2: OsISC1 CDS sequence

[0084]

[0085] SEQ ID No.3T1

[0086] ACGACGGCGATGGCTTCTGC

[0087] SEQ ID No.4 T2

[0088] GCTGCAGAACCTGCTGAAGA。

Claims

1. The application of knocking out the rice iron-sulfur cluster gene OsISC1 in controlling cadmium accumulation in grains and / or reducing cadmium content in rice grains, characterized in that, The genomic nucleotide sequence of the rice iron-sulfur cluster gene OsISC1 is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The CDS sequence of the rice iron-sulfur cluster gene OsISC1 is shown in SEQ ID NO.

2.

3. A knockout vector for inhibiting cadmium accumulation in grains, characterized in that, The knockout vector is a recombinant expression vector containing the rice iron-sulfur cluster gene OsISC1 as described in claim 1 or any fragment thereof.

4. The knockout carrier according to claim 3, characterized in that, The knockout vector is a recombinant expression vector containing the target sequence T1 of the iron-sulfur cluster gene OsISC1 shown in SEQ ID NO.3 and / or the target sequence T2 of the iron-sulfur cluster gene OsISC1 shown in SEQ ID NO.

4.

5. The knockout carrier according to claim 4, characterized in that, The knockout vector is obtained by assembling the sgRNA expression cassette OsU6a-T1-sgRNA containing the OsISC1 target sequence T1 of the iron-sulfur cluster gene shown in SEQ ID NO.3, and / or the sgRNA expression cassette OsU6a-T2-sgRNA containing the OsISC1 target sequence T2 of the iron-sulfur cluster gene shown in SEQ ID NO.4, between the BsaI-BsaI restriction sites of the base vector.

6. The knockout carrier according to claim 5, characterized in that, The sgRNA expression cassette OsU6a-T1-sgRNA containing the OsISC1 target sequence T1 of the iron-sulfur cluster gene shown in SEQ ID NO.3 and the sgRNA expression cassette OsU6a-T2-sgRNA containing the OsISC1 target sequence T2 of the iron-sulfur cluster gene shown in SEQ ID NO.4 were amplified using the following steps: (1) Using plasmid pYLsgRNA-OsU6a as a template, and SEQ ID NO.5gRT1 and SEQ ID NO.6OsU6aT1 as primers, an sgRNA fragment containing the target T1 was amplified; using plasmid pYL-sgRNA-OsU6b as a template, and SEQ ID NO.7gRT2 and SEQ ID NO.8OsU6bT2 as primers, an sgRNA fragment containing the target T2 was amplified; (2) Using Pps-GGL shown in SEQ ID NO.9 and Pgs-GG2 shown in SEQ ID NO.10 as primers, the sgRNA fragment containing the target T1 was amplified to obtain the sgRNA expression cassette OsU6a-T1-sgRNA; using Pps-GG2 shown in SEQ ID NO.11 and Pgs-GGR shown in SEQ ID NO.12 as primers, the sgRNA fragment containing the target T2 was amplified to obtain the sgRNA expression cassette OsU6a-T2-sgRNA.

7. The application of the knockout vector according to any one of claims 3 to 6 in controlling cadmium accumulation in grains and / or reducing cadmium content in rice grains.

8. The application according to claim 7, characterized in that, Introducing the knockout vector according to any one of claims 3 to 6 into rice yields rice with the iron-sulfur cluster gene OsISC1 knocked out, thereby inhibiting cadmium accumulation in grains and reducing the cadmium content in rice grains.

Images