Application of light collection antenna complex protein coding gene GmLHCa2 of soybean light system I

Abstract

The invention aims to provide an application of a light collection antenna complex protein coding gene GmLHCa2 of a soybean light system I. The invention further discloses a preparation method of the light collection antenna complex protein coding gene GmLHCa2. The nucleotide sequence of the GmLHCa2 is as shown in SEQ ID NO. 1. GmLHCa2 provided by the invention is subjected to gene knockout by utilizing a gene editing carrier pSC-M-GmLHCa2, and a GmLHCa2 gene editing material negatively regulates and controls the leaf net photosynthetic rate, the plant height and the grain protein content of soybeans under the condition of long sunshine; under a short-day condition, compared with a contrast Jack, the yield-related traits, including plant height, single plant pod number, single plant grain number and single plant yield, of the GmLHCa2 gene editing material are remarkably improved. The invention discloses the effect of the gene on regulation and control of soybean plant growth and development and grain quality and yield related traits, and is beneficial to analysis of LHCI family gene functions in soybeans and creation of genetic breeding materials.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of plant genetic engineering, and relates to application of a soybean light-harvesting antenna complex protein encoding gene GmLHCa2. BACKGROUND

[0002] Soybean [Glycine max (L.) Merr.] is the main source of plant protein and vegetable oil for human beings. Among plant proteins, the protein content of legumes, especially soybean, is the highest, which is about twice that of other plant products. Soybean protein not only has high content, but also contains various amino acids. Except for the lower content of methionine and cysteine, the content of other amino acids, especially lysine, is higher compared with the "ideal protein model" specified by the Food and Agriculture Organization of the United Nations. This makes soybean protein have a better supplement effect compared with cereal protein.

[0003] We screened a candidate gene GmLHCa2 (Glyma.03g262300 V4.0) that may be related to photosynthesis and quality through a yeast two-hybrid system. The gene encodes a light-harvesting antenna complex protein of soybean photosystem I, which plays an important role in the growth and development of soybean. Therefore, we decided to further explore the biological function of GmLHCa2.

[0004] Photosynthesis converts carbon dioxide and water into carbohydrates and oxygen using light energy, maintaining almost all life activities on earth. Photosynthesis is initiated by light reactions, in which light energy is captured and transferred to induce charge separation in the reaction centers of photosystem I (PSI) and photosystem II (PSII), thereby generating NADPH and ATP. In vascular plants, PSI and PSII have common general organization, including core complex parts (PSI core or PSII core) and outer antenna complex parts. Therefore, the two supercomplexes are called PSI-LHCI and PSII-LHCII. Notably, their spectral properties are quite different: PSI can use light with a wavelength of more than 700 nm, while PSII cannot, although they both use chlorophyll a (Chl a) as the main light-capturing pigment.

[0005] Among these complexes, PSI has the most negative redox potential in nature. PSI is a light-driven phycobilin: ferredoxin (FDX) oxidoreductase. Electron transfer from FDX to FDX-NADPH oxidoreductase (FNR) results in the formation of NADPH, the end product of linear electron flow (LEF). Alternatively, FDX can be involved in redirecting electron transfer to the Cyt b6f complex and / or NADPH oxidase (Joliot and Joliot, 2006; Yamamoto et al., 2011). The resulting cyclic electron flow (CEF) would provide ATP balance and protect the PSI acceptor side from over-reduction. CEF around PSI was first recognized by Arnon (1959). However, its mechanism of action is not yet clear. CEF can involve direct reduction of the plastoquinone (PQ) pool by NAD(P)H dehydrogenase (NDH)-dependent electron transfer.

[0006] The PSI core is surrounded by PSI-LHCI supercomplexes in various algae and higher plants, which are formed by the PSI core and the intrinsic light-harvesting complex (LHC) I proteins to maximize light energy utilization efficiency (Nelson & Junge, 2015; Suga et al., 2016). The crystal structure of PSI-LHCI in higher plants has also been reported with increasing resolution (Pi et al., 2018), which indicates that the supercomplex contains 12 PSI core subunits and 4 LHCI subunits, which are encoded by four different LHCa genes, named LHCa1 to LHCa4. The four LHCI subunits are associated on one side of the PSI core to form a hemispherical shape of the entire supercomplex. However, the regulatory mechanism of each LHCI subunit in soybean for photosynthesis and photosynthetic products is not yet clear. SUMMARY

[0007] The purpose of the present application is to disclose the application of a soybean photosystem I light-harvesting antenna complex protein encoding gene GmLHCa2. The GmLHCa2 gene is expressed in various tissues of soybean, with the highest expression in leaves. Subcellular localization shows that the protein encoded by GmLHCa2 is localized in chloroplasts. In this experiment, GmLHCa2 was used as the target gene to construct a CRISPR / Cas9 multi-gene knockout vector pSC-M-GmLHCa2 marked with the phosphinothricin resistance gene bar, and to transform soybean variety Jack to obtain two homozygous mutant lines.

[0008] The purpose of the present application can be achieved by the following technical solutions:

[0009] The gene encoding the light-collecting antenna complex protein of soybean photosystem I, GmLHCa2, has the coding region sequence shown in SEQ ID NO.1 and the amino acid sequence shown in SEQ ID NO.2.

[0010] The application of reducing the expression level of the light-harvesting antenna complex protein-coding gene GmLHCa2 in soybean photosystem I to improve soybean yield under short-day conditions, wherein the nucleotide sequence of the light-harvesting antenna complex protein-coding gene GmLHCa2 in soybean photosystem I is: SEQ ID NO.1.

[0011] As a preferred embodiment of the present invention, the yield traits include plant height, number of pods per plant, number of seeds per plant, and yield per plant.

[0012] As a preferred embodiment of the present invention, the means of reducing the expression level of the gene encoding the light-collecting antenna complex protein of soybean photosystem I is gene editing or RNA interference.

[0013] The gene editing vector for the light-collecting antenna complex protein encoding gene GmLHCa2 described in this invention.

[0014] As a preferred embodiment of the present invention, the gene editing vector is a dual vector for editing two sgRNAs by linking two sgRNAs of GmLHCa2 to a PSCM vector initiated by the U3 and U6 promoters.

[0015] As a further preferred embodiment of the present invention, the two sgRNA sequences are shown as SEQ ID NO.3 and SEQ ID NO.4, and SEQ ID NO.5 and SEQ ID NO.6, respectively.

[0016] The application of the gene-editing vector described in this invention in improving soybean yield traits under short-day conditions.

[0017] As a preferred embodiment of the present invention, the yield traits include plant height, number of pods per plant, number of seeds per plant, and yield per plant.

[0018] The plant expression vector carrying the GmLHCa2 of this invention can be used to transform plant cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electrocoagulation, and Agrobacterium-mediated transformation, and the transformed plant tissues can be cultured into plants. The plant hosts to be transformed can be monocotyledonous plants such as rice, wheat, and corn, or dicotyledonous plants such as tobacco, Arabidopsis thaliana, soybean, rapeseed, cucumber, tomato, poplar, turfgrass, and alfalfa.

[0019] Beneficial effects:

[0020] In this invention, GmLHCa2 belongs to the photosystem I light-harvesting antenna complex protein family. Tissue expression analysis based on website prediction revealed that GmLHCa2 is primarily expressed in leaves, and subcellular localization showed that the GmLHCa2 protein is mainly located in chloroplasts. Using the gene-editing vector pSC-M-GmLHCa2, gene knockout of GmLHCa2 in this invention can regulate the net photosynthetic rate of soybean leaves, plant height, and grain protein content. Under long-day conditions, the GmLHCa2 gene-edited material showed a significant decrease in net photosynthetic rate, plant height, and grain protein content compared to the control Jack. However, under short-day conditions, the GmLHCa2 gene-edited material showed a significant increase in yield-related traits, including plant height, number of pods per plant, number of grains per plant, and yield per plant, compared to the control Jack. This invention discloses the role of this gene in regulating plant growth and development, as well as grain quality and yield traits, which is beneficial for elucidating the function of LHCI family genes in soybean and creating genetic breeding materials. Attached Figure Description

[0021] The present invention will be further described below with reference to the accompanying drawings and embodiments.

[0022] Figure 1 Cloning of the GmLHCa2 gene.

[0023] Primers were designed based on the GmLHCa2 sequence information predicted by the Phytozome13 website (https: / / phytozome-next.jgi.doe.gov / ). PCR amplification was performed using leaf cDNA from Nanjing Agricultural University 1138-2 cultivar as a template, yielding an 804 bp DNA fragment. Sequencing analysis confirmed that the sequence information of this fragment matched the sequence predicted by the Phytozome13 website, indicating that this 804 bp fragment represents the GmLHCa2 gene. The markers were 2k, 100bp, 250bp, 500bp, 750bp, 1000bp, and 2000bp.

[0024] Figure 2 Tissue expression analysis of the GmLHCa2 gene.

[0025] RNA-seq data provided on Soybase (https: / / legacy.soybase.org / ) were used to predict the expression level of GmLHCa2 in soybean tissues throughout the entire growth period. The different soybean tissues included leaves, flowers, 1 cm pods, pods 10 and 14 days after flowering, seeds 10, 14, 21, 28, 35, and 42 days after flowering, roots, and stems.

[0026] Figure 3 Subcellular localization of GmLHCa2.

[0027] Figure 4 Bar test strip detection of GmLHCa2 gene-edited soybean plants.

[0028] 1 represents the recipient material; 2 and 3 represent two T0 generation transgenic lines, respectively.

[0029] Figure 5 Positive identification of soybean plants with GmLHCa2 gene editing.

[0030] 100bp, 250bp, 500bp, 750bp, 1000bp, 2000bp; N represents the amplification result of the recipient material Jack; P represents the positive control; 1 and 2 represent the two transgenic plants KO-1 and KO-2 detected in the T0 generation, respectively.

[0031] Figure 6 Expression analysis of GmLHCa2 in gene-edited materials and receptor Jack.

[0032] Figure 7 Comparison of net photosynthetic rates between soybean GmLHCa2 gene-edited material and recipient Jack under long-day conditions.

[0033] Figure 8 Comparison of mature plant height between soybean GmLHCa2 gene-edited material and recipient Jack under long-day conditions.

[0034] Figure 9 Comparison of the protein content of soybean GmLHCa2 gene-edited material and the receptor Jack under long-day conditions.

[0035] Figure 10 Comparison of yield-related phenotypes between soybean GmLHCa2 gene-edited materials and the recipient Jack under short-day conditions. Detailed Implementation

[0036] The present invention will now be described in further detail with reference to the accompanying drawings and embodiments, and to the data. These embodiments are merely illustrative and are not intended to limit the scope of the invention in any way. In the following embodiments, various processes and methods not described in detail are conventional methods known in the art. Primers used are indicated upon their first appearance, and subsequent use of the same primers will use primers with the same initial indication.

[0037] Example 1: Cloning and Identification of Soybean GmLHCa2 and its Encoding Gene

[0038] Primers were designed based on the GmLHCa2 sequence information predicted by the phytozome website, and cDNA from leaves of Nanjing Agricultural University 1138-2 was used as a template for PCR amplification.

[0039] Upstream primer GmLHCa2-F: TTTGAATCAAGGGTGAGGGC;

[0040] Downstream primer GmLHCa2-R: GGTGTCGGCACGTTGGATTA.

[0041] The GmLHCa2 gene was amplified from total RNA in soybean leaf organs using RT-PCR. Soybean leaf tissue was collected, ground in a mortar, and added to a 1.5 mL EP tube containing lysis buffer. After thorough shaking, the mixture was transferred to a glass homogenizer. The homogenized tissue was then transferred to a 1.5 mL EP tube, and RNA was extracted from the soybean tissue using a novel plant total RNA extraction kit (Tiangen). The quality of the total RNA was assessed by formaldehyde denaturing gel electrophoresis, and the RNA content was determined by spectrophotometry. Using the obtained total RNA as a template, the RNA was extracted according to the instructions of the kit. The IIQ RT SuperMix for qPCR (+gDNA wiper) kit (Vazyme) was used for reverse transcription to synthesize the first strand of cDNA. PCR amplification was then performed. The PCR reaction mixture consisted of: 2 μl cDNA (0.05 μg), 2 μl each of forward and reverse primers (10 μM), 25 μl 2×Phanta Max Buffer, 1 μl dNTP (10 mM), and 1 U Phanta Max Super-Fidelity DNA polymerase (Vazyme), with the final volume made up to 50 μl of ultrapure water. The PCR program was as follows: performed on a Bio-RAD PTC200 PCR instrument, with the following program: 95°C pre-denaturation for 3 min; 95°C denaturation for 15 s, 58°C annealing for 15 s, 72°C extension for 30 s, for a total of 35 cycles; then a final extension at 72°C for 5 min to terminate the reaction, and storage at 4°C. The PCR product was recovered and cloned into the pCE2 TA / Blunt-Zero vector. After sequencing, the cDNA sequence of the soybean gene GmLHCa2 with a complete coding region was obtained as SEQ ID NO.1, which is 804 bp in length and encodes 267 amino acids as shown in SEQ ID NO.2.

[0042] Example 2: Expression characteristics of GmLHCa2 in different organs of soybean

[0043] RNA-seq data provided by Soybase (https: / / legacy.soybase.org / ) was used to predict the expression level of GmLHCa2 in soybean tissues throughout the entire growth period. Analysis of expression heatmaps for leaves, flowers, 1cm pods, pods 10 and 14 days after flowering, seeds 10, 14, 21, 28, 35, and 42 days after flowering, roots, and stems showed that GmLHCa2 was present in all tissues, with the highest expression level in leaves.

[0044] Example 3: Subcellular localization of GmLHCa2

[0045] Subcellular localization was performed using transient expression of *Nicotiana benthamiana* (Nitric acid) with the vector pAN580 and primers pAN580-GmLHCa2-F: acaaatctatctctctcgagATGGCTTCCGCTTGTGCTTC, and pAN580-GmLHCa2-R: gctcaccatggatccCTTAGGGGTGAAAGCAGCAA. After PCR amplification and confirmation of the target band, the gel was excised and the recovered product was ligated into the vector via homologous recombination to construct the subcellular localization vector pAN580-GmLHCa2 (gene at the N-terminus of GFP). After expression in *Nicotiana benthamiana* and cultured for 48 hours, the protein was localized by laser confocal microscopy (Leica, SP8) and observed and photographed. Results are as follows: Figure 3 As shown, the empty vector plasmid is distributed throughout the cell, and the GmLHC a2:GFP fusion protein is also distributed in chloroplasts and fused with the auto-red fluorescence of chloroplasts, indicating that GmLHCa2 may mainly function through chloroplast-rich organs, such as leaves.

[0046] Example 4: Genetic Engineering Applications of GmLHCa2

[0047] The CDS region sequence of the GmLHCa2 gene was inserted into CRISPR-P 2.0 (http: / / crispr.hzau.edu.cn / CRISPR2 / ) to obtain sgRNA. sgRNAs with high targeting efficiency and low off-target rate were selected and ligated into a PSCM vector started by the U3 and U6 promoters. Two sgRNAs were selected: GmLHCa2-sgF1: GGCAACAGCTGTAATTGCAGgttttagagctagaaatagcaag (SEQ ID NO.3), GmLHCa2-sgR1: CTGCAATTACAGCTGTTGCCaatccatatgttttcctgggac (SEQ ID NO.4); GmLHCa2-sgF2: AGCAATTGGAGGACGATCGATgttttagagctagaaatagcaag (SEQ ID NO.4). NO.5), GmLHCa2-sgR2:ATCGATCGTCCTCCAATTGCTtgaccagacatgtcacgcttagt (SEQ ID NO.6); two sgRNA-edited binary vectors were constructed for tissue culture experiments to knock out soybean target genes. The pSC-M-GmLHCa2 vector was transformed into Agrobacterium tumefaciens strain EHA105 using the freeze-thaw method.

[0048] Soybean seeds with no surface defects, plump grains, and uniform size and color of seed coat were selected and sterilized in a fume hood. Sterilization was performed using chlorine gas generated from the chemical reaction HCl(conc.) + NaClO → Cl2↑ + NaOH (conc. hydrochloric acid and sodium hypochlorite in a volume ratio of approximately 1:10). In the experiment, 120 ml of NaClO was placed in an Erlenmeyer flask. The soybeans, placed in a petri dish, were then placed in a desiccator, and the Erlenmeyer flask was placed in the center of the desiccator and covered. 15 ml of concentrated HCl was then slowly added from above the desiccator through a separatory funnel. The sterilization time was 7 hours.

[0049] Seed germination: After sterilization, the seeds are thoroughly blown to disperse the chlorine gas in a clean bench and then vertically inserted into the pre-prepared solidified SG4 germination medium, ensuring that the medium covers half of the seed hilum.

[0050] Inoculation: Add approximately 120 ml of YEB liquid culture medium containing antibiotics Kan and Rif to an Erlenmeyer flask, add 1.5 ml of bacterial culture, and incubate at 28°C and 200 rpm until OD reaches the target value. 600 =0.9.

[0051] Agrobacterium infection: Centrifuge the shaken bacterial suspension at 5000 rpm for 10 min at room temperature, discard the supernatant, then add co-culture medium (CCM) to two centrifuge tubes and vortex to resuspend, adjusting the OD600 to 0.6. Five days after soybean seed germination, remove part of the hypocotyl, leaving 5-10 mm. Then cut the seed along the cotyledons and hypocotyl, remove the true leaves, and gently make several incisions along the hypocotyl direction at the cotyledon node. Pour the treated explants and the suspended bacterial suspension into a sterilized jar and co-culture at 28℃ and 120 rpm for 40 min. Finally, remove the explants, cotyledon side down, and place them on a solid co-culture medium (CCM) lined with filter paper. Place 14 explants per dish and incubate in the dark at 25℃ for 5 days.

[0052] Induction of shoot clusters: After co-culturing for 5 days, explants were sterilized with sterile water and Wash-Liquid. Excessively long hypocotyls were removed, leaving approximately 5-10 mm. The explants were inserted at a 45° angle with the growing point upward into SIM solid medium without glufosinate, 8 per plate, and cultured at 26°C under light for 15 days. After 15 days, large buds and part of the hypocotyl were removed. Explants that had developed shoot clusters were then transferred to SIM solid medium supplemented with 6 mg / L glufosinate for selection and cultured for another 15 days.

[0053] Elongation: Remove the cotyledons, dead leaves, and part of the hypocotyl from the explants that are not completely dead, and replace them with SEM solid medium containing 4 mg / L glufosinate for 15 days. Repeat this process every 15 days, removing dead leaves and part of the hypocotyl, replacing the medium with fresh SEM solid medium, and gradually decreasing the concentration of glufosinate.

[0054] Rooting: When the bud of the explant grows to about 6cm, cut off the bottom, make a cross-shaped cut at the bottom of the stem, and transfer it to rooting medium RM for culture. The induced roots will be visible after about 10 days.

[0055] Hardening off: Pour an appropriate amount of sterile water into the bottle and incubate at 26°C under light for about 5 days. Transplanting: When the number and length of roots are suitable, separate the tissue culture seedlings from the culture medium, transplant them into sterilized soil, and place them in an artificial incubator for growth (16h light / 8h darkness, 25°C).

[0056] T0 generation seedlings were tested using bar test strips. If bar protein expression was detected, the test strip showed two bands; otherwise, a single band. Simultaneously, the Cas9 gene marker was used for detection. Cas9 gene amplification conditions were: 95℃ pre-denaturation for 3 min; (95℃ denaturation for 15 s, 58℃ annealing for 15 min, 72℃ extension for 8 s) 35 cycles; 72℃ extension for 5 min. PCR products were detected by 1.5% TAE agarose gel electrophoresis. The detection primers were Cas9-F: CACGCGGAGAATATCACT, Cas9-R: TCTGGACATTGGGACGAA, and the PCR amplification product length was 865 bp. Two homozygous edited lines were obtained by propagating the seeds in the greenhouse to the T2 generation, and GmLHCa2 expression was analyzed. The primers were GmLHCa2-qPCR-F: CTGTTGCCATCTCTACGCC and GmLHCa2-qPCR-R: GGTCAAAGCCGA AGTCTCC. The expression level of the GmLHCa2 gene was significantly decreased in both homozygous lines. Figure 6 ).

[0057] We planted the mutant material in Nanjing, Jiangsu Province, from mid-June to early October (when the sunshine duration was greater than 12 hours), which is a long-day environment under natural conditions; and in Hainan Province, from early December to late March (when the sunshine duration was less than 12 hours), which is a short-day environment under natural conditions.

[0058] Under long-day conditions, the net photosynthetic rate of leaves in the two homozygous mutant lines was significantly lower than that of the recipient Jack. Figure 7 Furthermore, the plant heights of the transgenic material and the recipient Jack after maturity were measured, and the results showed that the plant heights of both mutant lines were significantly lower than those of the recipient. Figure 8 a and b). Using the Kjeldahl method to determine the protein content of transgenic materials and recipient seeds, we found that the protein content of the mutants showed a decreasing trend compared to the control, with one line reaching highly significant (a and b). Figure 9 ).

[0059] Interestingly, under short-day conditions, both homozygous mutants and the receptor Jack showed a trend of significantly increased yield-related traits. We performed yield-related phenotypic analysis on the mutants and Jack after harvest. Figure 10 a) The plant height of the two homozygous mutant lines ( Figure 10 b), Number of pods per plant ( Figure 10 c), number of grains per plant ( Figure 10 d) and yield per plant ( ​ e) were all significantly higher than the control.

Claims

1. The application of reducing the expression level of the light-harvesting antenna complex protein-coding gene GmLHCa2 in soybean photosystem I to improve soybean yield under short-day conditions, characterized in that, The nucleotide sequence of the light-collecting antenna complex protein encoding gene GmLHCa2 in soybean photosystem I is SEQ ID NO.1, and the short-day condition is a day duration of less than 12 hours.

2. The application according to claim 1, characterized in that, The yield traits mentioned include plant height, number of pods per plant, number of seeds per plant, and yield per plant.

3. The application according to claim 1, characterized in that, The method described for reducing the expression level of the gene encoding the light-collecting antenna complex protein in soybean photosystem I is gene editing or RNA interference.

4. The gene editing vector for the light-collecting antenna complex protein-coding gene GmLHCa2 as described in claim 1.

5. The gene editing vector according to claim 4, characterized in that, The gene editing vector is constructed by linking two sgRNAs of GmLHCa2 to a PSCM vector initiated by the U3 and U6 promoters, thus creating a dual-vector for editing two sgRNAs.

6. The gene editing vector according to claim 4, characterized in that, The two sgRNA sequences are shown in SEQ ID NO.3 and SEQ ID NO.4, and SEQ ID NO.5 and SEQ ID NO.6, respectively.

7. The application of the gene-editing vector according to any one of claims 4-6 in improving soybean yield under short-day conditions, wherein the short-day conditions are defined as day durations of less than 12 hours.

8. The application according to claim 7, characterized in that, The yield traits mentioned include plant height, number of pods per plant, number of seeds per plant, and yield per plant.

Images