Application of elytrigia elongata gene Glu-1Ex in regulating and controlling contents of wheat protein and glutelin

Abstract

The invention discloses an application of an elytrigia elongata gene Glu-1Ex in regulating and controlling the content of wheat protein and glutelin. The nucleotide sequence of the gene Glu-1Ex is as shown in SEQ ID No.1. The invention also discloses an application of the gene Glu-1Ex in regulating and controlling the content of wheat protein and glutelin. According to the invention, an overexpression vector for transforming the agropyron elongatum Glu-1Ex gene is successfully constructed by using a gene overexpression technology, and a strain for overexpressing the Glu-1Ex gene is obtained by using an agrobacterium-mediated wheat immature embryo genetic transformation method. The analysis on the protein content of transgenic wheat proves that the Glu-1Ex gene of elytrigia elongata can improve the protein content and glutelin content of wheat. The technical scheme provided by the invention has important significance for obtaining high-quality wheat new germplasm by utilizing the elytrigia elongata Glu-1Ex gene.

Description

Technical Field

[0001] This invention relates to wheat genetics and breeding, specifically to the long-eared drooping wheatgrass gene. Glu-1Ex Application in regulating wheat protein and gluten content. Background Technology

[0002] Wheat is the world's second-largest grain crop by total production, serving as a vital source of food for humans and animal feed. It can be processed into various foods such as steamed buns, noodles, bread, pastries, and biscuits, meeting the diverse needs of approximately 70% of the global population. However, due to the extensive selection of a few key parent lines in wheat breeding, the genetic background of wheat varieties has become increasingly narrow. Furthermore, researchers have focused on increasing yield over the years, neglecting the simultaneous improvement of quality, which has severely impacted consumer demand for wheat and farmers' income. To better meet people's pursuit of health, nutrition, and deliciousness, cultivating high-quality specialty wheat varieties has become one of the most important tasks in wheat breeding, cultivation, and processing at present.

[0003] The proteins in wheat endosperm are the material basis for wheat to be used to make various foods, and the quality traits of wheat are affected by both the quantity and quality of proteins and their components. High molecular weight glutenin subunits (HMW-GS), as one of the components of wheat protein, although accounting for only 5-10% of all storage proteins in wheat grains, are the main determinants of gluten protein and dough elasticity. The HMW-GS encoding genes in wheat are located at the Glu-1 sites (Glu-A1, Glu-B1, and Glu-D1) on the long arms of chromosomes 1A, 1B, and 1D. The 1Ax or null subunit is encoded by Glu-A1, the 1Bx and 1By subunits by Glu-B1, and the 1Dx and 1Dy subunits by Glu-D1. Typical hexaploid wheat contains six high-molecular-weight glutenin genes (1Ax, 1Ay, 1Bx, 1By, 1Dx, and 1Dy), but due to partial gene silencing, usually only three (1Bx, 1Dx, and 1Dy) to five (1Ax, 1Bx, 1By, 1Dx, and 1Dy) genes are expressed. The genes encoded by 1Ax and 1By are sometimes silenced in hexaploid wheat, while 1Ay is not expressed. Some studies have shown that different subunit combinations contribute differently to quality. For example, wheat with subunit combinations of 1Ax1, 1Ax2*, 1Bx7+1By8, 1Bx13+1By16, 1Bx14+1By15, 1Dx5+1Dy10, and 1Bx17+1By18 exhibits better baking quality. 1Bx7 is often linked to subunits 1By8 or 1By9, with the 1Bx7+1By8 subunit combination significantly improving gluten quality. However, the 1Dx2+1Dy12 and 1Bx7+1By9 subunit combinations have negative effects on bread making. Therefore, identifying more HMW-GS allelic variants can provide different subunit combinations for wheat quality improvement. However, the number of high molecular weight glutenin allelic variants in common wheat is limited. To obtain more superior subunits to improve wheat quality, identifying new superior high molecular weight glutenin subunits from wild wheat relatives is an important direction for wheat quality improvement. Summary of the Invention

[0004] To address the limited number of high-molecular-weight glutenin allelic variant genes in common wheat, this invention provides a long-spike drooping wheatgrass gene. Glu-1Ex Applications in regulating wheat protein and glutenin content: Identification of novel, superior high-molecular-weight glutenin subunits from the wild wheat relative, *Leymus chinensis*. Glu-1Ex It can increase the protein content of wheat and gluten content.

[0005] To achieve the above objectives, the present invention provides a long-spike wheatgrass gene that regulates the content of wheat protein and glutenin. Glu-1Ex Its nucleotide sequence is shown in SEQ ID No. 1.

[0006] SEQ ID No.1:

[0007] A second aspect of the present invention provides a Glu-1Ex protein that regulates the content of wheat protein and glutenin, the amino acid sequence of which is shown in SEQ ID No. 2.

[0008] SEQ ID No. 2: .

[0009] A third aspect of the present invention provides cloning the above-described gene. Glu-1Ex The primers are shown in SEQ ID No. 3 and SEQ ID No. 4.

[0010] SEQ ID No.3: 5'-ATGGCTAACGGC / TTA / GGTCCCTTTG -3'; SEQ ID No. 4: 5'-CTATCACTGGCTA / GGCCGACAATGCG-3'.

[0011] The fourth aspect of the present invention provides a method for identifying the above-mentioned genes. Glu-1Ex The primers are shown in SEQ ID No. 5 and SEQ ID No. 6.

[0012] SEQ ID No.5: 5'-CGCAGCAACTCCAACAAAAA-3'; SEQ ID No.6: 5'- GCGAAGAAGTTGAGTAGTACCCTG-3' The fifth aspect of the present invention provides for overexpression Glu-1Ex Application of genetically modified biomaterials in improving wheat protein content, high molecular weight gluten content and / or yield traits.

[0013] Specifically, yield traits include the number of grains per ear.

[0014] A sixth aspect of the present invention provides a method for increasing wheat protein content, high molecular weight gluten content, and / or yield traits, comprising overexpressing in wheat plants Glu-1Ex The steps involved in constructing transgenic wheat plants using genes; Glu-1Ex The nucleotide sequence of the gene is shown in SEQ ID No. 1.

[0015] Through the above technical solution, the present invention achieves the following beneficial effects: 1. This invention identifies novel and superior high-molecular-weight glutenin subunits from the wild relative of wheat, *Thinopyrum longipedii*. Glu-1Ex By overexpressing this gene, the protein content and high molecular weight gluten content of wheat varieties were significantly increased, thus improving the processing quality of wheat.

[0016] 2. Glu-1Ex Gene overexpression transgenic technology also improved wheat agronomic traits. Attached Figure Description

[0017] Figure 1 It is diploid long-spike wheatgrass Glu-1Ex Results of amino acid sequence analysis encoded by the gene; Figure 2These are the PCR results for the molecular marker CMSGlu-1Ex; where M: DNA Markers; 1: DS1E (1A); 2: DS1E (1B); 3: DS1E (1D); 4: DA1E; 5: Diploid long-spiked wheatgrass (WZ 218); 6: Diploid long-spiked wheatgrass (PI531717); 7: Diploid long-spiked wheatgrass (PI 531718); 8: Chinese Spring; 9: Fielder; 10: Neimai 1505; 11: Taimai 1918; 12: Yumai 9; 13: Yumai 13; 14: Yumai 18; 15: Zhenmai 12; 16: Shannong 23; the arrows indicate the target band. Figure 3 It is diploid long-spike wheatgrass Glu-1Ex A schematic diagram of gene overexpression strategies; where Ubi represents the Ubiquitin promoter; Glu-1Ex express Glu-1Ex Gene; NOS indicates terminator; 35S indicates 35S promoter; Bar indicates glyphosate resistance gene; CaMVpolyA indicates terminator; Figure 4 This is a graph showing the PCR identification results of positive transgenic wheat lines; Fielder represents the wild type and serves as a negative control for the PCR reaction; 2x indicates diploid *Thinopyrum elongatum*. Glu-1Ex Gene fragments were used as positive controls for PCR reactions. Glu-1Ex -OE2、 Glu-1Ex -OE4 and Glu-1Ex -OE7 represents different transgenic plants Figure 5 yes Glu-1Ex Quantitative analysis of relative gene expression levels; Fielder represents the wild type. Glu-1Ex -OE2、 Glu-1Ex -OE4 and Glu-1Ex -OE7 represents different transgenic plants; Figure 6 yes Glu-1Ex Comparison of protein content (a) and gluten content (b) between overexpressed transgenic and wild-type wheat; Fielder is the wild-type control plant. Glu-1Ex -OE2、 Glu-1Ex -OE4 and Glu-1Ex -OE7 represents different transgenic plants; Figure 7 yes Glu-1Ex Comparison of plant height (a), spike length (b), spikelet number (c), grain number per spike (d), and thousand-grain weight (e) between overexpressing transgenic and wild-type wheat; Fielder is the wild-type control plant. Glu-1Ex -OE2、 Glu-1Ex -OE4 and Glu-1Ex-OE7 represents different transgenic plants. Detailed Implementation

[0018] The specific embodiments of the present invention will be described in detail below with reference to examples. It should be understood that the specific embodiments described herein are for illustration and explanation only and are not intended to limit the present invention.

[0019] Example 1: Diploid long-spike wheatgrass Glu-1Ex Gene sequence acquisition and marker development (1) Total RNA was extracted from diploid wheatgrass and cDNA was synthesized. The cDNA was then amplified using degenerate primers P1 / P2. Glu-1Ex Full-length cDNA of the gene; the amplified product was recovered, purified, and sequenced, and compared with the published wheat high molecular weight glutenin sequence (e.g., Figure 1 Based on the analyzed sequence information, Glu-1Ex The molecular marker CMSGlu-1Ex was designed at a location where the gene sequence differs significantly from that of the wheat high molecular weight glutenin subunit gene. The stability and specificity of the marker were validated using the chromosome addition line DA1E, substitution lines DS1E(1A), DS1E(1B), and DS1E(1D) of the Chinese spring-diploid *Thinopyrum longipedii* 1E, diploid *Thinopyrum longipedii*, and cultivated wheat with different types of high molecular weight glutenin subunits. Figure 2 ).

[0020] Degenerate primer P1 sequence: 5'-ATGGCTAAGCGGC / TTA / GGTCCTCTTTG -3'; Degenerate primer P2 sequence: 5'- CTATCACTGGCTA / GGCCGACAATGCG -3'.

[0021] The CMSGlu-1Ex marker sequence is as follows: CMSGlu-1Ex-F: 5'-CGCAGCAACTCCAACAAAAA-3'; CMSGlu-1Ex-R: 5'-GCGAAGAAGTTGAGTAGTACCCTG-3'.

[0022] Example 2: Construction of overexpression vector and wheat genetic transformation (1) Construction of overexpression vector: In this experiment, homologous recombination was used to construct the overexpression vector. Glu-1Ex The coding gene is cloned into an overexpression vector, and its expression is driven by the Ubiquitin promoter (e.g., ...). Figure 3 Ubi stands for Ubiquitin promoter; Glu-1Ex express Glu-1ExGene; TNOS indicates terminator; 35S indicates 35S promoter; Bar indicates glyphosate resistance gene; CaMV polyA indicates terminator. The specific steps are as follows: ①pCE3- Glu-1Ex Construction of recombinant plasmids: The purified plasmids were then... Glu-1Ex Linked with the pCE3 Blunt vector, the recombinant plasmid pCE3- was obtained. Glu-1Ex ; ② Plant expression vector pWMB110- Glu-1Ex Construction: Based on the overexpression vector pWMB110 sequence and Glu- 1Ex Primers for the vector were designed based on the gene ORF sequence: pWMB110Glu-1E-F (5'-GGCCTACTAGGATCCATGGCTAAGCGGCTGGTCATC-3'); pWMB110Glu-1E-R (5'-CTCTGAGCTCGGATCCCTATCACTGGCTGACCGACAATGC-3'). After PCR amplification, plasmid extraction, and homologous recombination, the plant expression recombinant vector pWMB110-Glu-1Ex was obtained. The PCR reaction program was as follows: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 64℃ annealing for 30 s, and 72℃ extension for 2 min 30 s, for a total of 38 cycles. 5 μL of the product was taken and detected by 1% agarose gel electrophoresis.

[0023] The overexpression vector pWMB110 was linearized by single enzyme digestion with BamHI, and then homologous recombination ligation sequencing was performed using the ClonExpress II OneStep Cloning Kit (C112, Nanjing Novizan Biotechnology Co., Ltd.).

[0024] (2) Wheat genetic transformation: using the recombinant expression vector pWMB110- Glu-1Ex Agrobacterium EH105 competent cells were transformed (heat shock method). Immature embryos of Fielder wheat cultivar 15 days after flowering were infected with cultured Agrobacterium for 2 hours, washed in a sterile room, and transferred to selection medium containing 50 mg / L and 5 mg / L glyphosate for 2 weeks. Then, they were transferred to rooting medium (4.4 g MS + 30 g sucrose + 3 g plant gel) and cultured at 22°C for 4 weeks. Rooted wheat seedlings were then transplanted into soil. Single colonies were picked and cultured in LB liquid medium until OD = 1.0. CMSGlu-1Ex markers (F: 5'-CGCAGCAACTCCAACAAAAA-3'; R: 5'-GCGAAGAAGTTGAGTAGTACCCTG-3') were used to identify normally growing plants, ultimately screening for those capable of effectively amplifying diploid *Wheatgrass long-spike*.Glu-1Ex Genetically modified wheat containing gene fragments.

[0025] Example 3: Gene overexpression detection and phenotypic assessment (1) Long-spike wheatgrass Glu-1Ex Genetic testing: DNA was extracted from leaf tissues 3 weeks after planting the transgenic material. PCR amplification was performed on normally growing plants using CMSGlu-1Ex markers for identification. The PCR products were analyzed using agarose gel electrophoresis. The presence of a band approximately 300 bp in the electrophoresis results indicated the presence of *Thinopyrum elongatum*. Glu-1Ex Genes (such as) Figure 4 (Indicated by the middle arrow). Fielder represents the wild type and serves as a negative control for PCR; 2x indicates diploid *Thinopyrum elongatum*. Glu-1Ex Gene fragments were used as positive controls for PCR reactions. Glu-1Ex -OE2、 Glu-1Ex -OE4 and Glu-1Ex -OE7 represents different transgenic plants.

[0026] (2) In genetically modified wheat Glu-1Ex Gene expression level identification: RNA was extracted from leaf tissues and reverse transcribed into cDNA using a kit (HiScript II 1st Strand cDNA Synthesis Kit, R212-01, Vazyme Biotech Co., Ltd.). qPCR was then performed using primers RTGlu-1Ex-F (CGCAGCAACTCCAACAAAAA) and RTGlu-1Ex-R (GCGAAGAAGTTGAGTAGTACCCTG). Glu-1Ex Gene expression analysis; reaction conditions: Step 1: Perform one cycle of initial denaturation step, heating at 95℃ for 5 minutes; Step 2: Perform 40 cycles of PCR amplification step, each cycle including denaturation at 95℃ for 10 seconds, then annealing at 60℃ for 30 seconds, and finally extension at 72℃ for 20 seconds.

[0027] Analysis of transgenic lines Glu-1Ex Gene expression levels, such as Figure 5 As shown, it can be found in transgenic lines Glu-1Ex The expression levels of these genes were thousands of times higher than those in wild-type Fielders; therefore, three genes were selected based on their expression levels. Glu-1Ex Transgenic wheat lines with high gene expression levels were subsequently analyzed for agronomic and quality traits. Fielder served as a wild-type control plant. Glu-1Ex -OE2、 Glu-1Ex -OE4 and Glu-1Ex-OE7 represents different transgenic plants; the experiment was performed in three replicates (Student's t-test; *p<0.05; **p<0.01; ns: no significance).

[0028] (3) These lines were further planted in transgenic fields, and after harvest, the protein content and high molecular weight gluten content of the three overexpression lines and wild-type wheat Fielder were measured. Protein content was determined using a FOSS near-infrared cereal analyzer. High molecular weight gluten content was determined using the biuret method. ① Grind the mature wheat seeds into flour, weigh 1.000g of the sample into a 15ml centrifuge tube, and set aside for later use; ② Albumin extraction: Add 10ml of distilled water to a centrifuge tube containing the sample, stir well, place in a 50℃ water bath shaker for 0.5h, centrifuge at 4000r / min for 20min, transfer the supernatant to a 50ml volumetric flask, repeat twice to combine the supernatants, and dilute with distilled water to 50ml. ③ Globulin extraction: Add 10 ml of 10% NaCl solution to the above residue, and extract and centrifuge as before; ④ Extraction of alcohol-soluble proteins: Add 10 ml of 75% ethanol solution to the above residue, shake in a water bath for 5 min, and then shake in a water bath at room temperature for 30 min. Transfer the supernatant to a 50 ml volumetric flask, repeat twice, combine the supernatants and dilute with 75% ethanol to 50 ml. ⑤ Gluten extraction: Add 10 ml of 0.2% sodium hydroxide solution to the above residue and extract using the same method as albumin; ⑥ Standard Curve Determination: Divide 12 test tubes into two groups and add 0, 0.2, 0.4, 0.6, 0.8, and 1.0 mL of standard bovine serum albumin solution, respectively. Make up the volume to 1 mL with water, then add 4 mL of biuret reagent to each tube. Shake thoroughly and incubate at 60℃ for 5 min. Centrifuge at 4000 rpm for 10 min. Measure the centrifuged solution at 540 nm. The blank is the reagent without bovine serum albumin. Plot the average values ​​of the two groups, with bovine serum albumin content on the x-axis and absorbance on the y-axis, to obtain a standard curve for quantification. Accurately weigh a certain amount of sample, add 5 mL of biuret reagent, shake thoroughly, incubate at 60℃ for 5 min, centrifuge at 4000 rpm for 10 min, and measure the centrifuged solution at 540 nm. The blank is the reagent without bovine serum albumin. ⑦ Result Calculation: Sample protein content = X is the protein content (μg) in the sample solution obtained from the standard curve; W is the sample weight (g); V1 is the sample solution volume used in the determination (mL); V2 is the sample solution volume (mL); 100 is the conversion factor to the protein content in 100g of sample; 10 6 The conversion factor is used to convert g to μg; the experiment was repeated multiple times (Student's t-test; *p<0.05; **p<0.01; ns: no significance).

[0029] Figure 6 yes Glu-1Ex Comparison of protein content (a) and gluten content (b) between overexpressed transgenic and wild-type wheat. Fielder is the wild-type control plant. Glu-1Ex -OE2、 Glu-1Ex -OE4 and Glu-1Ex -OE7. (a) Glu-1Ex Gene overexpression transgenic lines Glu-1Ex -OE2、 Glu-1Ex -OE4 and Glu-1Ex -OE7 has a significantly higher protein content than wild-type wheat Fielder; (b) Glu-1Ex Gene overexpression transgenic lines Glu-1Ex -OE2、 Glu-1Ex -OE4 and Glu-1Ex -OE7 high molecular weight glutenin content is significantly higher than that of wild wheat Fielder.

[0030] (4) When planting materials in the field, regularly investigate and record the agronomic traits of the transgenic materials, such as plant height, spike length, number of spikelets, number of grains per spike, and thousand-grain weight (e.g., ...). Figure 7 ). Glu-1Ex Comparison of plant height (a), spike length (b), spikelet number (c), grain number per spike (d), and thousand-grain weight (e) between overexpressed transgenic and wild-type wheat. Fielder is the wild-type control plant. Glu-1Ex -OE2、 Glu- 1Ex -OE4 and Glu-1Ex -OE7 represents different transgenic plants. After statistical analysis of agronomic traits, (a) Glu-1Ex (b) The plant height of gene-overexpressing lines was reduced; Glu- The spike length of the gene-overexpressing lines did not change significantly; (c) 1Ex The number of spikelets in the gene-overexpressing lines did not change significantly; (d) Glu-1Ex Gene overexpression lines showed increased grain number per ear; (d) Glu-1ExNo significant change was observed in the thousand-grain weight of the gene-overexpressing lines (Student's t-test; *p<0.05; **p<0.01; ns: no significance).

[0031] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

[0032] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not describe the various possible combinations separately.

[0033] Furthermore, various different embodiments of the present invention can be combined in any way, as long as they do not violate the spirit of the present invention, they should also be regarded as the content disclosed by the present invention.

Claims

1. A gene from *Thinopyrum elongatum* that regulates wheat protein and gluten content. Glu-1Ex Its characteristics are, The nucleotide sequence is shown in SEQ ID No.

1.

2. A Glu-1Ex protein that regulates the content of wheat protein and gluten, characterized in that, The amino acid sequence is shown in SEQ ID No.

2.

3. Cloning the gene according to claim 1 Glu-1Ex The primers, characterized in that, As shown in SEQ ID No. 3 and SEQ ID No.

4.

4. For identifying the gene described in claim 1 Glu-1Ex The primers, characterized in that, As shown in SEQ ID No. 5 and SEQ ID No.

6.

5. A method for overexpressing the expression described in claim 1 Glu-1Ex Application of genetically modified biomaterials in improving wheat protein content, high molecular weight gluten content and / or yield traits.

6. The application according to claim 5, characterized in that, Yield traits include the number of grains per ear.

7. A method for improving wheat protein content, high molecular weight glutenin content, and / or yield traits, characterized in that, Including overexpression in wheat plants Glu-1Ex Genes, the steps to construct transgenic wheat plants; The Glu-1Ex The nucleotide sequence of the gene is shown in SEQ ID No. 1.

Images