Application of inhibiting expression of Dof transcription factor in relieving growth inhibition of loquat seedlings under salt stress

By inhibiting the expression of the Dof transcription factor Ej00082232 through genetic engineering and pre-drenching with melatonin, the problem of growth inhibition in loquat seedlings under salt stress was solved, the photosynthesis and antioxidant capacity of loquat were enhanced, and its normal growth was promoted, providing a theoretical basis for loquat breeding.

CN121109463APending Publication Date: 2025-12-12SOUTHWEST FORESTRY UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511283127.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-09
Publication Date
2025-12-12

AI Technical Summary

Technical Problem

Salt stress inhibits the growth of loquat seedlings, leading to a decrease in chlorophyll content and an increase in MDA content, thus affecting the normal growth and yield of loquat.

Method used

By inhibiting the expression of the Dof transcription factor Ej00082232 through genetic engineering, and using RNAi, VIGS, or CRISPRi technologies, combined with pre-treatment of loquat seedlings with 100 μmol/L melatonin solution through root irrigation, gene expression was regulated to enhance antioxidant enzyme activity and alleviate salt stress.

Benefits of technology

It significantly improved the photosynthetic and antioxidant capacity of loquat seedlings under salt stress, inhibited carbohydrate metabolism and amino acid metabolism, promoted the normal growth of loquat seedlings, and provided a theoretical basis for molecular marker-assisted breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121109463A_ABST
    Figure CN121109463A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of agricultural biology, particularly relates to application of inhibiting expression of a Dof transcription factor in inhibiting growth of loquat seedlings under salt stress, and particularly provides a Dof transcription factor Ej00082232 with a nucleotide sequence as shown in SEQ ID NO: 1. As a core switch for regulating and controlling a salt stress response gene network, the transcription factor has a key application value in loquat salt-tolerant variety breeding, by marking the transcription factor Ej00082232 and utilizing molecular marker-assisted selective breeding, not only can the traditional breeding period be shortened, but also the germplasm bottleneck of salinized land cultivation can be broken through, and the application prospect is broad. Or the expression of a Dof transcription factor (Ej00082232) is inhibited by adopting a genetic engineering technology, salt-stress-resistant germplasm resources are cultivated, and a theoretical basis is laid for carrying out salt-resistant breeding of loquat.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of agricultural biotechnology, specifically relating to the application of inhibiting the expression of the Dof transcription factor in alleviating the growth inhibition of loquat seedlings under salt stress. Background Technology

[0002] Loquat (Eriobotrya japonica) belongs to the genus Eriobotrya in the family Rosaceae. Eriobotrya Loquat is an evergreen tree, a very popular fruit and medicinal plant. Through long-term domestication and breeding, loquat has shown good adaptability to climate and many cultivation factors. However, with the rapid expansion of loquat planting areas and the accelerating rate of ecological degradation, various abiotic stresses such as drought, soil salinization, and excessive soil metal ion content have caused huge losses to the global loquat industry. In particular, in recent years, improper irrigation methods, water use, and secondary salinization caused by deforestation have become increasingly serious, and soil salinization has become one of the important environmental factors affecting the normal growth of loquat. Due to the impact of soil salinization, a series of problems have emerged, such as significantly reduced fruit quality and severe water shortage, resulting in a severe reduction in global loquat production. Salt stress can cause irreversible toxicity to loquat plants. Saline-alkali soils contain high concentrations of Na+ and Cl-, causing severe osmotic and ion stress to plants, hindering their absorption of water and nutrients from the soil. Simultaneously, high salt concentrations can lead to a surge in reactive oxygen species (ROS) within the plant, further causing DNA, RNA, and protein degradation or denaturation, impairing normal cell function, and ultimately resulting in stunted growth and even death. Therefore, improving the salt tolerance of loquat trees has become one of the crucial obstacles to the high-quality development of the loquat industry.

[0003] Salt-tolerant variety breeding is one of the main methods to improve salt stress in loquat. Numerous studies have found that wild loquat species face severe genetic bottlenecks during domestication, resulting in a very narrow genetic base for cultivated loquat populations. This invention aims to investigate the effects of exogenous melatonin on the physiological metabolism of loquat plants under salt stress. Transcriptome analysis will be used to explore the regulatory mechanism of exogenous melatonin in enhancing NaCl stress resistance in loquat seedlings, and to further uncover key genes and important pathways through which melatonin alleviates salt stress, providing a theoretical basis and practical evidence for the genetic improvement of salt tolerance in loquat. Summary of the Invention

[0004] This invention mainly provides an application of inhibiting Dof transcription factor expression in alleviating growth inhibition in loquat seedlings under salt stress, in order to solve the problems existing in the background art. Specifically, this invention provides the following technical solution: This invention provides an application of inhibiting the expression of transcription factor Ej00082232 through genetic engineering technology in alleviating the growth inhibition of loquat seedlings under salt stress. The nucleotide sequence of the transcription factor Ej00082232 is shown in SEQ ID NO: 1.

[0005] Furthermore, the genetic engineering techniques include RNAi, VIGS, or CRISPRi technologies.

[0006] Furthermore, the present invention provides the application of a substance prepared by genetic engineering technology that inhibits the expression of transcription factor Ej00082232 in alleviating the growth inhibition of loquat seedlings under salt stress. The nucleotide sequence of the transcription factor Ej00082232 is shown in SEQ ID NO: 1, and the substance includes dsRNA, shRNA or miRNA.

[0007] Furthermore, this invention provides the application of transcription factor Ej00082232 as a molecular marker in marker-assisted breeding of salt-stress resistant loquat. The nucleotide sequence of the transcription factor Ej00082232 is shown in SEQ ID NO: 1. When the base at position 273 of the sequence shown in SEQ ID NO: 1 is G or C, salt-tolerant loquat plants are obtained by screening.

[0008] Furthermore, the present invention provides a method for rapidly screening salt-resistant loquat seedlings by detecting the genotype of transcription factor Ej00082232, the nucleotide sequence of which is shown in SEQ ID NO: 1. When the base at position 273 of the sequence shown in SEQ ID NO: 1 is G or C, salt-tolerant loquat plants are obtained by screening.

[0009] Furthermore, the present invention provides an application of a kit for screening or assisting in the screening of salt-tolerant loquat seedlings. The kit contains a reagent for detecting the genotype of transcription factor Ej00082232. The nucleotide sequence of the transcription factor is shown in SEQ ID NO: 1. When the base at position 273 of the sequence shown in SEQ ID NO: 1 is G or C, salt-tolerant loquat plants are obtained through screening.

[0010] Furthermore, the kit contains the primer pairs shown in SEQ ID NO: 2 and SEQ ID NO: 3.

[0011] Furthermore, a method for alleviating the growth inhibition of loquat by salt stress involves drenching loquat seedlings with a 100 μmol / L melatonin solution before transplanting.

[0012] The technical effects achieved by this invention are as follows: Salt stress significantly inhibits the normal growth of loquat, leading to a significant decrease in chlorophyll content and a significant increase in malondialdehyde (MDA) content. However, pre-drenching the roots with a 100 μmol / L melatonin solution can effectively alleviate the inhibitory effect of salt stress on loquat growth, significantly increase the activity of antioxidant enzymes in loquat seedlings under salt stress, and effectively reduce the oxidative damage caused by salt stress. Transcription factors (TFs) play a crucial role in the process of melatonin alleviating salt stress in loquat seedlings. Dof transcription factor (Ej00082232) is a negative regulator of plant photosynthesis and a positive regulator of carbohydrate metabolism and amino acid metabolism. Pre-treatment with melatonin significantly inhibited the expression of Dof transcription factor (Ej00082232) in loquat seedlings under salt stress, enhanced photosynthesis in loquat under salt stress, and inhibited carbohydrate metabolism and amino acid metabolism, thereby helping loquat seedlings alleviate salt stress and ensure their normal growth.

[0013] Transcription factors, as core switches regulating the gene network of salt stress response, have key application value in the breeding of salt-tolerant loquat varieties. This study provides a theoretical basis for how to effectively alleviate salt stress in loquat in production practice. The key transcription factor Dof (Ej00082232) provided in this invention can be used for molecular marker-assisted selection breeding, which can shorten the traditional breeding cycle and break through the germplasm bottleneck of saline-alkali land cultivation. Alternatively, genetic engineering technology can be used to inhibit the expression of Dof (Ej00082232) to cultivate germplasm resources resistant to salt stress, laying a theoretical foundation for carrying out salt-tolerant breeding of loquat. Attached Figure Description

[0014] Figure 1 The effect of root irrigation with 100 μmol / L melatonin solution on alleviating salt stress in loquat seedlings; Figure 2 Effects of melatonin treatment on gene expression levels in loquat seedlings under salt stress. (a) PCA score of transcriptome samples, different colors represent different experimental groups, three different groups. (b) Statistical analysis of the number of genes at each expression level within different experimental groups, different colors represent the number of genes at different expression levels. (c) Overlap of expressed genes in different experimental groups. This invention uses 0.1 as the threshold for determining gene expression. TPM ≤ 0.1 indicates unexpressed genes; 0.1 < TPM ≤ 1 indicates low-abundance expressed genes; 1 < TPM ≤ 10 indicates medium-abundance expressed genes; TPM > 10 indicates high-abundance expressed genes. The number of expressed genes was statistically analyzed based on the mean TPM of the three replicates for each experimental group.

[0015] Figure 3A graph showing the differential gene expression analysis of loquat seedlings under salt stress induced by melatonin treatment. Statistics on the number of significantly differentially expressed genes in different comparison groups; Figure 4 Figure showing the overlap of differentially expressed genes in different comparison groups; Figure 5 Expression patterns of all differentially expressed genes in the three comparison groups, along with annotations and enrichment analysis of the GO and KEGG pathways. Figure 5 In the diagram, from left to right, the first column (C1-C6) represents the six major clusters analyzed by the MFUZZ method based on expression patterns; the second column contains six box plots showing the overall changes in all genes within each cluster; the third column is a heatmap of gene expression profiles in different experimental groups; the fourth and fifth columns are the GO enrichment analysis results for genes in each cluster. In the fourth column, the larger the font size of the GO entry name, the closer the FDR is to 0.05. The three different colors represent the three categories of GO: green for BP, orange for MF, and blue for CC. The bar chart in the fifth column represents the number of genes enriched in each entry; the sixth and seventh columns are the KEGG enrichment analysis results for genes in each cluster, with similar meanings to the GO enrichment results.

[0016] Figure 6 A diagram illustrating the transcription factors that may be regulated by melatonin in loquat seedling leaves under salt stress. The diagram shows the number of different families of transcription factors that may be regulated by melatonin in loquat seedling leaves under salt stress. Figure 7 This diagram shows 75 possible regulatory relationships between 13 key transcription factors and 44 key functional genes. Different colors represent different gene types. Red represents transcription factors, and solid circles in yellow, green, and blue represent key genes in the three metabolic pathways of amino acid metabolism, photosynthesis, and carbohydrate metabolism, respectively. The decrease in the size of the solid circles and the lightening of the color indicate that the regulatory relationships at that node gradually decrease. Figure 8 The expression profiles of 144 differentially expressed transcription factors were found in the two comparison groups, ST vs CK and MTST2 vs ST. Figure 9 This is a correlation plot of expression levels of 75 pairs of transcription factor genes and key functional genes that may have regulatory relationships. The vertical axis represents functional genes, and the horizontal axis represents transcription factors. Different colors on the vertical axis represent key genes from different metabolisms. The number of * indicates the significance of the correlation, *** represents p<0.001, ** represents p<0.01, and * represents p<0.05. Detailed Implementation

[0017] The following will describe the concept and technical effects of this application clearly and completely with reference to embodiments, so as to fully understand the purpose, features and effects of this application. The sequence of transcription factor Ej00082232 provided by this invention is shown in SEQ ID NO: 1.

[0018] Example 1 1. Materials and Methods 1.1 Plant materials and growing conditions The loquat seedlings used in this invention ('Da Wuxing' loquat) are asexual seedlings obtained by the research group through tissue culture propagation. After growing to about 5cm in the tissue culture bottle, the seedlings are hardened off and transplanted into a mixed substrate of equal volume of peat moss and vermiculite to continue growing. Three loquat tissue culture seedlings are transplanted into each pot. After 15 days, the pots with all three loquat seedlings have survived are moved to a greenhouse for rain protection and cultivation.

[0019] 1.2 Salt stress and melatonin treatment After one month of rain-sheltered cultivation, 60 loquat seedlings with uniform growth were selected for subsequent treatment. The treatment process consisted of the following two steps: First, the 60 loquat seedlings with uniform growth were divided into 5 groups. Three groups were root-irrigated with 250 mL of MT solution with concentrations of 50, 100, and 150 μmol / L, respectively, while the other two groups were root-irrigated with 250 mL of ultrapure water, once a day for 5 consecutive days. Second, one group of loquat seedlings that received ultrapure water was selected and continued to be irrigated with ultrapure water every 3 days as a blank control; the remaining 4 groups of loquat seedlings were irrigated with a 200 mmol / L NaCl solution every 3 days as the salt stress treatment group. The six treatments with different irrigation solutions were labeled CK, ST, MTST1, MTST2, and MTST3, as follows: (1) Irrigation with ultrapure water continuously, denoted as CK; (2) Irrigation with 200 mmol / L NaCl solution 5 days after irrigating with ultrapure water, denoted as ST; (3) Irrigation with 50 μmol / L melatonin solution 5 days after irrigating with 200 mmol / L NaCl solution, denoted as MTST1; (4) Irrigation with 100 μmol / L melatonin solution 5 days after irrigating with 200 mmol / L NaCl solution, denoted as MTST2; (5) Irrigation with 150 μmol / L melatonin solution 5 days after irrigating with 200 mmol / L NaCl solution, denoted as MTST3. Each treatment consisted of 10 pots, with 3 seedlings per pot. On the 10th day after treatment, various growth indicators of loquat plants under different treatments were observed. Young leaves from the loquat plants were cut, rapidly frozen in liquid nitrogen, and stored at -80°C for subsequent physiological indicators and transcriptome sequencing. The salt concentration and treatment time used in this invention were set based on preliminary experimental results. For sampling and growth indicator observation, three seedlings were randomly selected from each of the five different treatment groups, and leaves from nine loquat seedlings were collected, mixed, and then divided into three biological replicates.

[0020] 1.3 Transcriptome Sequencing Analysis Based on the physiological and morphological indicators of loquat seedlings under different treatments, the optimal melatonin concentration was determined. The plant samples that were subjected to salt stress treatment after being irrigated with the melatonin solution of this concentration in advance were used for subsequent transcriptome sequencing analysis. This group of samples was renamed MTST.

[0021] After extracting total RNA from the samples using the Servicebio® Plant RNA Kit R1027, mRNA was enriched using Oligo(dT) magnetic beads. Then, the mRNA was fragmented into short fragments using an ion fragmentation method. cDNA sequencing libraries were constructed using the RNA as templates, and the libraries were quality checked. Libraries that passed the quality check were sequenced using Illumina HiSeq™.

[0022] After sequencing, to avoid the inclusion of numerous adapters and low-quality data in the transcriptome data, we first used the FastP software (https: / / github.com / OpenGene / fastp) to remove adapters and filter low-quality data from the raw data. We then performed quality checks using FastAQC to ensure that the Q-value of all transcriptome data was greater than 30. Next, we used Hisat2 to map the quality-controlled transcript reads onto the reference genome. Finally, we used the FeatureCounts program in Rsubread software to statistically analyze the reads mapped to the reference genome and quantify the expression level of each gene. Considering the impact of sequencing depth and gene length on read counts, we selected the most commonly used gene expression normalization method for estimating gene expression levels to calculate the TPM value for each gene.

[0023] This invention also used the Deseq2 package to identify differentially expressed genes based on transcriptome sequencing. Genes with Fold Change > 2 were defined as differentially expressed genes, and genes with Fold Change > 2 and FDR < 0.05 were defined as differentially expressed genes. To further understand the functions of differentially expressed genes under salt stress, functional and metabolic pathway annotation enrichment analyses were performed on the identified differentially expressed genes using databases such as GO and KEGG.

[0024] 2. Results 2.1 Determination of the optimal melatonin solution concentration for alleviating salt stress in loquat seedlings A comprehensive evaluation of the phenotypic and physiological indicators of loquat seedlings under salt stress treated with melatonin solutions of 50, 100, and 150 μmol / L showed that pre-drenching with 100 μmol / L melatonin solution had the best effect on alleviating salt stress in loquat seedlings (e.g., ...). Figure 1 As shown in the figure, this treatment group was used for subsequent transcriptome sequencing analysis.

[0025] 2.2 Transcriptome sequencing analysis of loquat seedling leaves 2.2.1 Transcriptome characteristics of loquat seedlings under different treatments To further investigate the mechanism by which melatonin alleviates salt stress in loquat seedlings, we performed transcriptome sequencing analysis on leaves from loquat seedlings under normal growth conditions (CK), salt stress treatment (ST), and pre-treatment with 100 μmol / L melatonin solution followed by salt stress treatment (MTST2). The results showed that sequencing of the nine samples yielded 51.34 Gb of raw bases containing 339,982,682 raw reads, of which over 94% had a base quality greater than Q30. After further filtering to remove reads with adapters or an average quality fraction lower than Q20, 332,238,148 clean reads were obtained. Aligning these high-quality reads to the loquat genome, over 95% of the clean reads successfully aligned to the reference gene, with over 96% of the clean reads containing only one alignment site. Based on the alignment results and basic information of each gene, reads aligned to each gene were counted. The most commonly used gene expression level normalization method for estimating gene expression levels was selected, taking into account the influence of sequencing depth and gene length on read counts, and the TPM value for each gene was calculated. Based on the gene TPM values, principal component analysis (PCA) was performed on each sample. The results showed (e.g.) Figure 2 As shown in (a), the contribution rates of the two principal components (PC1 and PC2) were 78.35% and 12.68%, respectively. All three biological replicates under the same treatment formed a relatively dense population, while the distribution among different treatments showed obvious dispersion. In summary, the transcriptome data obtained by RNA-Seq sequencing in this invention are of extremely high quality, and the samples within each treatment group have good reproducibility, which can be used for further analysis.

[0026] 2.2.2 Gene expression in loquat seedlings under different treatments We further analyzed the quantitative results of expression (such as...) Figure 2(b, c) revealed that 13,982 genes (approximately 32% of the total genome) in the loquat genome were not expressed under any of the three treatments, 26,136 genes were expressed under all three treatments, and 2,168 genes were expressed only in one treatment group. Among these, 1,365 genes were expressed only in the ST group, 420 genes were expressed only in the MTST2 group, and 383 genes were expressed only in the CK group. The loquat seedlings subjected only to salt stress (ST) had the highest number of expressed genes and the largest proportion of highly expressed genes. The number of expressed genes was comparable in loquat seedlings under normal growth conditions (CK) and those subjected to pre-treatment root irrigation with melatonin solution followed by salt stress (MTST2), but the number of highly expressed genes was slightly higher in the MTST2 group than in the CK group. Overall, there were significant differences in the transcriptomes of loquat seedlings under the three different treatments. Compared to normal conditions, loquat seedlings upregulated the expression of a large number of genes in order to cope with salt stress. However, when loquat seedlings treated with melatonin in advance were subjected to salt stress again, the expression of some genes was suppressed. This suggests that melatonin may help loquat seedlings resist salt stress by regulating the expression of some genes.

[0027] 2.2.3 Identification and Analysis of Differentially Expressed Genes To investigate which genes melatonin specifically regulates to alleviate salt stress in loquat seedlings, we used the DESeq2R package to analyze pairwise gene expression differences between CK, ST, and MTST2 treatments, and calculated the fold change for each gene. The results showed (e.g.) Figure 3 As shown in the figure, a total of 6063 genes showed significant differences in expression among different treatments. Specifically, in the ST group compared to the CK group, 4623 genes were differentially expressed, with 2655 significantly upregulated and 1968 significantly downregulated. In the MTST2 group compared to the ST group, 2449 genes were differentially expressed, with 685 significantly upregulated and 1764 significantly downregulated. In the MTST2 group compared to the CK group, 2686 genes were differentially expressed, with 1323 significantly upregulated and 1363 significantly downregulated. In summary, under normal growth conditions, the number of differentially expressed genes induced in loquat seedlings subjected to salt stress (ST vs CK) was significantly higher than that in loquat seedlings subjected to pre-treatment with 100 μmol / L melatonin solution (MTST2 vs ST) under salt stress. This suggests that pre-treatment with melatonin may regulate the expression of some genes in loquat seedlings, enhancing their salt stress tolerance. When subjected to salt stress again, the stress response was significantly lower than that of loquat seedlings under normal growth conditions.

[0028] Based on the differential gene identification results, we statistically analyzed the common and unique DEGs among the groups. The results showed (e.g.) Figure 5 , 6As shown in the figure, compared with the control group (CK), 1343 genes showed significant differences in expression between ST and MTST2; 413 genes showed significant differences in expression levels between any two groups in CK, ST, and MTST2; 1250 genes showed differential expression in both CK and MTST2 compared to ST; and the number of genes showing significant differences in expression only in the three comparison groups of ST vs CK, MTST2 vs ST, and MTST2 vs CK were 1617, 510, and 654, respectively. Based on the number of differentially expressed genes in ST vs CK and MTST2 vs CK, pre-treatment with melatonin significantly affected the expression of some genes in loquat seedlings under salt stress, further demonstrating that melatonin can help loquat seedlings alleviate salt stress by regulating gene expression.

[0029] 2.3 Key transcription factors in loquat seedlings' process of alleviating salt stress Transcription factors are core components of gene regulatory networks. Transcription factors (TFs) regulate gene expression by binding to specific sequences on DNA. To investigate which transcription factors play a role in melatonin's role in alleviating salt stress in loquat seedlings, we used reciprocal BLAST based on the Plant Transcription Factor Database to annotate 1663 differentially expressed genes in the ST vs CK and MTST2 vs ST comparison groups. Of these, 144 genes were annotated as transcription factor genes. We then statistically analyzed the top 10 families (e.g., ...). Figure 7 As shown in the figure, among the 144 differentially expressed transcription factor genes, most transcription factors belonged to the ERF, MYB, WRKY, bHLH, NAC, and HD-ZIP transcription factor families, with the following percentages: 18.06%, 12.50%, 11.11%, 10.42%, 8.33%, and 5.56%, respectively. Further expression pattern analysis revealed that (as shown in the figure)... Figure 8 As shown), most (112) of the 144 differentially expressed transcription factor genes were significantly upregulated in the ST vs CK group, but significantly downregulated in the MTST2 vs ST group. 30 transcription factor genes were significantly downregulated in the ST vs CK group, but significantly upregulated in the MTST2 vs ST group, with only one (…) Ej00095568, NAC These TF (Transcription Factor) genes were upregulated in both the ST vs CK and MTST2 vs ST groups. In conclusion, we hypothesize that these TF genes may play a crucial role in the process by which melatonin alleviates salt stress in loquat seedlings.

[0030] To investigate which specific transcription factors regulate the expression of key genes, we used the PlantTF Binding Motif Shift tool in TBtools software to extract conserved motifs of all gene binding sites in 144 transcription factor genes. Simultaneously, we extracted 2000 bp promoter region sequences from 57 key functional genes. Based on the transcription factor binding site motif sequences and the upstream 2000 bp promoter region sequences of key functional genes, we further used Find Individual Motif Occurences (FIMO) to predict the regulatory relationships of transcription factors on key functional genes. A q-value ≤ 0.01 was used as the threshold, and other parameters were left as default. The results showed (e.g.) Figure 9 As shown in the figure, there may be regulatory relationships between 13 transcription factors and 44 key functional genes. The 13 transcription factors come from five transcription factor families: Dof (containing two genes, Ej00082232 and Ej00025314), MYB (Ej00016810), G2-like (Ej00044110), CPP (Ej00040221), and ERF (containing eight genes, Ej00039583, Ej00041246, Ej00005906, Ej00052655, Ej00040554, Ej00001370, Ej00011929, and Ej00043603). The 44 key functional genes include 9 amino acid metabolism-related genes, 14 photosynthesis-related genes, and 21 sugar metabolism-related genes. Notably, the results also indicate that both Dof transcription factors can bind to the promoter regions of multiple genes, with Ej00082232 exhibiting regulatory relationships with 41 genes. All eight ERF transcription factors showed regulatory relationships with AMY, and except for Ej00041246 and Ej00039583, the remaining six ERF transcription factors each had a regulatory relationship with only one AMY gene. The MYB (Ej00016810) and G2-like (Ej00044110) transcription factors also each had a regulatory relationship with only one amino acid metabolism-related gene. In summary, multiple pieces of evidence suggest that the Dof and ERF families may be two core transcription factor families involved in melatonin's role in alleviating salt stress in loquat seedlings. ERF transcription factors may primarily play a crucial role in the transcriptional regulation of amylase genes in sugar metabolism, while Dof transcription factors simultaneously participate in the regulation of carbohydrate metabolism, amino acid metabolism, and the transcriptional regulation of photosynthesis-related genes.

[0031] Numerous studies have shown that the expression levels of mutually regulated transcription factors and functional genes exhibit significant correlations. To further confirm the regulatory roles of five classes of transcription factors—Dof, G2-like, CPP, ERF, and MYB—on 44 functional genes, we further analyzed the correlation between the expression levels of mutually regulated transcription factors and functional genes. The results showed that nearly 40% of the mutually regulated transcription factors and functional genes showed a correlation of 0.9 or higher, indicating a significant correlation. This further demonstrates that Dof, G2-like, CPP, ERF, and MYB transcription factors are involved in the transcriptional regulation of key genes in carbohydrate metabolism, amino acid metabolism, and photosynthesis in loquat seedlings. Notably, we also found that among the 41 functional genes that have a regulatory relationship with Dof transcription factor (Ej00082232), nearly 80% (29 genes) showed a correlation greater than 0.8 between their expression levels and Dof transcription factor (Ej00082232) expression levels. More interestingly, among these genes, the expression levels of all key genes in photosynthesis showed a significant negative correlation with Dof transcription factor (Ej00082232) expression levels, while key genes in carbohydrate metabolism and amino acid metabolism showed a positive correlation. Therefore, we hypothesize that Dof transcription factor (Ej00082232) may be a negative regulator of plant photosynthesis, or a positive regulator of carbohydrate metabolism and amino acid metabolism.

[0032] Further analysis of expression pattern changes revealed that, compared to loquat seedlings under normal growth conditions, this transcription factor was significantly upregulated in loquat seedlings treated only with salt stress, while key genes interacting with it in photosynthesis were significantly downregulated, and key genes interacting with it in carbohydrate metabolism and amino acid metabolism were significantly upregulated. Conversely, in loquat seedlings treated with melatonin beforehand, this transcription factor was significantly downregulated in salt-stressed seedlings, while key genes interacting with it in photosynthesis were significantly upregulated, and key genes interacting with it in carbohydrate metabolism and amino acid metabolism showed both significant up- and down-regulation. These results further demonstrate that the Dof transcription factor (Ej00082232) may be a negative regulator of plant photosynthesis and a positive regulator of carbohydrate metabolism and amino acid metabolism. This also suggests that melatonin may help loquat seedlings alleviate salt stress by inhibiting the expression of Dof transcription factors, suppressing the expression of amino acid metabolism-related genes and sugar metabolism-related genes, and promoting the expression of key functional genes of photosynthesis.

[0033] Further analysis of the DoF transcription factor (Ej00082232) revealed a single nucleotide polymorphism (SNP) at position 273 of the nucleotide sequence (SEQ ID NO: 1) in different strains. In salt-intolerant strains, this position contained the base A, while in salt-tolerant strains, it contained either G or C. Specific primers were used to examine this position to determine whether the strain was salt-tolerant. The specific SCAR (Sequence-Specific Region) marker primers were as follows: Forward: CCATCCTGCTCTTCCTCCT, Reverse: CTCTCGTTCAGGTCCATCAG, Tm = 57℃. Strains that amplified the SCAR using these primers were salt-intolerant, while those that did not were salt-tolerant. Thirty loquat seedlings in the field were sampled for SCAR marker amplification in transcription factor Ej00082232. Seedlings with the A-selection site were selected and irrigated with 200 mmol / L NaCl solution, along with other seedlings. An ultrapure water control group was also included. Irrigation was performed every 3 days. On the 10th day after treatment, various growth indicators of the loquat seedlings under different treatments were observed. Although the root and stem growth of the 11 loquat seedlings with the A-selection site increased to some extent under salt stress, their leaf growth was severely inhibited compared with normally growing loquat seedlings. The leaf water content and chlorophyll content decreased by about 20%, and the growth of the loquat seedlings was significantly inhibited, significantly lower than that of normally growing loquat seedlings (P<0.05). Compared with normally growing loquat seedlings, the root, stem, and leaf growth of the other 19 loquat seedlings under salt stress was relatively slow, but there was no significant difference (P<0.05). The leaf water content and chlorophyll content of the loquat seedlings decreased by about 5%. In summary, transcription factor Ej00082232 can be used as a molecular marker in marker-assisted breeding of salt-tolerant loquat to help quickly screen salt-tolerant plants.

[0034] In summary, salt stress significantly inhibits the normal growth of loquat, leading to a significant decrease in chlorophyll content and a significant increase in malondialdehyde (MDA) content. Transcription factors play a crucial role in alleviating salt stress in loquat seedlings. This invention is the first to discover that the Dof transcription factor (Ej00082232) is a negative regulator of plant photosynthesis and a positive regulator of carbohydrate metabolism and amino acid metabolism. Inhibiting the expression of Dof transcription factor (Ej00082232) in loquat seedlings enhances photosynthesis under salt stress, inhibits carbohydrate metabolism and amino acid metabolism, thereby helping loquat seedlings alleviate salt stress and ensure their normal growth. Salt stress has become one of the major abiotic stresses limiting global plant growth and crop yield. This invention proposes a technical solution to help loquat seedlings alleviate salt stress. Transcription factors, as core switches regulating the gene network of salt stress response, have key application value in the breeding of salt-tolerant loquat varieties. This study provides a theoretical basis for how to effectively alleviate salt stress in loquat in production practice. The key transcription factor Dof (Ej00082232) provided in this invention can be used for molecular marker-assisted selection breeding, which can shorten the traditional breeding cycle and break through the germplasm bottleneck of saline-alkali land cultivation. Alternatively, genetic engineering technology can be used to inhibit the expression of Dof (Ej00082232) to cultivate germplasm resources resistant to salt stress, laying a theoretical foundation for carrying out salt-tolerant breeding of loquat.

Claims

1. The application of inhibiting the expression of transcription factor Ej00082232 by genetic engineering technology in relieving the growth inhibition of loquat seedlings under salt stress, characterized in that, The nucleotide sequence of the transcription factor Ej00082232 is shown as SEQ ID NO:

1.

2. Use according to claim 1, characterized in that, The genetic engineering technology includes RNAi, VIGS or CRISPRi technology.

3. The application of a substance prepared by genetic engineering technology to inhibit the expression of transcription factor Ej00082232 in relieving the growth inhibition of loquat seedlings under salt stress, characterized in that, The nucleotide sequence of the transcription factor Ej00082232 is shown as SEQ ID NO: 1, and the substance includes dsRNA, shRNA or miRNA.

4. Application of transcription factor Ej00082232 as a molecular marker in marker-assisted breeding of loquat resistant to salt stress, characterized in that, The nucleotide sequence of the transcription factor Ej00082232 is shown as SEQ ID NO: 1, and when the base at the 273th position of the sequence shown as SEQ ID NO: 1 is G or C, a salt-tolerant loquat plant is screened.

5. A method for rapid screening of salt stress tolerant loquat seedlings, characterized in that, The genotype of the transcription factor Ej00082232 is detected, the nucleotide sequence of the transcription factor is shown as SEQ ID NO: 1, and when the base at the 273th position of the sequence shown as SEQ ID NO: 1 is G or C, a salt-tolerant loquat plant is screened.

6. Use of a kit for screening or aiding in screening of anti-salt stress in young seedlings of Pyrus pyrifolia, characterized in that, The kit contains reagents for detecting the genotype of the transcription factor Ej00082232, the nucleotide sequence of the transcription factor is shown as SEQ ID NO: 1, and when the base at the 273th position of the sequence shown as SEQ ID NO: 1 is G or C, a salt-tolerant loquat plant is screened.

7. Use according to claim 6, characterized in that, The kit contains the primer pair shown as SEQ ID NO: 2 and SEQ ID NO:

3.

8. A method for alleviating the growth inhibition of loquat by salt stress, characterized in that, The method is to root irrigate 100 μmol / L melatonin solution in advance before the loquat seedlings are transplanted.