Application of GmVAP27-3 gene in regulation and control of protein content of soybean seeds or regulation and control of oil content of soybean seeds
By applying the GmVAP27-3A and GmVAP27-3B genes to soybeans, combined with CRISPR/Cas9 gene editing and Agrobacterium-mediated genetic transformation, the protein and oil content of soybean seeds was regulated, solving the problem of improving soybean quality in existing technologies and achieving an increase in the protein content and a decrease in the oil content of soybean seeds.
Patent Information
- Application Number
- CN202511370386.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-24
- Publication Date
- 2025-12-12
- Estimated Expiration
- 2045-09-24
AI Technical Summary
Existing technologies are insufficient to effectively regulate the protein and oil content of soybean seeds, which affects the improvement of soybean quality. Furthermore, soybeans are sensitive to environmental conditions and lack scientific genetic improvement strategies.
Using the GmVAP27-3A and GmVAP27-3B genes, gene editing was performed in soybeans using CRISPR/Cas9 gene editing technology to regulate the protein and oil content of soybean seeds. Combined with Agrobacterium-mediated genetic transformation, mutants and overexpression plants were constructed.
It significantly increased the protein content of soybean seeds, reduced the oil content, and regulated soybean plant height and seed size, thereby improving soybean quality.
Smart Images

Figure CN121109475A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of soybean quality technology, specifically involving the application of the GmVAP27-3 gene in regulating the protein content or oil content of soybean seeds. Background Technology
[0002] Soybeans originated in China and were widely cultivated in the Yellow River basin as early as the Shang and Zhou dynasties. Their uses expanded from simple food to include vegetable cultivation, fermentation, and oil extraction. Currently, my country's demand for soybeans continues to grow, resulting in a high dependence on imports. Therefore, increasing soybean self-sufficiency and oilseed production capacity has become a critical bottleneck that my country urgently needs to address.
[0003] The oil content of soybean seeds is an important quantitative trait controlled by multiple genes and influenced by various factors such as environmental conditions, exhibiting a complex regulatory network. Therefore, making full use of existing soybean germplasm resources to study and elucidate the molecular genetic mechanisms of soybean oil content will help improve soybean quality and provide scientific strategies and basis for its genetic improvement. Summary of the Invention
[0004] The purpose of this invention is to improve the quality of soybeans and increase the protein and oil content of soybean seeds.
[0005] This invention provides the application of GmVAP27-3A protein or GmVAP27-3B protein in regulating soybean seed protein content, soybean seed oil content, soybean plant height, or soybean seed size.
[0006] Further specifying, the amino acid sequence of the GmVAP27-3A protein is shown in SEQ ID NO.43; the amino acid sequence of the GmVAP27-3B protein is shown in SEQ ID NO.41.
[0007] This invention provides the application of the GmVAP27-3A gene or the GmVAP27-3B gene in regulating soybean seed protein content, soybean seed oil content, soybean plant height, or soybean seed size. The GmVAP27-3A gene is numbered Glyma.03G032100; the GmVAP27-3B gene is numbered Glyma.01G136000.
[0008] This invention provides the application of a recombinant vector or recombinant microbial cell containing the above-mentioned GmVAP27-3A gene or GmVAP27-3B gene in regulating soybean seed protein content, soybean seed oil content, soybean plant height, or soybean seed size. The GmVAP27-3A gene is numbered Glyma.03G032100; the GmVAP27-3B gene is numbered Glyma.01G136000.
[0009] This invention provides the application of recombinant vectors or recombinant microbial cells containing overexpression of the GmVAP27-3A and GmVAP27-3B genes in regulating soybean seed protein content, soybean seed oil content, soybean plant height, or soybean seed size. The invention is characterized in that the GmVAP27-3A gene is numbered Glyma.03G032100; and the GmVAP27-3B gene is numbered Glyma.01G136000.
[0010] To further specify, the regulation of soybean seed oil content is achieved by overexpressing the GmVAP27-3A or GmVAP27-3B gene; the regulation of soybean seed protein content, soybean plant height, or soybean seed size is achieved by mutating the GmVAP27-3A or GmVAP27-3B gene.
[0011] This invention provides a breeding method for increasing the oil content of soybean seeds, comprising the following steps: (1) Amplify the GmVAP27-3A gene or the GmVAP27-3B gene and insert the gene sequence into the plant overexpression vector; the GmVAP27-3A gene is numbered Glyma.03G032100; the GmVAP27-3B gene is numbered Glyma.01G136000; (2) The vector obtained in step (1) is introduced into Agrobacterium, and the Agrobacterium is used to transfer it into soybeans to obtain transgenic plants; (3) Identification step (2) The transgenic soybeans obtained in step (2) yielded positive transgenic plants.
[0012] This invention provides a breeding method for promoting soybean growth and increasing soybean seed size, comprising the following steps: (1) Amplify the sgRNA of the GmVAP27-3A gene or the GmVAP27-3B gene, and insert the sgRNA into the CRISPR expression vector; the sgRNA of the GmVAP27-3A gene is shown in SEQ ID NO.46, SEQ ID NO.47 and SEQ ID NO.48; the sgRNA of the GmVAP27-3B gene is shown in SEQ ID NO.49, SEQ ID NO.50 and SEQ ID NO.51; (2) The vector obtained in step (1) is introduced into Agrobacterium, and the Agrobacterium is used to transfer it into soybeans to obtain transgenic plants; (3) Identification step (2) yields positive transgenic plants from the transgenic soybeans obtained; or 1) Amplify the sgRNA of the GmVAP27-3A and GmVAP27-3B genes, and insert the sgRNA into the CRISPR expression vector; the sgRNA of the GmVAP27-3A gene is shown in SEQ ID NO.46, SEQ ID NO.47 and SEQ ID NO.48; the sgRNA of the GmVAP27-3B gene is shown in SEQ ID NO.49, SEQ ID NO.50 and SEQ ID NO.51; 2) The vector obtained in step 1) is introduced into Agrobacterium, and the Agrobacterium is used to transfer it into soybeans to obtain transgenic plants; 3) Identify the transgenic soybeans obtained in step 2) to obtain positive transgenic plants.
[0013] This invention provides a breeding method for increasing the protein content of soybean seeds, comprising the following steps: (1) Amplify the sgRNA of the GmVAP27-3A gene or the GmVAP27-3B gene, and insert the sgRNA into the CRISPR expression vector; the sgRNA of the GmVAP27-3A gene is shown in SEQ ID NO.46, SEQ ID NO.47 and SEQ ID NO.48; the sgRNA of the GmVAP27-3B gene is shown in SEQ ID NO.49, SEQ ID NO.50 and SEQ ID NO.51; (2) The vector obtained in step (1) is introduced into Agrobacterium, and the Agrobacterium is used to transfer it into soybeans to obtain transgenic plants; (3) Identification step (2) yields positive transgenic plants from the transgenic soybeans obtained; or 1) Amplify the sgRNA of the GmVAP27-3A and GmVAP27-3B genes, and insert the sgRNA into the CRISPR expression vector; the sgRNA of the GmVAP27-3A gene is shown in SEQ ID NO.46, SEQ ID NO.47 and SEQ ID NO.48; the sgRNA of the GmVAP27-3B gene is shown in SEQ ID NO.49, SEQ ID NO.50 and SEQ ID NO.51; 2) The vector obtained in step 1) is introduced into Agrobacterium, and the Agrobacterium is used to transfer it into soybeans to obtain transgenic plants; 3) Identify the transgenic soybeans obtained in step 2) to obtain positive transgenic plants.
[0014] Beneficial Effects: GmVAP27-3A and GmVAP27-3B mutations lead to reduced soybean oil content: Stable genetic mutants gmvap27-3a, gmvap27-3b, and gmvap27-3a gmvap27-3b were created using CRISPR / Cas9 gene editing technology. Analysis of seed oil and protein content showed that compared to the control variety DN50, the mutants had lower seed oil content and higher protein content. This indicates that GmVAP27-3A and GmVAP27-3B positively regulate oil content.
[0015] GmVAP27-3A and GmVAP27-3B negatively regulate protein content, and the double mutants show more significant phenotypic changes than the single mutants. Attached Figure Description Figure 1 Figure showing the identification results of Arabidopsis mutants; Note: A: M: Trans2K® Plus DNA Marker; 1: Water; 2-4: Wild-type Col-0; 5-7: PCR detection results of mutant atvap27-3; B: Top view of Arabidopsis wild-type Col-0 (left) and atvap27-3 mutant (right), Bar=1 cm; Figure 2 Figure 1 shows the screening results of Arabidopsis thaliana overexpression plants and Arabidopsis thaliana replacement-related plants; Note: A: Glufosinate-ammonia (Basta) was used to screen Arabidopsis thaliana overexpression plants, and Bar test strips were used for verification; B: Hygromycin B was used to screen Arabidopsis thaliana replacement-related plants, Bar = 1 cm; Figure 3Figure 1 shows the results of PCR (A) and qRT-PCR identification of Arabidopsis thaliana overexpressing plants (B) and PCR identification of Arabidopsis thaliana replacement plants (C). Note: A: M: Trans5K® Plus DNA Marker; 1, 5: Positive plasmids; 2-4, 6-8: Arabidopsis thaliana overexpressing plants; 9: Wild-type Col-0. B: The horizontal axis represents three different lines of Arabidopsis thaliana mutants, wild-type plants, and Arabidopsis thaliana overexpressing plants, and the vertical axis represents the relative expression level of the AtVAP27-3 gene. The Arabidopsis thaliana gene Actin2 was used as an internal control gene. The experiment was performed in three biological replicates, and the error value is the standard error. C: M: Trans5K® Plus DNA Marker; 1: Wild-type Col-0; 2-9: Arabidopsis thaliana replacement plants; 10-17: Arabidopsis thaliana replacement control plants. Figure 4 Figure 1 shows the phenotypic identification results of transgenic Arabidopsis thaliana; Note: A: Phenotypic identification of oil content in wild-type and transgenic Arabidopsis thaliana seeds; B: Phenotypic identification of protein content in wild-type and transgenic Arabidopsis thaliana seeds; C: Phenotypic identification of fatty acid content in wild-type and transgenic Arabidopsis thaliana seeds. Data were analyzed for significance using t-tests. The experiment was performed in three biological replicates, with the error value being the standard error. *Significant difference p < 0.05; **Extremely significant difference p < 0.01; Figure 5 Figure 1 shows the detection results of gmvap27-3a and gmvap27-3b mutants; Note: A: Two mutation types of gmvap27-3a; B: Two mutation types of gmvap27-3b; C: Cas9 vector detection results of gmvap27-3a: M: Trans5K® Plus DNA Marker; 1: DN50; 2-9: gmvap27-3a-1; 11-19: gmvap27-3a-2; D: Cas9 vector detection results of gmvap27-3b: M: Trans5K® Plus DNA Marker; 1-6: gmvap27-3b-1; 8-13: gmvap27-3b-2; E: Target-off-target gene information; Figure 6The image shows the results of three mutation types of the gmvap27-3a and gmvap27-3b double mutants; Note: A: Three mutation types of gmvap27-3a and gmvap27-3b; B: Cas9 vector detection results of gmvap27-3a and gmvap27-3b: M: Trans5K®Plus DNA Marker; 1-6: gmvap27-3a and gmvap27-3b-1; 8-13: gmvap27-3a and gmvap27-3b-2; 15-19: gmvap27-3a and gmvap27-3b-3; C: Off-target gene information for target two; D: Off-target gene information for target three. Figure 7 Figures show the results of grain oil (A), protein content (B), and T2 generation fatty acid (C) determination of gmvap27-3a, gmvap27-3b, gmvap27-3a, and gmvap27-3b mutants (T1 / T2 generations). Note: Data were analyzed for significance using t-tests. The experiment was performed in three biological replicates, with the error value being the standard error. *Significant difference p < 0.05; **Extremely significant difference p < 0.01. Figure 8 Transmission electron microscopy (TEM) images of gmvap27-3a, gmvap27-3b, and gmvap27-3a / gmvap27-3b mutants; Note: SSP (Small Secreted Protein) represents protein bodies, OBs (Oil Badies) represents oil bodies, and SGs (Starch Grains) represents starch granules. In the figures, MM stage represents 50-80 days after soybean flowering, LM stage represents 80-110 days after soybean flowering, and DS stage represents dried mature soybean seeds (Bar = 10 μm). Figure 9 Statistical results of agronomic traits of soybean mutants gmvap27-3a, gmvap27-3b, and gmvap27-3a gmvap27-3b are shown in the figure. Note: A, C, D: Phenotypic identification of plant height, grain length, and grain width of the three mutants; B, E, F, G: Statistical analysis of plant height, grain length, grain width, and 100-grain weight of the three mutants. Data were analyzed for significance using a t-test. The experiment was performed in three biological replicates, and the error value was the standard error. *Significant difference p < 0.05; **Extremely significant difference p < 0.01. Detailed Implementation
[0016] The strains selected for this experiment were Escherichia coli DH5a, Agrobacterium tumefaciens EHA105, and Saccharomyces NMY51.
[0017] The Arabidopsis transformation vectors were pSoy1 and pSoy10; the soybean transformation vector was pGES401; the knockout vector pGES401 was kindly provided by Professor Guan Yuefeng of Guangzhou University and recorded in the article [1] Bai M, Lin W, Peng C, et al. Expressing a human RNA demethylase as an assister improves gene-editing efficiency in plants[J].Molecular Plant, 2024, 17(3):363-366.DOI:10.1016 / j.molp.2024.02.010.; the pSoy and Fu series vectors were kindly provided by Professor Fu Yongfu of the Institute of Crop Science, Chinese Academy of Agricultural Sciences.
[0018] BioVector, a flexible system for gene-specific expression in plants, is documented in this article, which records all the designed Fu vectors.
[0019] The Fu28 carrier and pSOY1 and pSOY10 carriers are disclosed in the patent application number CN202210517898.4.
[0020] Example 1. Obtaining transgenic Arabidopsis thaliana 1. Construction of Arabidopsis thaliana overexpression vectors and Arabidopsis thaliana complementation vectors AT2G45140 Amino acid: (SEQ ID NO.1), restriction site selection and primer design were performed using CE Design. The specific primer sequences are shown below: Fu28- AtVAP27-3 -F: ggaaacagctatgaccCTCAGATGAATCTACTTGTGG (SEQ ID NO.2); Fu28- AtVAP27-3 -R: ccctcagatctaccatGGCGGAGGGATGGGCGGGGAT (SEQ IDNO.3); Fu76- ProVAP27-3 -F: GACATGCATGAATTCTCTAGAGCCTCAGATGCTGATTTGTTAG (SEQ IDNO.4); Fu76- ProVAP27-3-R: AGATCTGCGGCCGCAAGCTTGGATCCTCTGATGCGATATTTTATTC (SEQ IDNO.5); Fu28- GmVAP27-3A -F: gagccatggctgcagaagcttATGAGTTCCGGCGAGCTCC (SEQ IDNO.6); Fu28- GmVAP27-3A -R: gctcaccatgagctcgaattcCGTCCTCTTCAACAGGAAAC (SEQ ID NO. 7).
[0021] Using Arabidopsis CDS as a template, Fu28-AtVAP27-3-F and Fu28-AtVAP27-3-R primers were used to obtain the target gene with the homologous arm AtVAP27 of the Fu28 vector; Using soybean CDS as a template, Fu28-GmVAP27-3A-F and Fu28-GmVAP27-3A-R were used as primers to obtain the target gene containing the homologous arm GmVAP27-3A of the Fu28 vector; Using Arabidopsis DNA as a template, and Fu76-ProVAP27-3-F and Fu76-ProVAP27-3-R as primers, the target gene containing the ProAtVAP27-3 homologous arm of the Fu76 vector was obtained. (1) Plasmid extraction: plasmids of Fu76 and pSoy10 vectors were extracted using a kit from Novizan (product number: DC201).
[0022] (2) Plasmid linearization: The introductory vector Fu28 was linearized by PCR (Xba1 and BamH1 digestion), and ligated with the cloned genes ATVAP27-3 and GmVAP27-3A, respectively. The gel was then used to obtain the Fu28-ATVAP27-3 / Fu28-GmVAP27-3A vector. The Fu76 vector was linearized (EcoR1 and HindIII digestion), and ligated with ProAtVAP27-3 to obtain the recombinant vector Fu76-ProAtVAP27-3. (3) LR reaction: The Arabidopsis complementation vector was formed by ligating the target gene fragment (Fu28-GmVAP27-3A) on the entry vector Fu28 and the target gene promoter (Fu76-ProAtVAP27-3) on the entry vector Fu76 together to the expression vector pSoy10. The sequencing primers were pSoy10 sequencing primers to obtain the vector ProAtVAP27-3GmVAP27-3A-pSoy10; Arabidopsis overexpression vector: The target gene fragment (Fu28-ATVAP27-3) on Fu28 was ligated into the expression vector pSoy10 to obtain the pSoy10 sequencing primers to obtain the vector pSoy10-AtVAP27; the sequencing primers are as follows: Vector Fu28, universal primer GFP-R: CACGAACTCCAGCAGGACCATG (SEQ ID NO.8); Vector Fu76, universal primer M13 Forward: GTAAAACGACGGCCAGTG (SEQ ID NO.9); Vector pSoy1, universal primer NOS-R: gataatcatcgcaagaccgg (SEQ ID NO.10); Vector pSoy10, universal primer M13 rev prime: AGCGGATAACAATTTCACAC (SEQ ID NO.11); (4) The constructed vector was transformed into Agrobacterium, and Arabidopsis thaliana was transformed by the Arabidopsis thaliana fluff infection method; 2. Arabidopsis overexpression vector was transformed into Arabidopsis Col-0 to obtain Arabidopsis overexpression plants (35s:: AtVAP27- 3 ): Arabidopsis thaliana replacement vector was transferred into the Arabidopsis thaliana mutant atvap27-3 (SALK_091291C) to obtain Arabidopsis thaliana replacement plants ( Pro AtVAP27-3 ::GmVAP27-3A ), and Arabidopsis thaliana replacement vector was transferred into Arabidopsis thaliana mutant Col-0 to obtain Arabidopsis thaliana replacement control plants ( Pro AtVAP27-3 ::AtVAP27-3 ).
[0023] 3. Screening of Arabidopsis thaliana plants overexpressing the gene and those that have been replaced After drying the recovered T0 Arabidopsis seeds, plant more than half of them. After the seedlings have basically emerged and have only grown 2 leaves, use a micro plastic sprayer with good atomization effect to spray 20 mL / L glufosinate solution (Bayer, YQ1363-100 mL) on the overexpressing transgenic Arabidopsis. Spray the replanted Arabidopsis plants with a 30 mg / mL solution of hygromycin B (Roche, 10843555001-20 mL), once every two days, for a total of three sprays. Seven days later, transplant the Arabidopsis seedlings with four leaves into individual flowerpots. Harvest the seeds after they mature for further selection.
[0024] 4. PCR detection of transgenic Arabidopsis thaliana DNA was extracted from the selected Arabidopsis plants using the CTAB method. The DNA from the freshly extracted Arabidopsis leaves was used as a PCR template. The PCR primers were as follows: At-CDS-F: ATGAGTAACGAGCTTCTCAC (SEQ ID NO.12); GFP-R: GTCCTTGAAGAAGATGGTGC (SEQ ID NO.13); Hyg-F: GAGCTTGTCGATCGACAGAT (SEQ ID NO.14); Hyg-R: TCTCGAGCTTTCGCAGATCC (SEQ ID NO.15). The primers for qRT-PCR identification of T3 generation transgenic Arabidopsis thaliana are as follows: At-q-ACT2-F: AATTACGAGCTGGGCA (SEQ ID NO.16); At-q-ACT2-R: TCATACTCGGCCTTGGA (SEQ ID NO.17); ATVAP27-3-qF: AGGTTAAGACGACGAATCCAAAGA (SEQ ID NO.18); ATVAP27-3-qR: CTAGCGACTACACATTGAAGCAAG (SEQ ID NO.19).
[0025] Mutant Arabidopsis: Search for the gene on the Arashare website, select the mutant with wild-type Col-0 as the control background and T-DNA insertion method for ordering.
[0026] DNA from Arabidopsis thaliana leaves was used as a PCR template. The PCR primers were as follows: LP-01: AAAAGGAAGCTCCTGCTGATC (SEQ ID NO.20); RP-01: AACCGCAGAGTTCTTTTCCTC (SEQ ID NO.21); LB1-01: GCCTTTTCAGAAATGGATAAATAGCCTTGCTTCC (SEQ ID NO.22).
[0027] Results: Arabidopsis mutants atvap27-3 PCR identification To verify GmVAP27-3A The effect on the oil content and composition of the seeds will GmVAP27-3A Transfer to Arabidopsis atvap27-3 Functional verification is performed on mutants. Order from the Arashare website. GmVAP27-3A Arabidopsis homologs AT2G45140 mutant atvap27-3 (SALK_091291C). Extraction of Arabidopsis thaliana Col-0 and... atvap27-3The mutant DNA was analyzed by PCR using a three-primer method. The results showed that both the mutant and the wild type were homozygous. Figure 1 ).
[0028] 5. GmVAP27-3A Screening and PCR identification of transgenic Arabidopsis thaliana 1) Screening of Arabidopsis overexpression plants and replacement plants Using Arabidopsis DNA, seed cDNA, and soybean LM stage seed cDNA as templates, amplification was performed. Pro AtVAP27-3 , CDS- AtVAP27-3 and CDS-GmVAP27-3A The cloned gene was ligated into vectors pSoy1 and pSoy10 using the Gateway cloning method and transformed into Agrobacterium. Arabidopsis thaliana was then transformed using the pollen infection method. The obtained T0 generation seeds were dried and planted, including Arabidopsis thaliana overexpression plants (35s:: AtVAP27-3 Arabidopsis thaliana replants ( Pro AtVAP27-3 ::GmVAP27-3A ) and Arabidopsis thaliana replacement control plants ( Pro AtVAP27-3 ::AtVAP27-3 After the transgenic Arabidopsis seedlings developed two cotyledons, overexpressing Arabidopsis plants were screened using a 20 mL / L solution of glufosinate-ammonium (Basta); recombinant Arabidopsis plants were screened using a 30 mg / mL solution of hygromycin B (Hyg B), sprayed every other day for three weeks. After 2-3 weeks, normally growing Arabidopsis seedlings were selected as positive seedlings for subsequent PCR identification. Figure 2 ).
[0029] 2).A tVAP27-3 Identification of transgenic Arabidopsis plants Overexpressing transgenic Arabidopsis thaliana plants (35s:: AtVAP27-3 The plants were screened and propagated to the T3 generation. DNA and RNA were extracted from the rosette leaves for further identification. Wild-type Col-0 was used as a control, and PCR identification and qRT-PCR detection were performed. The results are as follows: Figure 3 As shown in A and B, a total of 3 overexpressing plants were identified. AtVAP27-3 The expression level of overexpressing plants was significantly higher than that of control plants. Overexpressing plants with higher gene expression folds were selected for subsequent experiments.
[0030] Reintroducing genetically modified Arabidopsis thaliana into relevant plants Pro AtVAP27-3 ::GmVAP27-3A and Pro AtVAP27-3 ::AtVAP27-3The plants were continuously screened and propagated to the T3 generation, and DNA was extracted from the rosette leaves of Arabidopsis thaliana for PCR identification. AtVAP27-3 The detection primers are universal primers attB1-F and CDS-AtVAP27-3 Downstream primers for cloning; GmVAP27-3A The detection primers are universal primers attB1-F and CDS-GmVAP27-3A Downstream primers for cloning. A total of 4 were identified. Pro AtVAP27-3 ::GmVAP27-3A and 4 Pro AtVAP27-3 ::AtVAP27-3 Positive plants were used for subsequent experiments. Figure 3 (C in the middle).
[0031] Example 2. GmVAP27-3A and AtVAP27-3 promote oil synthesis in Arabidopsis thaliana seeds The oil and protein content of soybean seeds was determined using a FOSS near-infrared grain analyzer (FOSS1241).
[0032] To verify GmVAP27-3A and AtVAP27-3 The effects on the oil and protein content of Arabidopsis thaliana seeds, comparing wild-type, transgenic, and... atvap27-3 Mutant Arabidopsis plants were planted under the same conditions, and seeds of T3 generation transgenic Arabidopsis were harvested for quality trait analysis.
[0033] The results of oil content determination showed that the oil content of seeds from mutant plants was significantly lower than that of wild-type plants; the oil content of seeds from overexpression plants was significantly higher than that of wild-type plants; there was no significant difference in oil content between Arabidopsis thaliana replacement plants and replacement control plants. Figure 4 (A in the middle).
[0034] Protein content analysis showed that the protein content of seeds from mutant plants was significantly higher than that of wild-type plants; the protein content of seeds from overexpression plants was significantly lower than that of wild-type plants; there was no significant difference in seed protein content between replacement plants and replacement control plants. Figure 4 (B in the middle).
[0035] Fatty acid content analysis showed that, compared to the wild type, the mutant seeds contained significantly lower levels of stearic acid (C18:0) and linoleic acid (C18:2n6c), and significantly higher levels of oleic acid (C18:1n9c) and α-linolenic acid (C18:3n3). Palmitic acid (C16:0) content showed no significant trend. The overexpression plants exhibited the opposite phenotype to the mutants. Furthermore, there was no significant difference in seed fatty acid content between the replacement plants and the replacement control plants. Figure 4 (C in the middle).
[0036] The above research results indicate that:GmVAP27-3A and AtVAP27-3 It promotes the accumulation of oil in Arabidopsis seeds, inhibits the accumulation of protein, and has a certain promoting effect on the content of stearic acid and linoleic acid in fatty acids; it also has a certain inhibitory effect on oleic acid and α-linolenic acid.
[0037] Example 3. Construction of soybean knockout mutant vector (1) Design of knockout vector primers Design CRISPR / Cas9 targets on the Target design website (selected based on the percentage of off-score). GmVAP27-3A and GmVAP27-3B We designed suitable knockout target sequences for the exon regions, and the primers are as follows. GmVAP27-3A: sgRNA1:AGTGACAATGCAAGCCCAAAAGG (SEQ ID NO.46); sgRNA2:CAGGGAAACTGCAGCTCCTGGGG (SEQ ID NO.47); sgRNA3:AGGTCTACTTGTGATGTCATAGG (SEQ ID NO.48); GmVAP27-3B: sgRNA1:AGTAACAATGCAAGCCCAAAAGG (SEQ ID NO.49); sgRNA2:CAGGGAAACTGCAGCTCCTGGGG (SEQ ID NO.50); sgRNA3:AGGTCTACTTGTGATGTCATAGG; (SEQ ID NO.51); Knockout vector primers: VAP-401-F1: TGGTCTCgTGCAAGTGACAATGCAAGCCCAAAgttttagagctagaaatagc (SEQ ID NO. 23); VAP-401-R1: TGGTCTCgAAACCCCATGAGTTCCGGCGAGCTCtgcaccagccgggaatcgaa (SEQ ID NO.24); VAP-401-F2: TGGTCTCgTGCACAGGGAAACTGCAGCTCCTGgttttagagctagaaatagc (SEQ ID NO.25); VAP-401-R2: TGGTCTCgAAACATGACATCACAAGTAGACCTtgcaccagccgggaatcgaa (SEQ ID NO.26); (2) Construction of knockout vector Step 1: Using pGES401 Vector as a template, and employing primers: VAP13-401-F1: TGGTCTCgTGCAAGTGACAATGCAAGCCCAAAgttttagagctagaaatagc (SEQ ID NO. 27); VAP13-401-R1: TGGTCTCgAAACCCATGAGTTCCGGCGAGCTCtgcaccagccgggaatcgaa (SEQ ID NO.28); VAP2-401-F2: TGGTCTCgTGCACAGGGAAACTGCAGCTCCTGgttttagagctagaaatagc (SEQ ID NO.29); VAP2-401-R2: TGGTCTCgAAACATGACATCACAAGTAGACCTtgcaccagccgggaatcgaa (SEQ ID NO.30); Step 2: Prepare the PCR amplification system according to the following formula (using GXL high-fidelity enzyme as an example): pGES401 Vector (diluted 100 times) 1 μl; VAP13-401-F1 (10 μM) 1 μl; VAP13-401-R1 (10 μM) 1 μl; 5× STAR GXL Buffer 10 μl; dNTP 4 μl; GXL DNA Polymerase 1 μl; add water to make up to 50 μl; Repeat the mixing of the prepared reaction buffer, briefly centrifuge, and place on the PCR instrument. Run the following program: 98℃ 5min, 98℃ 30s, 58℃ 30s, 72℃ 15s (35 cycles); 72℃ 10min, 16℃ ∞; The PCR-amplified DNA fragment 1 can be used immediately or stored long-term at -20℃. DNA fragment 2 is then obtained using VAP2-401-F2 and VAP2-401-R2. The homozygous DNA fragment and the pGES401 vector are simultaneously added to the reaction system, along with BsaI restriction enzyme and T4 ligase, allowing for simultaneous digestion and ligation. (Since correctly ligated fragments do not contain BsaI restriction sites, they will not be cleaved again in subsequent digestion rounds, while incorrectly ligated fragments will be cleaved again; therefore, each round of digestion and ligation enriches the correctly ligated fragments.) Finally, the fragments are transformed into DH5α to screen for positive clones, completing vector construction.
[0038] Golden Gate one-step vector construction: After a brief centrifugation, the reaction mixture was placed in a PCR instrument. The product was used directly for transformation after the program ended. The obtained pGES401-DNA 1 fragment recombinant vector was ligated with DNA 2 fragment to obtain the pGES401-DNA 2 fragment recombinant vector using the same method. Golden Gate reaction system and program: pGES401 Plasmid (digested with BsaI), 5 μL; T4 DNA Ligase Buffer (10X), 2 μL; T4 DNA Ligase, 1 μL; BsaI, 1 μL; Nuclease-free H2O, (10⁻ⁿ) μL; DNA 1 fragment, 1 μL; Transformation and plaque screening: The plaque screening primers were STU-TEST-4R sequencing primers: STU-TEST-3F: tgctaccctcatccatcagtc (SEQ ID NO.31); STU-TEST-4R: TGTTGTGTGGAATTGTGAGCG (SEQ ID NO.32).
[0039] (3) Expression vector was transformed into Agrobacterium rhizogenes The constructed vector was then transformed into Agrobacterium after plasmid extraction.
[0040] (4) Genetic transformation of soybean cotyledon nodes Mutant plants were obtained by co-mediated transformation of soybean cotyledon nodes using Agrobacterium tumefaciens containing the pGES401-DNA 1 fragment recombinant vector and Agrobacterium tumefaciens containing the pGES401-DNA 2 fragment recombinant vector.
[0041] (5) PCR detection of mutant plants 1) Extraction of total plant DNA by CTAB method: extraction of DNA from Arabidopsis thaliana leaves.
[0042] 2) Genotyping of mutants: The genotype of mutants was detected using Sanger sequencing and PCR detection. The template was changed from bacterial culture to DNA. The PCR products were sent to Ruibo Biotechnology for sequencing. The returned sequencing results showed that the plant was homozygous at the target site if the result showed a normal peak, and that the plant was heterozygous at the target site if the result showed an overlapping peak. The returned sequencing results were compared with the DN50 genome sequence to detect whether the sequence at the target site had changed. The changed CDS sequence was translated into a protein sequence using Snap Gene software, and it was observed whether the predicted protein sequence terminated prematurely. Knockout target detection primer: 3A-ED-T1-F3: ggagtgagtacggtgtgcGTTAAGTAACTTTCTTCCT (SEQ ID NO. 33); 3A-ED-T1-R3: gagttggatgctggatggCGAGGGGAATCATCTTCATC (SEQ ID NO.34); 3A-ED-T2 / 3-F1: ggagtgagtacggtgtgcATTGATCTCTCTCTCCGGCG (SEQ ID NO.35); 3A-ED-T2 / 3-R1: gagttggatgctggatggAAAATTGGTACCTTGAAAGCC (SEQ ID NO.36); 3B-ED-T1-F3: ggagtgagtacggtgtgcGTAACTTTGTTTTCTATGTA (SEQ ID NO.37); 3B-ED-T1-R3: gagttggatgctggatggGCACGAGGTGATGAGTCTTC (SEQ ID NO.38); 3B-ED-T2 / 3-F1: ggagtgagtacggtgtgcCATAAAGATGGGACCAGTTA (SEQ ID NO.39); 3B-ED-T2 / 3-R1:gagttggatgctggatggGCAGAAACCGAATAAAAAAGCG (SEQ ID NO.40).
[0043] 3) Mutant Positive Detection: PCR was used to detect the presence of CRISPR / Cas9 vector T-DNA in mutant plants. The PCR primers were STU-TEST-3F and STU-TEST-4R. After the PCR reaction, agarose gel electrophoresis was performed. The presence of bands indicated that T-DNA was still present in the mutant plants, potentially allowing for further editing.
[0044] (6) gmvap27-3a and gmvap27-3b Construction of gene-edited mutants To verify GmVAP27-3A andGmVAP27-3B Its role in soybean oil regulation was investigated using Crisper / Cas9 gene editing technology. gmvap27-3a , gmvap27-3b, gmvap27-3a gmvap27-3b Genetically edited mutants were genetically transformed using the soybean cotyledon node transformation method. When the T1 generation mutant plants grew their first trifoliate compound leaves, DNA was extracted from the leaves. The recipient variety DN50 was used as a negative control. Detection primers were designed upstream and downstream of the gene editing site for PCR amplification, and the products were then subjected to Sanger sequencing.
[0045] Sequencing results for target 1: gmvap27-3a Two mutation types were detected in the single mutant; gmvap27-3b Two mutation types were detected in the single mutant. Among them, gmvap27-3a The mutation type is ( Figure 5 A in the middle): gmvap27- 3a-1 The CDS sequence has a deletion of one base (C) at 220 bp, and translation terminates at the 92nd amino acid. gmvap27-3a-2 The mutation involved a 5-base deletion at 216 bp in the CDS sequence (AGCCC), which terminated translation at amino acid 78. Both mutation types resulted in incomplete translation of the major structural domain (MSP), leading to loss of original protein function. gmvap27-3b There are two types of mutations ( Figure 5 (B in the text) gmvap27-3b-1 One base (C) was added at 218 bp of the CDS sequence, and translation terminated at the 80th amino acid. gmvap27-3b-2 The deletion of two bases (CC) at 218 bp in the CDS sequence terminated translation at amino acid 79. Both mutation types resulted in incomplete translation of the major structural domain (MSP), leading to loss of original protein function.
[0046] To determine whether the homozygous mutants still contained the Cas9 vector, DNA extracted from the mutants and control plants (DN50) was used for PCR identification using universal primers (STU-3F, STU-4R) for detecting the Cas9 vector. The results are shown in the figure below: gmvap27-3a-1 , gmvap27-3a-2 Plants that do not contain Cas9 vector ( Figure 5 (C in the middle). gmvap27-3b-1 All contain the Cas9 vector, and gmvap27-3b-2 Only a small number of plants do not contain the Cas9 vector, and these two mutants may produce other knockout types in subsequent generations. Figure 5 D in the middle To verify whether off-target effects exist, we logged into the Target Design website (http: / / skl.scau.edu.cn / targetdesign / ) to query off-target genes. Figure 5 (E in the text). Target 1 may go off-target. Glyma.20g230200 and Glyma.05g154200 Within gene introns, since introns do not affect protein sequence translation, the target gene was not targeted. GmVAP27-3A and GmVAP27-3B The mutant phenotype has an impact.
[0047] The sequencing results for target 2 and target 3 are shown in the figure below: gmvap27-3a gmvap27-3b The double mutant was found to have the following three mutation types ( Figure 6 A in the middle): gmvap27-3a gmvap27-3b-1 The mutation types are: GmVAP27-3A At target site 2, 24 bases are deleted at 18 bp of the CDS sequence (CCTCCACATACAGCCCCAGGAGCT), and at target site 3, 2 bases are deleted at 199 bp of the CDS sequence (GT). Translation terminates at the 71st amino acid. GmVAP27-3B At target site 2, a single base (G) is missing at 36 bp of the CDS sequence, which terminates at the 20th amino acid.
[0048] gmvap27-3a gmvap27-3b-2 The mutation types are: GmVAP27-3A At target site 2, an A base was added at 35 bp of the CDS sequence, and translation terminated at the 20th amino acid. GmVAP27-3B At target site 3, the gene adds one base (T) at 199 bp of the CDS sequence and terminates at amino acid 81.
[0049] gmvap27-3a gmvap27-3b-3 The mutation types are: GmVAP27-3A At target site 2, an A base was added at 35 bp of the CDS sequence, and translation terminated at the 20th amino acid. GmVAP27-3B At target site 2, a 3-base deletion (CTC) occurs at 37 bp of the CDS sequence; at target site 3, a 1-base addition (T) occurs at 199 bp of the CDS sequence; and translation terminates at amino acid 79. All three double mutation types result in incomplete translation of the major structural domain (MSP), leading to loss of original protein function.
[0050] To determine whether the homozygous mutants still contained the Cas9 vector, DNA extracted from the mutants and control plant DN50 was used for PCR identification using universal primers for the Cas9 vector (STU-3F, STU-4R). The results are as follows.Figure 6 As shown in B in the figure. All three mutation types detected plants without the Cas9 vector, while the remaining plants containing the Cas9 vector may exhibit other knockout types in subsequent propagation.
[0051] To verify whether only the target gene was edited, we logged into the Target Design website (http: / / skl.scau.edu.cn / targetdesign / ) to query off-target genes. Figure 6 (C, D in the text). Target 2 may go off-target. Glyma.20g230200 On the intron; target three may go off-target. Glyma.20g025000 and Glyma.16g131900 Within the introns, since introns do not affect protein sequence translation, the target gene is not affected. GmVAP27-3A GmVAP27-3B and GmVAP27-3B The mutant function.
[0052] (7) GmVAP27-3A and GmVAP27-3B Mutation inhibits soybean seed oil synthesis To verify GmVAP27-3A and GmVAP27-3B The effects of DN50 and mutant plants on the oil and protein content of soybean seeds were investigated at the transgenic base in the North District of Northeast Agricultural University. After seed maturity, the oil content of T1 / T2 generation soybean seeds was determined using a FOSS near-infrared grain analyzer (FOSS1241). Figure 7 A in the middle) and protein ( Figure 7 The content of B in soybean seeds; the content of five major fatty acid components (palmitic acid, stearic acid, oleic acid, linoleic acid, and linolenic acid) in soybean seeds by gas chromatography. Figure 7 (C in the original text). The results are as follows: The results of the oil content determination showed that: gmvap27-3a The average oil content of the seeds of each mutant line was 18.38% and 18.49%, respectively, which was 1.30% and 1.19% lower than that of wild-type DN50 plants (19.68%). gmvap27- 3b The average oil content of the seeds of each mutant line was 18.55% and 18.58%, respectively, which was 1.13% and 1.10% lower than that of wild-type DN50 plants (19.68%). gmvap27-3a gmvap27-3b The average oil content of each line of the double mutant was 18.28%, 18.22%, and 18.29%, respectively, which was 1.40%, 1.46%, and 1.39% lower than that of wild-type DN50 plants (19.68%). Furthermore, the oil content of the double mutant seeds was significantly lower than that of the single mutant. Figure 7 (A in the middle). GmVAP27-3A orGmVAP27-3B Genetically modified soybeans were obtained by overexpressing the gene in soybeans, resulting in increased oil accumulation in the seeds of these soybeans compared to wild-type soybeans.
[0053] The protein content determination results showed that: gmvap27-3a The average protein content of the seeds of each mutant line was 42.26% and 42.62%, respectively, which was 1.82% and 2.18% higher than that of wild-type DN50 plants (40.44%). gmvap27- 3b The average protein content of seeds from each line of the single mutant was 42.05% and 41.87%, respectively, which was 1.61% and 1.43% higher than that of wild-type DN50 plants (40.44%). gmvap27-3a gmvap27-3b The average protein content of seeds from each line of the double mutant was 43.22%, 43.14%, and 43.41%, respectively, which were 2.78%, 2.70%, and 2.97% higher than that of wild-type DN50 plants (40.44%). Furthermore, the protein content of seeds from the double mutants was significantly higher than that of the single mutants. Figure 7 (B in the middle).
[0054] The results of fatty acid content determination showed that gas chromatography analysis of five major fatty acid components (palmitic acid, stearic acid, oleic acid, linoleic acid, and alpha-linolenic acid) in soybean seeds revealed that, compared with the control DN50, the contents of stearic acid (C18:0) and linoleic acid (C18:2n6c) were significantly decreased in the three mutants; the contents of oleic acid (C18:1n9c) and alpha-linolenic acid (C18:3n3) were significantly increased; while the contents of palmitic acid (C16:0) showed no obvious trend. Figure 7 (C in the middle).
[0055] The above results indicate that: GmVAP27-3A and GmVAP27-3B It promotes the accumulation of oil in soybean seeds, inhibits the accumulation of protein, and positively regulates the content of stearic acid and linoleic acid; it negatively regulates the content of oleic acid and α-linolenic acid.
[0056] (8) GmVAP27-3A and GmVAP27-3B Effects on seed oil bodies and protein bodies In order to study GmVAP27-3A and GmVAP27-3B Effects on seed oil bodies and protein bodies, selected gmvap27- 3a , gmvap27-3b, gmvap27-3a gmvap27-3b The accumulation of oil bodies and protein bodies inside soybean grains from three mutant and control plants at the DN50 MM, LM, and DS stages was observed using transmission electron microscopy. The results, observed under 3000x magnification at 100 kV, are as follows: Figure 8As shown, as the seeds develop, the starch granules in the seeds gradually become smaller until they disappear. Compared with the control group, the protein bodies in the three mutants are larger and the number of oil bodies is reduced, which is consistent with the previous trend of changes in the oil and protein content of soybean seeds.
[0057] (9) GmVAP27-3A and GmVAP27-3B Mutations cause increased soybean plant height and larger grains. To explore GmVAP27-3A and GmVAP27-3B The impact on plant growth and development, when planted under the same cultivation conditions. gmvap27-3a , gmvap27-3b, gmvap27-3a gmvap27-3b Three mutant plants and a control plant (DN50) were used. Changes in plant height, grain length, and grain width were observed and recorded. The results are as follows: Figure 9 As shown.
[0058] Plant height measurements showed that, compared to the control group of DN50 plants, gmvap27-3a , gmvap27-3b, gmvap27- 3a gmvap27-3b The height of mutant plants increased significantly, and the increase was more significant in double mutants than in single mutants. Figure 9 (A and B in the text).
[0059] Grain length and width measurements showed that, compared with the control group of DN50 plants, gmvap27-3a , gmvap27-3b, gmvap27-3a gmvap27-3b The mutant plants showed a significant increase in grain length and width, with the increase being more pronounced in double mutants than in single mutants. Figure 9 (CF in the middle).
[0060] The results of the 100-grain weight measurement showed that, compared with the control group of DN50 plants, gmvap27-3a , gmvap27-3b, gmvap27-3a gmvap27-3b The weight of 100 seeds in mutant plants was significantly increased, and the increase was more significant in double mutants than in single mutants. Figure 9 (G in the middle).
[0061] The above results indicate that GmVAP27-3A and GmVAP27-3B Mutations can cause soybean plants to grow taller and seeds to become larger.
[0062] GmVAP27-3B Amino acids: (SEQ ID NO.41); GmVAP27-3B gene: (SEQ ID NO.42); GmVAP27-3A amino acids: (SEQ ID NO.43); GmVAP27-3A gene: (SEQ ID NO.44); ProAtVAP27-3 promoter: (SEQ ID NO.45).
Claims
1. Use of GmVAP27-3A protein or GmVAP27-3B protein in regulating protein content of soybean seed, regulating oil content of soybean seed, regulating plant height of soybean or regulating seed size of soybean.
2. Use according to claim 1, characterized in that, The amino acid sequence of the GmVAP27-3A protein is shown as SEQ ID NO. 43; the amino acid sequence of the GmVAP27-3B protein is shown as SEQ ID NO.
41.
3. Application of GmVAP27-3A gene or GmVAP27-3B gene in regulating soybean seed protein content, regulating soybean seed oil content, regulating soybean plant height or regulating soybean seed size, characterized in that, The GmVAP27-3A gene is numbered as Glyma.03G032100; the GmVAP27-3B gene is numbered as Glyma.01G136000.
4. Use of recombinant vectors or recombinant microbial cells containing overexpressed GmVAP27-3A gene or GmVAP27-3B gene in regulating soybean seed protein content, regulating soybean seed oil content, regulating soybean plant height, or regulating soybean seed size, characterized in that, The GmVAP27-3A gene is numbered as Glyma.03G032100; the GmVAP27-3B gene is numbered as Glyma.01G136000.
5. The use of recombinant vectors or recombinant microbial cells containing overexpressed GmVAP27-3A and GmVAP27-3B genes in regulating the protein content of soybean seeds, regulating the oil content of soybean seeds, regulating the plant height of soybean, or regulating the seed size of soybean, characterized in that, The GmVAP27-3A gene is numbered as Glyma.03G032100; the GmVAP27-3B gene is numbered as Glyma.01G136000.
6. Use according to any one of claims 1 to 5, characterized in that, The GmVAP27-3A gene is numbered as Glyma.03G032100; the GmVAP27-3B gene is numbered as Glyma.01G136000.
7. The use according to any one of claims 1 to 5, characterized in that, Regulating oil content of soybean seed is overexpressing GmVAP27-3A gene or GmVAP27-3B gene.
8. A breeding method for increasing oil content of soybean seeds, characterized by, Regulating protein content of soybean seed, regulating plant height of soybean or regulating seed size of soybean is mutating GmVAP27-3A gene or GmVAP27-3B gene. The steps are as follows: (1) amplifying GmVAP27-3A gene or GmVAP27-3B gene, inserting the gene sequence into a plant overexpression vector; the GmVAP27-3A gene is numbered as Glyma.03G032100; the GmVAP27-3B gene is numbered as Glyma.01G136000; (2) introducing the vector obtained in step (1) into Agrobacterium, and using Agrobacterium to transform soybean to obtain transgenic plants; 9. A breeding method for promoting growth and grain size of soybean, characterized by, (3) identifying the transgenic soybean obtained in step (2) to obtain positive transgenic plants. The steps are as follows: (1) amplifying sgRNA of GmVAP27-3A gene or GmVAP27-3B gene, inserting the sgRNA into a Crispr expression vector; the sgRNA of the GmVAP27-3A gene is shown as SEQ ID NO. 46, SEQ ID NO. 47 and SEQ ID NO. 48; the sgRNA of the GmVAP27-3B gene is shown as SEQ ID NO. 49, SEQ ID NO. 50 and SEQ ID NO. 51; (2) introducing the vector obtained in step (1) into Agrobacterium, and using Agrobacterium to transform soybean to obtain transgenic plants; (3) identifying the transgenic soybean obtained in step (2) to obtain positive transgenic plants; or 1) amplifying sgRNA of GmVAP27-3A gene and GmVAP27-3B gene, inserting sgRNA into Crispr expression vector; sgRNA of GmVAP27-3A gene is shown as SEQ ID NO. 46, SEQ ID NO. 47 and SEQ ID NO. 48; sgRNA of GmVAP27-3B gene is shown as SEQ ID NO. 49, SEQ ID NO. 50 and SEQ ID NO. 51; 2) introducing the vector obtained in step 1) into Agrobacterium, and transferring into soybean by Agrobacterium to obtain transgenic plants; 3) identifying the transgenic soybean obtained in step 2) to obtain positive transgenic plants.
10. A breeding method for increasing the protein content of soybean seeds, characterized by, The steps are as follows: (1) amplifying sgRNA of GmVAP27-3A gene or GmVAP27-3B gene, inserting sgRNA into Crispr expression vector; sgRNA of GmVAP27-3A gene is shown as SEQ ID NO. 46, SEQ ID NO. 47 and SEQ ID NO. 48; sgRNA of GmVAP27-3B gene is shown as SEQ ID NO. 49, SEQ ID NO. 50 and SEQ ID NO. 51; (2) introducing the vector obtained in step (1) into Agrobacterium, and transferring into soybean by Agrobacterium to obtain transgenic plants; (3) identifying the transgenic soybean obtained in step (2) to obtain positive transgenic plants; or 1) amplifying sgRNA of GmVAP27-3A gene and GmVAP27-3B gene, inserting sgRNA into Crispr expression vector; sgRNA of GmVAP27-3A gene is shown as SEQ ID NO. 46, SEQ ID NO. 47 and SEQ ID NO. 48; sgRNA of GmVAP27-3B gene is shown as SEQ ID NO. 49, SEQ ID NO. 50 and SEQ ID NO. 51; 2) introducing the vector obtained in step 1) into Agrobacterium, and transferring into soybean by Agrobacterium to obtain transgenic plants; 3) identifying the transgenic soybean obtained in step 2) to obtain positive transgenic plants.
Citation Information
Patent Citations
A multi-gene mutant of rhizobium HH103 and its applications
CN115161251B
Methods and compositions for increasing protein and / or oil content and modifying oil profile in a plant
WO2023154887A1
Use of soybean gmsammt gene in regulation of vegetable protein content and / or yield
WO2024183168A1
Cited By
Application of GmFd2 gene in regulating soybean protein content and regulating soybean plant height
CN122465946A