Paddy rice heavy metal transport regulation gene TNI6 and application of protein coded by paddy rice heavy metal transport regulation gene TNI6

Abstract

The invention discloses a rice heavy metal transport regulation gene TNI6 and application of a protein coded by the gene TNI6, the gene is used for regulating the content of heavy metal nickel and / or cadmium in rice grains, the nucleotide sequence of the gene is shown as Seq ID No: 1, and the amino acid sequence of the protein coded by the gene is shown as Seq ID No: 2; according to the application, the content of heavy metal nickel and / or cadmium in rice grains is reduced through gene overexpression; or the content of heavy metal nickel and / or cadmium in the rice grains is increased by inhibiting gene expression. Through functional analysis of the TNI6 gene, a regulation and control mechanism of heavy metal nickel and cadmium content in grains of plants, especially gramineous plants, is further defined, and a foundation is laid for cultivating low-nickel and low-cadmium rice varieties and improving the safety quality of rice.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering, and in particular to the application of a rice heavy metal transport regulatory gene TNI6 (transporter nickel ion 6) (or RNiT1) and the protein it encodes. Background Technology

[0002] Rice, one of my country's three major grain crops, is the staple food of half the world's population and an ideal model plant for basic research on monocotyledonous plants. In recent years, due to mining, overuse of chemical fertilizers, and industrial activities, pollution of agricultural soils with nickel (Ni) and cadmium (Cd) has become increasingly prominent. Because rice has a strong ability to absorb and transport heavy metals from the soil, rice has become a major source of heavy metals such as nickel and cadmium for humans. Excessive accumulation of heavy metals in rice poses a threat to consumer health; therefore, controlling the accumulation of nickel and cadmium in rice is of great significance for ensuring rice quality and safety and protecting consumer health.

[0003] One of the most effective strategies for reducing nickel and cadmium content in rice grains is breeding rice varieties with lower nickel and cadmium levels. Therefore, cloning genes that can regulate the content of heavy metals nickel and cadmium in rice grains will contribute to further improvement of rice safety and quality. Summary of the Invention

[0004] The purpose of this invention is to provide an application of the rice heavy metal transport regulatory gene TNI6 and its encoded protein, enabling it to affect the content of heavy metals nickel and cadmium in rice grains.

[0005] To solve the above-mentioned technical problems, the present invention adopts the following technical solution:

[0006] On one hand, the present invention provides an application of the rice heavy metal transport regulatory gene TNI6, which is used to regulate the content of heavy metals nickel and / or cadmium in rice grains, and the nucleotide sequence of the gene is shown in Seq ID No: 1.

[0007] Furthermore, the content of heavy metals nickel and / or cadmium in rice grains can be regulated by gene overexpression or gene inhibition.

[0008] Furthermore, the content of heavy metals nickel and / or cadmium in rice grains can be reduced by gene overexpression; or the content of heavy metals nickel and / or cadmium in rice grains can be increased by inhibiting gene expression.

[0009] Furthermore, the content of heavy metals nickel and / or cadmium in rice grains is reduced by overexpressing the gene through transgenic methods; the transgenic methods include: transforming rice cells with the gene, or a plasmid containing the gene, or a plant expression vector containing the gene, or a host cell containing the gene, and then cultivating the transformed rice cells into plants.

[0010] Secondly, the present invention also provides an application of a protein encoded by the rice heavy metal transport regulatory gene TNI6, the protein being used to regulate the content of heavy metals nickel and / or cadmium in rice grains, the amino acid sequence of the protein being shown in SeqID No: 2.

[0011] Furthermore, the content of heavy metals nickel and / or cadmium in rice grains can be reduced by increasing the protein content; or the content of heavy metals nickel and / or cadmium in rice grains can be increased by reducing the protein content.

[0012] This invention utilizes CRISPR / Cas9 gene editing technology to clone the TNI6 gene in rice. This gene encodes a protein containing a nickel-cobalt transporter functional domain (HTLSGPDHL domain, GHDA (G / S)Q domain) that regulates the changes in the content of heavy metals nickel and cadmium in rice grains. Functional analysis of the TNI6 gene further clarifies the regulatory mechanism of heavy metals nickel and cadmium content in plant grains, particularly in grasses, laying the foundation for breeding low-nickel and low-cadmium rice varieties and improving the safety and quality of rice. Attached Figure Description

[0013] The above is merely an overview of the technical solution of the present invention. In order to better understand the technical means of the present invention, the present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments.

[0014] Figure 1 The nickel and cadmium content (A) and other heavy metal content (B) of the rice grain high-accumulation nickel and cadmium mutant material tni6 and wild-type material Jiahe 212.

[0015] Figure 2 The plant phenotypes (A) of the rice grain high-accumulation nickel-cadmium mutant material tni6 and the wild-type material Jiahe 212 are shown, bar = 10cm.

[0016] Figure 3 This is the spectrum of the VK005-TNI6 vector;

[0017] Figure 4 The identification of the TNI6 genotype in the rice grain high-accumulation nickel-cadmium mutant tni6;

[0018] Figure 5 The nickel and cadmium content of the TNI6 overexpression material and the wild-type material Jiahe 212 is shown. Detailed Implementation

[0019] The following embodiments further illustrate the content of the present invention, but should not be construed as limiting the present invention. Modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and substance of the invention are all within the scope of the present invention. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, the biochemical reagents, carriers, consumables, etc. used in the embodiments are commercially available products.

[0020] This invention utilizes CRISPR / Cas9 gene editing technology to perform site-directed mutations in the TNI6 gene in the rice genome, generating a tni6 mutant with abnormal nickel and cadmium content in rice grains. The TNI6 gene (nucleotide sequence shown in Seq ID No: 1) encodes a protein containing a nickel-cobalt transporter functional domain (HTLSGPDHL domain GHDA (G / S) Q domain) (amino acid sequence shown in Seq ID No: 2). By interpreting the function of the TNI6 gene, the genetic mechanism regulating nickel and cadmium content in rice grains is further elucidated, laying the foundation for improving the safety and quality of rice and breeding low-cadmium rice varieties.

[0021] (1) Segregation and genetic analysis of mutant tni6:

[0022] The nickel-cadmium transporter mutant tni6 of this invention was generated from the japonica rice variety Jiahe 212 through site-directed mutagenesis of the TNI6 gene in rice using CRISPR / Cas9 gene editing technology. The grain nickel-cadmium content and plant phenotype of the mutant were compared with those of the wild type. The comparison results are as follows: Figure 1 , 2 As shown.

[0023] (2) Cloning and functional identification of the TNI6 gene:

[0024] 1) Construction of the TNI6 gene CRISPR / Cas9 vector:

[0025] Based on the principles of CRISPR / Cas9 gene editing technology and the TNI6 gene cDNA sequence, the specific gRNA target sequence of the TNI6 gene was obtained through database and tool website analysis. This target sequence was then subcloned into the CRISPR / Cas9 gene editing vector VK005, resulting in the VK005-TNI6 gene editing vector. Figure 3 Then, the VK005-TNI6 plasmid was transferred into the callus tissue of the rice variety Jiahe 212 using transgenic technology to obtain transgenic progeny plants.

[0026] 2) Genotyping of TNI6:

[0027] Phenotypic observation was performed on the obtained transgenic T1 generation plants throughout their entire growth period. Specific primer amplification and sequencing were performed on the genomic regions near the gRNA target sequence in all T1 generation plants to identify mutations in the target sequence and its vicinity. Genotypic comparison and phenotypic analysis yielded the genotype of TNI6 in the tni6 mutant. Figure 4 ).

[0028] 3) TNI6 gene functional analysis:

[0029] Through transgenic technology and further observation of its field phenotype, the results showed that the present invention obtained a mutant tni6 with significantly higher nickel and cadmium content in the grain than the wild type. Figure 1 ).

[0030] In addition, by constructing a TNI6 overexpression vector to transform rice and further observing its field phenotype, the results showed that the present invention obtained a rice variety with reduced nickel and cadmium content in the grain.

[0031] The following is a detailed description through specific embodiments:

[0032] Example 1. Isolation of the rice tni6 mutant

[0033] (1) Construction of the rice VK005-TNI6 plant expression vector:

[0034] Based on the principles of CRISPR / Cas9 gene editing technology and the specific cDNA sequence of the TNI6 gene, the specific gRNA target sequence of the TNI6 gene was obtained through database and tool website analysis. Primers were designed to subclone this target sequence into the CRISPR / Cas9 gene editing vector VK005, resulting in the VK005-TNI6 gene editing vector. Figure 3 The primers for the gRNA target sequence are as follows:

[0035] TNI6-CRISPR-1 Sense:5'- GGCCAATCCTGCTGCCGATG TGG-3'

[0036] TNI6-CRISPR-1 Anti: 5'- CCA CATCGGCAGCAGGATTGGCC -3'

[0037] TNI6-CRISPR-2 Sense:5'- GCGTTGGCGTCGTTCCACT CGG -3'

[0038] TNI6-CRISPR-2 Anti: 5'- CCG AGTGGAACGACGCCAACGC -3'

[0039] (2) Transform rice with the VK005-TNI6 plant expression vector.

[0040] A method for transforming mature rice embryo callus using Agrobacterium-mediated transformation was employed. The plant expression vector VK005-TNI6 was transferred into mature rice embryos. The transformation method is as follows: ① Induction of mature rice embryo callus: Mature wild-type Jiahe 212 seeds were dehulled, then surface-sterilized with 70-75% alcohol for 1 min, followed by soaking in 30% NaClO solution for 15 min, repeated twice. The seeds were then washed 4-5 times with sterile water. The seeds were then cultured on induction medium at 26-28℃ in the dark to induce callus formation for transformation. ② Co-culture of rice callus with Agrobacterium: EHA105 strain containing the VK005-TNI6 expression vector was activated, enriched, and resuspended, with OD600 adjusted to 0.4-0.6. Callus was collected in 50 ml sterile centrifuge tubes, and the resuspended Agrobacterium suspension was added to infect the callus. After soaking for 15-30 minutes, discard the suspension and place the soaked callus on sterile filter paper to absorb excess Agrobacterium tumefaciens solution. Then place the callus in a petri dish lined with sterile filter paper and incubate at 26°C in the dark for 2-3 days. ③ Screening of resistant callus: After co-culture, transfer the callus to a selection medium containing 50 mg / ml hygromycin and screen for resistance at 26-28°C. ④ Differentiation of resistant callus: Place the callus with good growth in the selection medium into a differentiation medium and culture it under 16 hours of light / 8 hours of darkness at an ambient temperature between 26-28°C until seedlings emerge. ⑤ Rooting of differentiated seedlings: When the differentiated seedlings are about 2-5 cm long, transfer them to a rooting medium for rooting culture. Transplant the rooted seedlings to a greenhouse or transgenic nursery for growth. Observe the phenotype of the obtained transgenic progeny T1 plants throughout their entire growth period. Figure 1 Individual plants with the mutant phenotype were harvested and propagated individually. After multiple generations of planting, phenotype-stable lines were used for genotyping of offspring.

[0041] Example 2. Genotyping of rice tni6 mutant

[0042] (1) Identification of the TNI6 genotype in rice tni6 mutant:

[0043] Phenotypic observation and recording were performed on phenotypic stable transgenic mutant lines throughout their entire growth period. Simultaneously, specific primers were used to amplify and sequence the genomic regions near the gRNA target sequence to identify mutations in the target sequence and its surrounding regions. PCR was used to amplify and sequence the genomic regions near the gRNA target sequence from both mutant lines and the wild-type cultivar Nipponbare. The PCR amplification program was as follows: 94℃ pre-denaturation for 3 minutes; 98℃ denaturation for 30 seconds, 55℃ annealing for 30 seconds, 68℃ extension for 45 seconds, 38 cycles; and a final extension at 68℃ for 5 minutes. PCR products were separated by 5% agarose gel electrophoresis and stained with ethidium bromide. The target band fragments were then sent to Qingke for sequencing. Primer sequences are as follows:

[0044] TNI6-S1F: 5'- ATGGCAATGGAGAGGCTTATC -3'

[0045] TNI6-S1R: 5'- GTCCGGCCCGGAGAGCGTGTG -3'

[0046] Through sequencing analysis, we obtained the genotype of TNI6 in the tni6 mutant as follows: Figure 4 As shown, there are two genotypes. The first genotype has a G base deletion in the first exon of the TNI6 gene, and the second genotype has an A base insertion in the second exon region. Both result in premature termination of the amino acid encoded by TNI6. The sequencing process was repeated twice, yielding the same results.

[0047] Example 3. Phenotypic identification of the rice grain high-accumulation nickel-cadmium mutant tni6

[0048] After the rice grains in the field were fully mature, three seed samples were taken from the wild type and each homozygous transgenic line, and the sample numbers were marked. After thorough drying, the rice husks were removed, and the brown rice was ground into rice flour. The brown rice flour was then digested with HNO3 (60%) at 120°C. Finally, the digestion solution was diluted, and the metal concentration in the digestion solution was determined by atomic absorption spectrometry and inductively coupled plasma mass spectrometry (ICP-MS7800, Agilent Technologies).

[0049] The measurement results are as follows Figure 1 As shown, Figure 1 The nickel and cadmium content (A) and other heavy metal content (B) of the high-accumulation nickel-cadmium mutant material tni6 and the wild-type material Jiahe 212 in rice grains were compared by... Figure 1 It can be seen that, compared with the wild type (WT), the nickel and cadmium content in rice grains of homozygous transgenic lines (tni6 mutants: tni6-1, tni6-2) is significantly increased.

[0050] Example 4. Construction of pCambia1390-TNI6 plant expression vector

[0051] Based on the complete genome sequence of the rice variety Nipponbare (Oryza sativa L cv. Nipponbare) provided in NCBI, specific primers for amplifying the full-length TNI6 gene sequence were designed. Specific restriction enzyme sites were added to both ends of the primers according to the characteristics of the selected pCambia1390 expression vector and the full-length TNI6 gene sequence. Specifically, the primers were designed as follows: the forward primer (P1F) with a KpnI restriction site (GGTACC) added to the 5' end, and the reverse primer (P1R) with a SpeI restriction site (ACTAGT) added to the 5' end. The primer sequences are as follows:

[0052] TNI6-C1F forward primer: 5'-ACCTTCTGCACTAGGTACCATGGCAATGGAGAGGCTTATCTC-3'

[0053] TNI6-C1R reverse primer: 5-GCGTTAACACTAGTTCAGTACAAGCTAAAGCCGAGAGAC-3'

[0054] Then, using Nipponbare genomic DNA as a template, the TNI6 candidate gene cds sequence, totaling 1104 bp, was amplified using the primers (P1F and P1R) designed above. The amplification program was as follows: 94℃ pre-denaturation for 4 minutes; 98℃ denaturation for 30 seconds, 55℃ annealing for 30 seconds, 68℃ extension for 12 minutes, for 40 cycles; and a final extension at 68℃ for 10 minutes. The target fragment amplified by PCR was recovered, ligated into the ZERO BLUNT TOPO vector (Invitrogen), transformed into E. coli DH5α competent cells, and positive clones were screened by colony PCR and sent to Tsingke for sequencing. The TNI6 overexpression vector pCambia1390-TNI6 was obtained and transformed into Agrobacterium tumefaciens EHA105 using electroporation.

[0055] Example 5. Transforming rice with the pCambia1390-TNI6 plant expression vector.

[0056] The Agrobacterium-mediated transformation of mature rice embryo callus was adopted. The recombinant expression vector pCambia1390-TNI6 was transferred into mature rice embryos. The transformation method is as follows: (1) Induction of mature rice embryo callus: Mature wild-type Jiahe 212 seeds were dehulled, then surface-sterilized with 70-75% alcohol for 1-2 min, then soaked in 30% NaClO solution for 15 min, and repeated twice. Then, the seeds were washed 4-5 times with sterile water. The seeds were then placed on induction medium and cultured at 26-28 degrees Celsius in the dark to induce callus for transformation. (2) Co-culture of rice callus and Agrobacterium: The EHA105 strain containing the pCambia1390-TNI6 expression vector was activated, enriched, and resuspended, and the OD600 was adjusted to 0.5-0.6. The callus was collected in 50 ml sterile centrifuge tubes, and the resuspended Agrobacterium suspension was poured in to infect the callus. After soaking for 15-30 minutes, discard the suspension and place the infected callus on sterile filter paper to absorb excess Agrobacterium tumefaciens solution. Then place the callus in a petri dish lined with sterile filter paper and incubate at 26 degrees Celsius in the dark for 2-3 days. (3) Screening of resistant callus: After co-culture, transfer the callus to a screening medium containing 50-100 mg / ml of hygromycin antibiotic and screen for resistance at 26-28 degrees Celsius. (4) Differentiation of resistant callus: Place the callus with good growth in the screening medium into a differentiation medium and culture it under 16 hours of light / 8 hours of darkness at an ambient temperature between 26-28 degrees Celsius until seedlings emerge. (5) Rooting of differentiated seedlings: When the differentiated seedlings are about 2-5 cm long, transfer them to a rooting medium for rooting culture. Transplant the rooted seedlings to a greenhouse or transgenic nursery for growth. After homozygosity, transplant them to Hainan.

[0057] Phenotypic observations were conducted on the obtained transgenic progeny plants throughout their entire growth period, and the nickel and cadmium content of the grains was measured. The results showed that: Figure 5 The nickel and cadmium content of the TNI6 overexpression material and the wild-type material Jiahe 212 was determined by... Figure 5 It was found that, compared to the wild type (WT), the nickel and cadmium content in rice grains from the TNI6 overexpression lines (OETNI6-1 and OETNI6-2) was significantly reduced. These results indicate that transgenic overexpression of the TNI6 gene can reduce the content of heavy metals nickel and cadmium in rice grains.

[0058] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Any simple modifications, equivalent changes, or alterations made by those skilled in the art using the disclosed technical content shall fall within the protection scope of the present invention.

Claims

1. Use of a heavy metal transport regulation gene TNI6 of rice, characterized in that, The gene is used for regulating the heavy metal nickel and / or cadmium content in rice grains, and the nucleotide sequence of the gene is shown in Seq ID No:

1.

2. The use of the heavy metal transport regulating gene TNI6 of rice according to claim 1, characterized in that, The heavy metal nickel and / or cadmium content in rice grains is regulated by overexpressing or inhibiting the expression of the gene.

3. The use of the heavy metal transport regulating gene TNI6 of rice according to claim 2, characterized in that, The heavy metal nickel and / or cadmium content in rice grains is reduced by overexpressing the gene. Or the heavy metal nickel and / or cadmium content in rice grains is increased by inhibiting the expression of the gene.

4. The use of the heavy metal transport regulating gene TNI6 of rice according to claim 3, characterized in that, The heavy metal nickel and / or chromium content in rice grains is reduced by overexpressing the gene in a transgenic manner. The transgenic manner includes: transforming the gene, or a plasmid containing the gene, or a plant expression vector containing the gene, or a host cell containing the gene, into rice cells, and then cultivating the transformed rice cells into plants.

5. Use of a protein encoded by a heavy metal transport regulation gene TNI6 of rice, characterized in that, The protein is used for regulating the heavy metal nickel and / or cadmium content in rice grains, and the amino acid sequence of the protein is shown in Seq ID No:

2.

6. The use of the protein encoded by the heavy metal transport regulation gene TNI6 of rice according to claim 5, characterized in that, The heavy metal nickel and / or cadmium content in rice grains is reduced by increasing the content of the protein; or the heavy metal nickel and / or cadmium content in rice grains is increased by reducing the content of the protein.

Images