Glycosylation-like extracellular vesicle as well as preparation method and application thereof
By synthesizing glycosylated liposomes to simulate glycosylated EV subpopulations, the problem of lacking unified reference and quality control materials in existing technologies has been solved, thus improving the accuracy and stability of glycosylated EV experiments and enhancing the reliability and repeatability of experimental results.
Patent Information
- Application Number
- CN202511233249.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-29
- Publication Date
- 2025-12-12
AI Technical Summary
The existing technology lacks a unified reference and quality control standard applicable to glycosylated extracellular vesicle (EV) subsets. Artificially synthesized liposomes cannot completely mimic natural EVs, have poor stability, and the preparation process is not mature, which affects the accuracy and reproducibility of experimental results.
Glycosylated liposomes were synthesized using glycosylated amphiphilic lipids to mimic a subset of glycosylated extracellular vesicles (EVs) as a reference or quality control. These liposomes were formed by encapsulating nucleic acids in an extracellular membrane composed of cholesterol, phospholipids, cationic lipids, and an amphiphilic lipid-PEG-glycosylated complex in a specific molar ratio. The preparation method involved forming glycosylated extracellular vesicles in a liposome synthesizer.
It provides stable reference or quality control samples of glycosylated EVs, improves the accuracy and reproducibility of experimental results, enhances the quality control standards of glycosylated EV subgroups, and improves encapsulation efficiency and storage stability.
Smart Images

Figure BDA0005575398030000071 
Figure BDA0005575398030000072 
Figure HDA0005575398080000011
Abstract
Description
Technical Field
[0001] This invention belongs to the field of extracellular vesicle enrichment technology, and relates to a glycosylated extracellular vesicle, its preparation method and application. Background Technology
[0002] Extracellular vesicles (EVs), considered a cornerstone of liquid biopsy, are promising biomarkers for disease diagnosis. However, the high complexity and heterogeneity of EVs present numerous challenges for their clinical translation and industrial production, one of the main reasons being the lack of standardized reference and quality control standards. The heterogeneity of EVs is closely related to their extraction methods. Heterogeneity means that extracellular vesicles exhibit diversity in size, composition, and function, which directly affects the choice and effectiveness of extraction methods. Beijing Hotgen Biotech Co., Ltd.'s GlyExo-Capture extracellular vesicle extraction reagent can specifically capture glycosylated EV subsets, but currently, standardized reference and quality control standards applicable to glycosylated EV subsets are still lacking.
[0003] Liposomes are bilayer structures spontaneously formed in water by lipid molecules such as phospholipids and cholesterol. They possess a structure similar to biological cell membranes and are therefore also known as artificial biomembranes. Due to their excellent biocompatibility and tunable physicochemical properties, and their similarity to EVs (endothelial cells), liposomes can be used as reference or quality control materials in EV experiments, and are widely used in quantitative and quality control experiments involving EVs. Synthetically produced liposome reference materials can help researchers make comparisons and calibrations. These liposomes can mimic the characteristics of cell membranes, thus providing reliable reference data. Researchers can monitor variations during experiments to ensure the consistency and reliability of experimental results.
[0004] However, using synthetic liposomes as reference materials in EV-related experiments faces some challenges and problems, mainly including the following:
[0005] 1) Samples of EVs are often heterogeneous, and synthetically produced liposomes cannot completely mimic natural EVs in composition and structure. This difference may affect the accuracy and reproducibility of experimental results. Currently, there are no liposome references or quality control samples applicable to glycosylated EV subgroups.
[0006] 2) Liposomes exhibit poor stability both in vitro and in vivo, and are prone to aggregation, fusion, or drug leakage, which limits their effectiveness as reference materials. Changes in the physical and chemical properties of liposomes can affect their performance in experiments.
[0007] 3) The preparation process of artificially synthesized liposomes may be immature, resulting in low encapsulation efficiency and high transportation and storage costs, which limits their application in experiments.
[0008] Currently, liposomes are mainly used as drug-carrying liposomes, and the purpose of modifying liposomes is primarily for targeted delivery to corresponding lesions. There are currently no reference or quality control liposomes suitable for glycosylated EV subgroups, and there is also a lack of efficacy evaluations of liposomes as references for glycosylated EV subgroups. Summary of the Invention
[0009] To address the shortcomings of existing technologies, this invention provides a glycosylated extracellular vesicle, its preparation method, and its application.
[0010] This invention utilizes glycosylated amphiphilic lipids to artificially synthesize glycosylated liposomes, which simulate glycosylated EVs subpopulations and serve as reference or quality control products for glycosylated EVs. This can solve the problem of the lack of quality control standards for glycosylated EVs subpopulations extracted by existing sugar capture methods.
[0011] Solution
[0012] To achieve the above objectives, the present invention provides the following technical solution:
[0013] In a first aspect, the present invention provides a glycosylated extracellular vesicle comprising a glycosylated lipid extracellular membrane and nucleic acid encapsulated therein, wherein the glycosylated lipid extracellular membrane comprises cholesterol, phospholipids, cationic lipids and an amphiphilic lipid-PEG-glycosylated complex in a molar ratio of (6-10):(6.5-4.5):(6.5-4.5):1.
[0014] Furthermore, the molar ratio of cholesterol is 30%-50%, the molar ratio of phospholipids and cationic lipids is 65%-45%, and the molar ratio of amphiphilic lipid-PEG-glycosyl complex is 5%;
[0015] And / or, the molar ratio of cholesterol, phospholipids, cationic lipids and amphiphilic lipid-PEG-glycosyl complex is 7:6:6:1;
[0016] And / or, the nucleic acid is DNA or RNA, optionally miRNA or DNA, optionally selected from one or more of hsa-miR-16, hsa-miR-93, hsa-miR-211, hsa-miR-26a, hsa-miR-191, hsa-miR-320a, U6, gapdh, actin, 18S rRNA, cel-miR-39, cel-miR-54.
[0017] Furthermore, in the amphiphilic lipid-PEG-glycosyl complex, the amphiphilic lipid is selected from one or more of DSPE (distearylphosphatidylethanolamine), DOPE (dioleoylphosphatidylethanolamine), and SA (stearic acid), and optionally DSPE;
[0018] And / or, in the amphiphilic lipid-PEG-glycosyl complex, the molecular weight of PEG (polyethylene glycol) is 350 to 5000, and optionally PEG2000;
[0019] And / or, in the amphiphilic lipid-PEG-glycosyl complex, the glycosyl group is selected from one or more of sialic acid, galactose, glucose, chitosan, mannose, fucose, and fucoidan.
[0020] And / or, in lipid phase substances, the phospholipids are lecithin;
[0021] And / or, in the lipid phase, the cationic lipid is selected from one or more of DOTAP ((2,3-dioleoyloxypropyl)trimethylammonium chloride), SM102 (heptadecane-9-yl-8-((2-hydroxyethyl)(6-oxo-6-((undecyloxy)hexyl)amino)octanoate), ALC-0315 (((4-hydroxybutyl)azadialkyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate)), Dlin-MC3-DMA (4-(N,N-dimethylamino)butyric acid (6Z,9Z,28Z,31Z)-heptadecane-6,9,28,31-tetraen-19-yl ester), DOTMA (N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride), optionally SM102;
[0022] In a second aspect, a method for preparing glycosylated extracellular vesicles as described in the first aspect is provided, characterized in that it includes forming glycosylated extracellular vesicles by mixing a lipid phase and an aqueous phase in a liposome synthesizer.
[0023] The lipid phase consists of cholesterol, phospholipids, cationic lipids, and amphiphilic lipid-PEG-glycosyl complexes added to anhydrous ethanol in a molar ratio to obtain the lipid phase.
[0024] The aqueous phase consists of adding nucleic acids to a buffer solution with a pH of 4–6 to obtain the aqueous phase.
[0025] Furthermore, the pH of the aqueous phase is 4–6;
[0026] Optionally, in the aqueous phase, the nucleic acid concentration is 10. 12 ~10 14 copies / ml, optionally 10 13 copies / ml;
[0027] Optionally, in the aqueous phase, the buffer solution is a citrate-sodium citrate buffer solution.
[0028] Optionally, in the lipid phase, the molar ratio of cholesterol, phospholipids, cationic lipids and amphiphilic lipid-PEG-glycosyl complex is (6-10):(6.5-4.5):(6.5-4.5):1, and the concentration of amphiphilic lipid-PEG-glycosyl complex in the lipid phase is optionally 0.5-0.8 mM, optionally 0.6 mM;
[0029] Optionally, the volume ratio of the lipid phase to the aqueous phase is 1:3 to 1:4, and optionally 1:3.
[0030] Furthermore, in the liposome synthesizer, the flow rate ratio of the lipid phase to the aqueous phase is 1:3 to 1:4, and optionally 1:3;
[0031] And / or, in the liposome synthesizer, the total flow rate is 10–14 ml / min, optionally 12 ml / min.
[0032] Furthermore, after liposome synthesis, they are stored in a buffer solution containing trehalose.
[0033] Furthermore, after liposome synthesis, impurities are removed by ultrafiltration and washing.
[0034] In a second aspect, the application of the glycosylated extracellular vesicles described in the first aspect or prepared by the preparation method described in the second aspect as a reference or quality control product for glycosylated exosomes is provided.
[0035] Beneficial effects:
[0036] This invention utilizes glycosylated amphiphilic lipids to artificially synthesize glycosylated liposomes, which simulate glycosylated EVs subpopulations and serve as reference or quality control products for glycosylated EVs. This can solve the problem of the lack of quality control standards for glycosylated EVs subpopulations extracted by existing sugar capture methods. Attached Figure Description
[0037] One or more embodiments are illustrated by way of example with reference to the accompanying drawings, and these illustrative examples are not intended to limit the embodiments. The term "illustrative" as used herein means "serving as an example, embodiment, or illustration." Any embodiment illustrated herein as "illustrative" is not necessarily to be construed as superior to or better than other embodiments.
[0038] Figure 1 Transmission electron microscope images of liposomes prepared with different formulations of the present invention. A is an image of a normal vesicle structure with a diameter of 50-200 nm prepared in Example 1; B is an image of an abnormal multilayer membrane structure prepared in Comparative Example 1; C is an image of Comparative Example 2 with no vesicle structure formed; D is an image of an abnormal multivesicle stacked structure in Comparative Example 3.
[0039] Figure 2The tracking analysis results of nanoparticles loaded with miR-16 liposomes in Example 1 of this invention.
[0040] Figure 3 The figures represent the differences in liposomes synthesized with different lipid phase formulations. Comparative Example 4 (A) extracted by GlyExo Capture showed significantly lower efficiency of non-glycosidic liposomes without DSPE-PEG2000-sialic acid compared to normal glycosidic liposomes. Comparative Example 5 (B) showed significantly lower miR-16 loading in SM-102-free glycosidic liposomes compared to normal glycosidic liposomes. t-tests and ANOVA were used; **** indicates P < 0.0001.
[0041] Figure 4 : This is the liposome concentration versus CT value curve for Test Example 1 of this invention. A, log [value] diluted 10-fold with 0.5M trehalose aqueous solution. 10 The linear relationship between miR-16 liposome loading concentration and corresponding CT value was established using the regression equation Y = -3.269*X + 38.34, R0 2 =0.9991. B, log from a 10-fold dilution of serum. 10 The linear relationship between miR-16 liposome loading concentration and corresponding CT value was established using the regression equation Y = -3.259*X + 39.56, R0 2 =0.9993. C, log [value] diluted 10 times with 0.5M trehalose aqueous solution. 10 The linear relationship between the concentration of cel-miR-39 liposomes and the corresponding CT value was established using the regression equation Y = -3.186*X + 41.13, R0 2 =0.9989.
[0042] Figure 5 The accuracy test results of Test Example 1 of the present invention: the coefficient of variation (CV) of the CT values of miR-16 in glycosylated liposomes loaded with miR-16 was 0.7% after 10 tests; the coefficient of variation (CV) of the CT values of cel-miR-39 in glycosylated liposomes loaded with cel-miR-39 was 0.4% after 10 tests.
[0043] Figure 6 This invention presents a comparative analysis of the stability and freeze-thaw stability of glycosylated liposomes loaded with miRNA and ultra-extracted extracellular vesicles in Test Example 1 at -20°C, 4°C, and 30°C. One-way ANOVA was used to analyze the differences in CT values. 'a' indicates no significant difference compared to 0 days / 0 freeze-thaw cycles, and 'b' indicates a significant difference compared to 0 days / 0 freeze-thaw cycles (p < 0.05).
[0044] Figure 7The stability and freeze-thaw stability of DNA-loaded glycosylated liposomes in Test Example 2 of this invention were analyzed at -20°C, 4°C, and 30°C. One-way ANOVA was used to analyze the differences in CT values. 'a' indicates no significant difference compared to 0 days / 0 freeze-thaw cycles, and 'b' indicates a significant difference compared to 0 days / 0 freeze-thaw cycles (p < 0.05). Detailed Implementation
[0045] To better illustrate the present invention, various exemplary embodiments of the present invention are now described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0046] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. This specification and its embodiments are merely exemplary.
[0047] The terms "comprising," "including," "having," and "containing" used in this article are open-ended, meaning they include but are not limited to. Unless otherwise specified, all reagents used below are commercially available reagents, and the chemical reagents used are of analytical grade or higher.
[0048] In the following examples or comparative examples, the lectin-magnetic carrier coupling complex (CN 111253491 B) of Hotgen Biotech was used to enrich glycosylated liposomes; The Mini Kit extracts RNA from liposomes.
[0049] Example 1: Preparation of glycosylated liposomes.
[0050] The raw materials used include: amphiphilic lipid-PEG-glycosyl complex (e.g., DSPE-PEG2000-sialic acid, which was purchased from Xi'an Ruixi Biotechnology Co., Ltd., where the glycosyl group (sialic acid) can be replaced with galactose, glucose, chitosan, mannose, fucose, fucoidan, and has similar effects), phospholipids, cholesterol, cationic lipids, and aqueous phase: various miRNAs.
[0051] The liposome synthesis method is as follows: Cholesterol, lecithin, cationic lipid SM-102 (purchased from Xi'an Ruixi), and DSPE-PEG2000-sialic acid were added to anhydrous ethanol in a molar ratio of 7:6:6:1, with concentrations of 4.2 mM, 3.6 mM, 3.6 mM, and 0.6 mM, respectively. The mixture was shaken and stirred to obtain the lipid phase. Separately, 1.05 g of citric acid monohydrate and 1.47 g of sodium citrate dihydrate were weighed and dissolved in 50 ml of ultrapure water, respectively. 33 ml of the citric acid solution and 17 ml of the sodium citrate solution were mixed, and the pH was adjusted to 4.0 with sodium hydroxide. Ultrapure water was added to a final volume of 100 ml. A solution of artificially synthesized RNA (hsa-miR-16: UAGCACGUAAAUAUUGGCG (SEQ ID NO:8)) was prepared using citrate buffer to a final volume of 10 ml. 13 The resulting solution was an aqueous phase. In a smart liposome synthesizer S1, the lipid and aqueous phase parameters were set to a flow rate ratio of 1:3, with a total flow rate of 12 ml / min. The product was collected, and the resulting homogeneous nanoliposomes were centrifuged at 3000 × g for 10 min using a 10 kDa ultrafiltration tube until the original volume was reduced to 1 / 4. PBS was added to the original volume, and ultrafiltration was repeated three times. The final ultrafiltration was concentrated using a buffer solution containing 0.5 M trehalose. The ultrafiltered liquid was collected and stored at -20°C.
[0052] Characterization of liposomes: The morphology of liposomes was observed using transmission electron microscopy, such as... Figure 1 As shown in Figure A, the product is a uniformly sized monolayer membrane structure with a particle size of 100-200 nm, meeting the standards for liposomes. The product was analyzed using a nanoparticle tracking analyzer, and the results are as follows: Figure 2 As shown, the particle size is 100–200 nm, and the concentration is 5.9 × 10⁻⁶. 10 particles / mL;
[0053] Comparative Example 1
[0054] The difference from Example 1 is that the molar ratio of cholesterol, lecithin, SM-102 and DSPE-PEG2000-sialic acid is 20:6:6:1.
[0055] Transmission electron microscopy revealed that when the molar ratio of cholesterol in the lipid phase exceeded 60%, an abnormal multilayer membrane structure was formed, such as... Figure 1 As shown in B.
[0056] Comparative Example 2
[0057] The difference from Example 1 is that the molar ratio of cholesterol, lecithin, SM-102 and DSPE-PEG2000-sialic acid is 3:6:6:1.
[0058] Transmission electron microscopy revealed that when the molar percentage of cholesterol in the lipid phase was less than 20%, an abnormal multilayer membrane structure was formed, such as... Figure 1 As shown in C.
[0059] Comparative Example 3
[0060] The difference from Example 1 is that the lipid phase and aqueous phase parameters were set at a flow rate ratio of 1:2 and a total flow rate of 12 ml / min. Transmission electron microscopy observation of the liposome morphology revealed that the liposome vesicles were smaller and more clustered together. Figure 1 D).
[0061] Comparative Example 4
[0062] The difference from Example 1 is that DSPE-PEG2000-sialic acid was not added to the liposomes; instead, cholesterol, lecithin, and SM-102 were added to anhydrous ethanol in a molar ratio of 7:6:6 for preparation.
[0063] Normal glycan liposomes from Example 1 and non-glycan liposomes from Comparative Example 3 were extracted using GlyExo-Capture technology, and then... The Mini Kit was used to extract RNA and detect the miR-16 content. Results showed that the extraction efficiency of non-glycan liposomes was significantly lower than that of glycan liposomes (P < 0.05), and the miR-16 content detected in non-glycan liposomes was only 0.59% of that in normal glycan liposomes. Figure 3 A).
[0064] Comparative Example 5
[0065] The difference from Example 1 is that SM-102 is not added to the liposomes. Instead, cholesterol, lecithin and DSPE-PEG2000-sialic acid are added to anhydrous ethanol in a molar ratio of 7:12:1 for preparation.
[0066] RNA was directly extracted from the SM-102-free glycan liposomes of Comparative Example 5 and the glycan liposomes of Example 1, and then the miR-16 content was detected. The results showed that the miR-16 content detected in the SM-102-free glycan liposomes of Comparative Example 5 was only 8.51% of that in the glycan liposomes of Example 1. Figure 3 B).
[0067] Test Example 1: Performance Validation of Glycosylated Liposome Extraction Using the Sugar Capture Method
[0068] Standard curve for liposomes: The product synthesized in Example 1 was serially diluted 10-fold with 0.5M trehalose solution. Glycosylated liposomes were enriched using GlyExo-Capture extracellular vesicle extraction reagent (using the lectin-magnetic carrier coupling complex of CN 111253491 B), and then separately... Mini Kit Reagent Extraction 10 8 -10 2 Nucleic acid in liposomes at a particle / mL concentration; the obtained RNA / DNA was validated by RT-qPCR / qPCR and a standard curve was plotted.
[0069] The RT reaction system in this experiment is as follows:
[0070] reaction system Volume (μL) Reverse transcription primers (20 μM) 1 5× Reverse Transcription Buffer 2 Poly A polymerase (5 U / μL) 0.5 Reverse transcriptase (200 U / μL) 0.5 ATP (10mM) 0.5 dNTPs (10mM) 0.5 RNA template 5 Total volume 10
[0071] The RT reaction conditions in this experiment are as follows:
[0072] Reaction conditions Time (minutes) 42℃ 15 85℃ 1 4℃ ∞
[0073] In this experiment, the qPCR reaction was performed on an ABI 7500, and the reaction system and conditions are as follows:
[0074] reaction system
[0075] reaction system Volume (μL) 2×qPCR reaction solution 12.5 Forward primer (10 μM) 2 Reverse primer (10 μM) 2 Probe (10μM) 1 Rox 0.5 Nuclease-free water 2 cDNA 5 Total volume 25
[0076] Reaction conditions
[0077]
[0078] The primer sequences used in the RT-qPCR program are as follows:
[0079]
[0080] Standard curve
[0081] The standard curve of miR-16 liposomes diluted with 0.5M trehalose solution is shown below. Figure 4 As shown in A and 4B Figure 4 The standard curve equation for A is Y = -3.269*X + 38.34, R 2 =0.9991, indicating that the concentration and CT value have a high linear correlation, that is, the concentration gradient of the synthesized liposomes is strictly positively correlated with the loaded nucleic acid, and the amplification efficiency is ≈103.8%, and qPCR can detect the nucleic acid inside the liposomes normally.
[0082] To test the performance of glycosylated liposomes as a reference, the miR-16-loaded liposomes from Example 1 were mixed with negative serum at a ratio of 1:9, followed by 10-fold serial dilutions with negative serum. 10 liposomes were then extracted using GlyExo-Capture extracellular vesicle extraction reagent. 8 -10 2 RNA from liposomes at a particle / mL concentration was used for RT-qPCR, and the resulting data were used to plot a standard curve equation: Y = -3.259*X + 39.56, with a correlation coefficient R. 2 =0.9993, indicating that there is a strict positive correlation between the nucleic acid concentration gradient inside the liposomes in serum.
[0083] Liposome encapsulation efficiency
[0084] To test the efficiency of liposome encapsulation of nucleic acids, the 10 samples from Example 1 were first tested. 5 The theoretical concentration of hsa-miR-16 loaded in liposomes (particles / mL) was directly tested by RT-qPCR. Additionally, 10... 5 Liposomes at a particle / mL concentration, using The Mini Kit was used to extract nucleic acids from liposomes for RT-qPCR; CT values were obtained for both methods, and the concentration difference was calculated as 2. -△CT The encapsulation efficiency of RNA by liposomes was calculated (i.e., encapsulation rate, which is the ratio of the amount of nucleic acid extracted from liposomes to the theoretical initial amount of nucleic acid). The CT values were converted to the corresponding nucleic acid concentrations, and the encapsulation efficiency of the liposomes in Example 1 was calculated to be 83.1%. This may be because the liposomes contain cationic lipids that bind to negatively charged nucleic acids, resulting in a higher encapsulation rate.
[0085] The effect of GlyExo-Capture method on the extraction of glycosylated liposomes
[0086] To evaluate the effectiveness of the GlyExo-Capture method in extracting glycosylated liposomes, glycosylated liposomes from Example 1 and non-glycosylated liposomes from Comparative Example 4 were captured using the GlyExo-Capture method (a lectin-magnetic carrier coupling complex of CN 111253491 B). Then, the liposomes were extracted using...
[0087] The Mini Kit extracts nucleic acid, performs RT-qPCR detection, and the obtained CT value is substituted into the standard curve to convert it into nucleic acid concentration for analysis of capture efficiency (capture efficiency = amount of nucleic acid captured by GlyExo-Capture method / amount of nucleic acid extracted after complete lysis of the same amount of liposomes).
[0088] The calculation showed that the sugar capture method had a capture efficiency of 85.6% for glycosylated liposomes in Example 1, but only 18.7% for non-glycosylated liposomes. This indicates that the sugar capture method is highly specific for glycosylated liposomes, while the low extraction efficiency of non-glycosylated liposomes is due to non-specific adsorption rather than targeted binding, proving that the sugar capture method is ineffective for non-glycosylated liposomes.
[0089] Accuracy
[0090] Take 10 of Example 1 5 Liposomes at a concentration of particles / mL were extracted 10 times using the same batch of GlyExo-Capture extraction reagent (lectin-magnetic carrier coupling complex of CN 111253491 B). The results are as follows: Figure 5 The mean and standard deviation of 10 test results were calculated, and the coefficient of variation (CV) was calculated to be 0.7%, indicating that the liposomes have good precision.
[0091] stability
[0092] To test the stability of the liposomes, 10 samples from Example 1 were taken. 5 Liposomes at a particle / mL concentration were aliquoted into 1.5mL EP tubes, 1.1mL per tube, and divided into four treatment groups: -20℃, 4℃, 30℃, and a freeze-thaw group. The -20℃ group had eight time points: 0 days, 7 days, 15 days, 30 days, 60 days, 90 days, 180 days, and 360 days. The 4℃ group had eight time points: 0 days, 7 days, 15 days, 30 days, 60 days, 90 days, 180 days, and 360 days. The 30℃ group had eight time points: 0 days, 2 days, 4 days, 6 days, 8 days, 10 days, 12 days, and 1... Over four days and eight time points, the freeze-thaw group was removed from -20°C and placed at 30°C every 2 hours, and tested for 0, 2, 4, 6, 8, 10, 12, and 14 freeze-thaw cycles, respectively. The control group consisted of EVs of the same concentration extracted from serum by ultracentrifugation, and the negative control group consisted of nuclease-free water. Nucleic acid was extracted from the liposomes using the GlyExo-Capture technique described above and subjected to RT-qPCR / qPCR reactions under the same reaction system and conditions as above.
[0093] One-way ANOVA was used to analyze the differences in detected CT values. The results are as follows: Figure 6The results showed that, compared with day 0, the CT values of miR-16 in glycosylated liposomes at -20℃ were not significantly different from those at day 0 at 7, 15, 30, 60, 90, 180, and 360 days, indicating that liposomes could be stably preserved for at least 360 days at -20℃. In contrast, the CT values of miR-16 in the EVs control group showed significant differences after 90 days compared to day 0, indicating that EVs degraded significantly after 90 days. Compared with day 0, the CT values of miR-16 in glycosylated liposomes at 4℃ did not show significant differences until after 180 days, while the EVs group showed significant differences after day 7, indicating that the CT values at 4℃... Under the specified conditions, glycan liposomes can be stably stored for at least 90 days, while EVs degrade within 7 days. Compared with day 0, the CT value of miR-16 in glycosylated liposomes at 30℃ only showed a significant difference after day 10, while the EVs group showed a significant difference after day 2. This indicates that at 30℃, glycan liposomes can be stably stored for at least 8 days, while EVs degrade within 2 days. Compared with the 0th freeze-thaw cycle, the CT value of miR-16 in glycosylated liposomes only showed a significant difference after the 14th freeze-thaw cycle, while the EVs group showed a significant difference after 2 freeze-thaw cycles. This indicates that glycan liposomes can withstand at least 12 freeze-thaw cycles, while EVs cannot be repeatedly freeze-thawed. In conclusion, glycosylated liposomes loaded with miR-16 exhibit superior stability compared to natural EVs at -20℃, 4℃, 30℃, and within a certain range of freeze-thaw cycles.
[0094] Example 2: Glycosylated liposomes loaded with DNA
[0095] The difference from Example 1 is that 10 13 Replace copies / ml RNA(hsa-miR-16) with 10 13 artificially synthesized DNA copies / ml: cel-miR-39 (SEQ ID NO:9:
[0096] GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACCAAGCTGATTTACACCCGGTGACTCTGTTCTT).
[0097] Test Example 2: Performance Analysis of DNA-Loaded Glycosylated Liposomes
[0098] The standard curve test, liposome encapsulation efficiency test, stability, and reference sample performance analysis were performed in Implementation Case 2. The results are as follows:
[0099] Standard curve
[0100] The glycosylated liposomes from Example 2, which encapsulate DNA, were serially diluted 10-fold with pure water and extracted using GlyExo-Capture extracellular vesicle extraction reagent. 8 -10 2 DNA from glycosylated liposomes at a particle / mL concentration was used for qPCR, and a standard curve was calculated using CT values. The results are as follows: Figure 4 As shown in C, the standard curve formula is: Y = -3.186*X + 41.13, R 2 =0.9989, indicating that the concentration of liposomes encapsulating nucleic acids is strictly positively correlated with their concentration.
[0101] Liposome DNA Encapsulation Efficiency Assay
[0102] Glycosylated liposomes loaded with cel-miR-39 prepared according to Example 2 (10 5 (particles / mL) were directly used for qPCR testing, and another 10 were taken. 5 Glycosylated liposomes prepared in Example 2 with particles / mL were used The Mini Kit was used to extract internal DNA for qPCR; the CT values of the two methods were calculated, based on the concentration difference = 2. -△CT Calculate the efficiency of liposome encapsulation of DNA.
[0103] The encapsulation efficiency was calculated to be 81.6% by converting the CT value to the corresponding nucleic acid concentration, which is consistent with the efficiency of loading miRNA.
[0104] Accuracy of DNA liposome encapsulation:
[0105] Take 10 5 The glycosylated liposomes prepared in Example 2 were extracted 10 times using the same batch of GlyExo-Capture extraction reagent.
[0106] The results are as follows Figure 5 The mean and standard deviation of 10 test results were calculated, and the coefficient of variation (CV) was calculated to be 0.4%, indicating that the liposome extraction detection has good precision.
[0107] Stability of DNA-encapsulated liposomes :
[0108] Take 10 5The liposomes prepared in Example 2 were aliquoted into 1.5 mL EP tubes, 1.1 mL per tube, and divided into four treatment groups: -20℃, 4℃, 30℃, and a freeze-thaw group. The -20℃ group had eight time points: 0 days, 7 days, 15 days, 30 days, 60 days, 90 days, 180 days, and 360 days. The 4℃ group had eight time points: 0 days, 7 days, 14 days, 30 days, 60 days, 90 days, 180 days, and 360 days. The 30℃ group had eight time points: 0 days, 2 days, 4 days, 6 days, 8 days, 10 days, 12 days, and 14 days. At 8 time points throughout the day, the freeze-thaw group was taken out from -20℃ and placed at 30℃ every 2 hours, and tested for 0, 2, 4, 6, 8, 10, 12 and 14 freeze-thaw cycles respectively. The positive control was the same concentration of EVs (gold standard) extracted from serum by ultracentrifugation. The negative control was nuclease-free water. Nucleic acid inside the liposomes was extracted by the above GlyExo-Capture extraction method and qPCR was performed. The reaction system and conditions were the same as above.
[0109] Similarly, one-way ANOVA was used to analyze the differences in the detected CT values, and the results were as follows: Figure 7 The results showed that, compared to day 0, the CT value of cel-miR-39 in glycosylated liposomes loaded with cel-miR-39 DNA at -20℃ was not significantly different at 7, 15, 30, 60, 90, 180, and 360 days, indicating that DNA-loaded glycan liposomes could be stably preserved for at least 360 days at 30℃. Compared to day 0, the CT value of cel-miR-39 in glycosylated liposomes loaded with cel-miR-39 DNA at 4℃ was not significantly different up to 180 days, indicating that DNA-loaded glycan liposomes could be stably preserved for at least 360 days at 4℃. Glycosyl liposomes loaded with cel-miR-39 DNA showed stable storage for at least 180 days. Compared to day 0, the CT value of cel-miR-39 in glycosylated liposomes loaded with cel-miR-39 DNA showed no significant difference until day 4, indicating that DNA-loaded glycosyl liposomes could be stably stored for at least 4 days at 30°C. Compared to day 0, the CT value of cel-miR-39 in glycosylated liposomes loaded with cel-miR-39 DNA showed no significant difference after 14 freeze-thaw cycles, indicating that cel-miR-39 DNA-loaded glycosyl liposomes could withstand at least 14 freeze-thaw cycles. In summary, miR-16-loaded glycosyl liposomes exhibited superior stability compared to natural EVs at -20°C, 4°C, 30°C, and a certain range of freeze-thaw cycles. DNA-loaded glycosyl liposomes also exhibited excellent stability at -20°C, 4°C, 30°C, and a certain range of freeze-thaw cycles.
[0110] The foregoing description illustrates and describes preferred embodiments of the present invention. As previously stated, it should be understood that the present invention is not limited to the forms disclosed herein and should not be construed as excluding other embodiments. It can be used in various other combinations, modifications, and environments, and can be altered within the scope of the inventive concept described herein through the foregoing teachings or techniques or knowledge in related fields. Any modifications and variations made by those skilled in the art that do not depart from the spirit and scope of the present invention should be within the protection scope of the appended claims.
Claims
1. A type of glycosylated extracellular vesicle, characterized in that, It includes a glycosylated lipid extracellular membrane and nucleic acids encapsulated therein, wherein the glycosylated lipid extracellular membrane comprises cholesterol, phospholipids, cationic lipids and amphiphilic lipid-PEG-glycosylated complexes, with a molar ratio of (6-10):(6.5-4.5):(6.5-4.5):
1.
2. The glycosylated extracellular vesicle according to claim 1, characterized in that, The molar ratio of cholesterol is 30%-50%, the molar ratio of phospholipids and cationic lipids is 65%-45%, and the molar ratio of amphiphilic lipid-PEG-glycosyl complex is 5%. And / or, the molar ratio of cholesterol, phospholipids, cationic lipids and amphiphilic lipid-PEG-glycosyl complex is 7:6:6:
1.
3. The glycosylated extracellular vesicle according to claim 1, characterized in that, The nucleic acid is DNA or RNA, optionally miRNA or DNA, optionally selected from one or more of hsa-miR-16, hsa-miR-93, hsa-miR-211, hsa-miR-26a, hsa-miR-191, hsa-miR-320a, U6, gapdh, actin, 18S rRNA, cel-miR-39, and cel-miR-54.
4. The glycosylated extracellular vesicles according to any one of claims 1 to 3, characterized in that, In the amphiphilic lipid-PEG-glycosyl complex, the amphiphilic lipid is selected from one of DSPE, DOPE, and SA, and optionally the amphiphilic lipid is DSPE; And / or, in the amphiphilic lipid-PEG-glycosyl complex, the molecular weight of PEG (polyethylene glycol) is 350 to 5000, and optionally PEG2000; And / or, in the amphiphilic lipid-PEG-glycosyl complex, the glycosyl group is selected from one or more of sialic acid, galactose, glucose, chitosan, mannose, fucose, and fucoidan; And / or, in lipid phase substances, the phospholipids are lecithin; And / or, in the lipid phase, the cationic lipid is selected from one or more of DOTAP, SM102, ALC-0315, Dlin-MC3-DMA, and DOTMA, optionally SM102.
5. A method for preparing glycosylated extracellular vesicles according to any one of claims 1 to 4, characterized in that, This includes forming glycosylated extracellular vesicles from lipid and aqueous phases in a liposome synthesizer; The lipid phase consists of cholesterol, phospholipids, cationic lipids, and amphiphilic lipid-PEG-glycosyl complexes added to anhydrous ethanol in a molar ratio to obtain the lipid phase. The aqueous phase consists of adding nucleic acids to a buffer solution with a pH of 4–6 to obtain the aqueous phase.
6. The preparation method according to claim 5, characterized in that, The pH of the aqueous phase is 4–6; Optionally, in the aqueous phase, the nucleic acid concentration is 10. 12 ~10 14 copies / ml, optionally 10 13 copies / ml; Optionally, in the aqueous phase, the buffer solution is a citrate-sodium citrate buffer solution; Optionally, in the lipid phase, the molar ratio of cholesterol, phospholipids, cationic lipids and amphiphilic lipid-PEG-glycosyl complex is (6-10):(6.5-4.5):(6.5-4.5):1, and the concentration of amphiphilic lipid-PEG-glycosyl complex in the lipid phase is optionally 0.5-0.8 mM, optionally 0.6 mM; Optionally, the volume ratio of the lipid phase to the aqueous phase is 1:3 to 1:4, and optionally 1:
3.
7. The preparation method according to claim 5 or 6, characterized in that, In the liposome synthesizer, the flow rate ratio of the lipid phase to the aqueous phase is 1:3 to 1:4, and optionally 1:3; And / or, in the liposome synthesizer, the total flow rate is 10–14 ml / min, optionally 12 ml / min.
8. The preparation method according to any one of claims 5 to 7, characterized in that, After liposome synthesis, they are stored in a buffer solution containing trehalose.
9. The preparation method according to any one of claims 5 to 8, characterized in that, After liposome synthesis, impurities are removed by ultrafiltration and washing.
10. The use of a glycosylated extracellular vesicle according to any one of claims 1 to 4 or a glycosylated extracellular vesicle prepared by any one of claims 5 to 9 as a reference or quality control product for glycosylated exosomes.
Citation Information
Patent Citations
A lectin-magnetic carrier coupling complex for isolating glycosylated exosomes from clinical samples
CN111253491B