Application of SNP molecular marker in evaluating the first-time calving success rate of dairy cows and assisting in breeding

Abstract

The application discloses application of a SNP molecular marker in evaluation of postpartum first mating success rate of a dairy cow and in auxiliary breeding, and belongs to the technical field of biological breeding of animal husbandry. The SNP molecular marker is a base G at the 564th position of a sequence shown in SEQ ID NO: 1 or a base A at the 564th position of a sequence shown in SEQ ID NO: 2, and is located on a GUSB gene. The postpartum first mating success rate of a dairy cow with a genotype AA of the SNP molecular marker is better. The postpartum first mating success rate of a dairy cow can be accurately evaluated by detecting the SNP molecular marker, and this is of great significance to improvement of dairy cow reproduction efficiency, shortening of a farrowing interval, reduction of feeding cost and promotion of efficient and sustainable development of the dairy industry.

Description

Technical Field

[0001] This invention relates to the field of livestock bio-breeding technology, specifically to the application of an SNP molecular marker in assessing the success rate of first mating after calving in dairy cows and in assisted breeding. Background Technology

[0002] Reproductive performance in dairy cows is a key trait affecting farm productivity and the sustainable development of the dairy industry, directly impacting calving interval, lactation cycle, and lifetime milk production. However, reproductive traits generally suffer from low heritability (h²≈0.05~0.15) and are difficult to improve. Furthermore, a significant genetic antagonism exists between reproductive traits and productive traits such as milk yield (correlation coefficient approximately -0.3), making genetic improvement of reproductive traits very slow under traditional breeding methods. In actual production, insufficient reproductive performance leads to prolonged non-pregnant periods and increased calving intervals, not only reducing the cow's productive lifespan and lifetime milk production but also significantly increasing feeding and culling costs, adversely affecting farm economics.

[0003] With the development of molecular breeding technology, association analysis and selection breeding using genome-wide single nucleotide polymorphism (SNP) markers have become important methods for genetic improvement of reproductive traits. Genotyping can screen for key molecular markers related to reproductive efficiency, enabling early and accurate selection and improving breeding efficiency and economic benefits. However, current research lacks clarity regarding the functional molecular markers affecting the success rate of first mating in dairy cows, and stable genetic markers that can be directly applied to molecular breeding are still scarce. Summary of the Invention

[0004] The purpose of this invention is to provide the application of SNP molecular markers in assessing the success rate of first mating in dairy cows, thereby providing technical support for this trait.

[0005] The technical solution of this invention is described in detail below:

[0006] In a first aspect, the present invention provides the application of SNP molecular markers in assessing the success rate of first mating after calving in dairy cows. The SNP molecular marker is located on the GUSB gene and is chr25:g 27913684G>A, that is, the 564th base of the sequence shown in SEQ ID NO:1 is G or the 564th base of the sequence shown in SEQ ID NO:2 is A. The reference sequence of the GUSB gene is NCBI Gene ID: 515687. Dairy cows with the SNP molecular marker genotype AA have a higher success rate of first mating after calving than individuals with the genotype GG.

[0007] Optionally or preferably, the cow is a Holstein cow.

[0008] Secondly, this invention provides the application of a reagent for detecting SNP molecular markers in assessing the success rate of first mating after calving in dairy cows. The SNP molecular marker is located on the GUSB gene and is chr25:g 27913684G>A, that is, the 564th base G in the sequence shown in SEQ ID NO:1 or the 564th base A in the sequence shown in SEQ ID NO:2. The reference sequence of the GUSB gene is NCBI GeneID: 515687. Dairy cows with the SNP molecular marker genotype AA have a higher success rate of first mating after calving than individuals with the genotype GG.

[0009] Optionally or preferably, the reagent includes primer pairs, the nucleotide sequences of which are shown in SEQ ID NO:3~4.

[0010] Compared with the prior art, the present invention has the following beneficial effects:

[0011] The SNP molecular marker identified in this invention as closely related to the success rate of first mating after calving is chr25:g 27913684G>A. Studies have shown that the dominant genotype of chr25:g 27913684G>A is AA, and individuals carrying this dominant genotype exhibit better first mating success rates. Accurately assessing the success rate of first mating in dairy cows by detecting this SNP molecular marker is of great significance for improving dairy cow reproductive efficiency, shortening calving intervals, reducing feeding costs, and promoting the efficient and sustainable development of the dairy industry. Attached Figure Description

[0012] Figure 1 Manhattan plot of GWAS results for the first mating success rate of Holstein cows after calving in Example 1.

[0013] Figure 2 This is a GWAS result QQ-plot of the first insemination success rate of Holstein cows after calving in Example 1.

[0014] Figure 3 The results of the locuszoom analysis of candidate region sites in Example 1 are shown.

[0015] Figure 4 In Example 2, six individuals were randomly selected, and primer amplification was used to verify the electrophoresis results. The target band was the spot amplification band.

[0016] Figure 5 This is the Sanger sequencing data of the chr25:g 27913684G>A site in six individuals from Example 2. Detailed Implementation

[0017] To enable those skilled in the art to better understand the present application, the present application will be clearly and completely described below with reference to embodiments and accompanying drawings. Obviously, the described embodiments are only some embodiments of the present application, and not all embodiments. Based on the embodiments of the present application, all other embodiments obtained by those of ordinary skill in the art without creative effort should fall within the scope of protection of the present application. Unless otherwise specified, the instruments and reagents used in the embodiments are all from commercial channels.

[0018] Example 1: Screening and identification of SNP molecular markers related to the success rate of first marriage after childbirth

[0019] 1. DNA sample collection and gene data analysis

[0020] Blood samples were collected from 1,800 Holstein cows in 5 large-scale farms. The location of the farms and the number of samples collected from each farm are shown in Table 1.

[0021] Table 1. Collection locations and number of samples from Holstein cows

[0022]

[0023] 2. The collected blood samples were sent to Shanghai Newgene Technology Co., Ltd. for GGP Bovine 100K SNP chip detection. The valid data obtained after deleting SNP sites with no detection results were used for subsequent whole-genome SNP genotype quality control analysis.

[0024] 3. SNP genotyping quality control: During the SNP genotyping quality control process, individuals or loci that meet the following criteria are deleted: loci with a genotyping deletion count >10%, loci with a minimum allele frequency below 0.01, and loci with a Hardy-Weinberg test p-value <0.000001. Data will be deleted if any of the above three conditions are met.

[0025] 4. Genotype filling: Based on the resequencing data of 1,800 Holstein cattle collected in the previous period, the Hidden Markov Model (HMM) algorithm was used, and the BEAGLE software was used to fill the 100K chip data sequentially according to chromosomes to the whole genome sequence data level.

[0026] 5. Genome-wide association analysis: A GWAS analysis was performed to examine the relationship between genome-wide SNP genotypes and litter phenotypic traits. The GWAS analysis model was as follows: ;in y It is a vector of phenotypic traits; b This is a fixed-effects vector, including influencing factors such as year of birth, season of birth, year of calving, season of calving, inseminator, and parity. XThis is the design matrix corresponding to these fixed effects, used to vectorize the fixed effects. b With phenotypic vectors y Related; S a For each individual, there is an additive genotype encoding vector for the SNP, where genotypes AA, Aa, and aa are encoded as 0, 1, and 2, respectively. β a This represents the fixed additive genetic effect at this SNP locus; 'a' represents an additive polygenic effect. Z a It is its corresponding design matrix; PE For permanent environmental effects, Z pe It is its corresponding design matrix; e It is a random residual vector, which usually follows a normal distribution.

[0027] 6. Identification of Significant SNPs: The Bonferroni correction was used to adjust the significance level (P-value) of the GWAS analysis results of the success rate of first mating after calving in Holstein cattle. The Bonferroni correction method was used to control for multiple tests and correct the GWAS results, with the significance threshold set at 8 × 10⁻⁶. -8 Key SNPs significantly associated with the genetic effect of first mating success rate after calving in Holstein cattle were identified using GWAS results. Manhattan plots and QQ plots were then constructed using the CMplot package in R software. SNPs above the threshold line on the Manhattan plot were identified as SNPs significantly associated with the first mating success rate after calving in Holstein cattle.

[0028] Two SNP loci closely associated with the success rate of first mating after birth were identified, one of which is chr25:g27913684G>A (GUSB gene). The results showed that the dominant genotype of this SNP is AA, and individuals carrying this dominant genotype have a better success rate in first mating.

[0029] Table 2. Genotypes of SNP loci associated with postpartum first-time marriage success rate

[0030]

[0031] As shown in Table 2, when the SNP locus genotype is AA, the success rate of the first mating after calving is high, and it can be used as a molecular marker for screening superior individuals for reproduction.

[0032] Example 2: Validation of the correlation between SNP molecular markers and the success rate of first marriage after delivery

[0033] Primers were designed targeting the reference sequence (NCBI Gene ID: 515687) of the SNP marker chr25:g 27913684G>A. The primer sequences are shown below:

[0034] Upstream primer: TGGCGGAAGTTACTGGTATG, SEQ ID NO:3,

[0035] Downstream primer: CCGGCTGGTTACTACTTCAAG, SEQ ID NO:4.

[0036] Blood samples were collected from six Holstein cows in the validation group. Total DNA was extracted and used as a template. PCR amplification was performed using SEQ ID NO:3-4 as primers and the extracted genomic DNA as a template. The total reaction volume was 25 μL: 1 μL template DNA, 2.5 μL 10×Buffer (containing 15 mmol / L MgCl2), 2 μL dNTPs (2.5 mmol / L), 0.5 μL each of forward and reverse primers (12.5 pmol / μL), 0.5 μL Taq DNA polymerase (2.5 U / μL), and ultrapure water to a final volume of 25 μL. The amplification program was: 95℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 45 s, for a total of 35 cycles; final extension at 72℃ for 10 min. The agarose gel electrophoresis results of the DNA amplification products are shown below. Figure 4 After purification, the amplified products were genotyped using Sanger sequencing. The sequencing results are shown below. Figure 5 .

[0037] chr25:g 27913684G>A gene sequence

[0038] TGGCGGAAGTTACTGGTATGCAGTGAACGGACAATGAACTTCATTCAGGTGACCTGGTCCCGTCTAACAACGTAACTTTAGGATAGTCAGAACATGCACGTCTTTGAAAATCTGTTTATAATTATATGCCTAGGTCAGCTTTATAAAGTTTAAATCCCCTTTACAGGTGAACTCAAAAGCATTGCAAAGTGGTTTTGTGCAGTTCTAACATGTACTAAATTTCCCAGGAATAGGGACAGCATAAAAATCAAGGGAAGACACAGGTGGCTTAGTGGTAAAGAACCCGCCTGCTAAGCGGAAGATGCAGGTTGATCCCTGGGTCAGGAAGATCCCCTGGAGAAGGAAATGGCAACCCACTCCAGTATTCTTGCCTGGGAAATCCCAAGGACAGAGGAGCCTGGTGGGCTACAGCCCATGAGGTCGCAAAGAGTCGGACACGACTTAGCGACTAAACAATAACAGCAGGGCTTGGTTTTGACTGGAGCTCTGTCAGCCATGGCTCAGTGCCTCAGAAAAGAGCAGAACAGAGGGAAATGCTGCTCGCGGCACCACAGTCGCTGGCT GTGCTTTCCAGCTCTGTCATCAGCTTCTGTAGCTCTGTTTTCAGGGAGTTTCCCAGAAGGTGCAAGCGCCTGACTCTTTCAATGGGCCCTTCTGGAAAGTCAGGTCACAGATTTATGTATTCTTTGACAAATGTCTCTTCCTTATGTCAGTCAGGCCACGTCACTATCTTTTTTCTTTAATTTGAAGTTTTGGGTTAACTCCTCTGCATTTCATTTCAGGTGTGTCTAG GAGACACTTGGCTGAAATCATAATCTGGGTGGGTGAGTATCTTGTCCCCTAAATTGACCAGGGATGGATGCACCTGGGCTGGAAGCAGCCCACACCCACTGCAGGGCCCACCGCCACTCTCCCGTGGCTGCCAGGCAAGGCTGAGCTGGGCCAGCAGGCTGTGGTCTCAATGGGGACCAGCCCAGGCAAGCAGGAGCACTCACTTGAAGTAGTAACCAGCCGG, SEQ. ID NO:1, where the 564th base G is an SNP site, and the nucleotide sequence when the base at this site is A is shown in SEQ ID NO:2.

[0039] Blood samples were collected from 1000 Holstein cows in the validation group and sent to Shanghai NewQC for GGP Bovine 100K SNP chip analysis. SNPs without test results were removed, and the resulting valid data were used for subsequent genome-wide SNP genotypic quality control analysis. The actual phenotype of the first mating success rate was recorded for the control group. The results are shown in Table 3 below, indicating that the SNP genotype combinations corresponded consistently with the first mating success rate.

[0040] Table 3. Correlation between SNP molecular markers and the success rate of first marriage after delivery

[0041]

[0042] This article uses specific examples to illustrate the inventive concept in detail. The description of the above embodiments is only for the purpose of helping to understand the core idea of ​​the present invention. It should be noted that any obvious modifications, equivalent substitutions or other improvements made by those skilled in the art without departing from the inventive concept should be included within the protection scope of the present invention.

Claims

1. Use of a reagent for detecting a SNP molecular marker in the manufacture of a product for assessing the success of the first postpartum insemination in a dairy cow, characterized in that, The SNP molecular marker is located on the GUSB gene, is the base G at position 564 of the sequence shown in SEQ ID NO: 1 or the base A at position 564 of the sequence shown in SEQ ID NO: 2, and the postpartum first mating success rate of a cow with a SNP molecular marker genotype of AA is higher than that of a cow with a genotype of GG; the cow is a Holstein cow.

2. Use according to claim 1, characterized in that, The reagent comprises a primer pair, and the nucleotide sequences of the primer pair are shown in SEQ ID NOs: 3-4.

Images