Breeding method for polymerizing low-arsenic accumulation stable genetic loci of wheat grains

Abstract

The invention provides a breeding method for polymerizing low-arsenic accumulation stable genetic loci of wheat grains, relates to the technical field of crop genetic breeding, and aims to solve the food safety problem caused by arsenic accumulation of wheat grains in arsenic-polluted areas. The method is based on six stable genetic loci for controlling low-arsenic accumulation of wheat grains, and parent selection, hybridization and multi-generation screening are carried out in stages through a KASP molecular marker-assisted selection technology: individuals carrying at least one target locus dominant haplotype are screened in early generation; in the middle generation, two or more dominant haplotypes are aggregated, and phenotype verification is combined; the homozygous degree and genetic stability of sites are identified in an advanced generation, and finally a homozygous strain with low arsenic accumulation of grains and excellent agronomic characters is obtained through multi-environment verification. According to the method, accurate directional improvement of the low-arsenic accumulation character is realized, the breeding efficiency is improved, the hereditary stability and environmental adaptability of the character are ensured, and an effective technical scheme is provided for safe production of wheat in an arsenic-polluted area.

Description

Technical Field

[0001] This invention belongs to the field of crop genetics and breeding technology, and more specifically, it relates to a breeding method for low-arsenic accumulation stable genetic loci in aggregated wheat grains. Background Technology

[0002] Arsenic is a highly toxic and carcinogenic metalloid that can enter crops through contaminated soil and groundwater, threatening human health through the food chain. As one of the world's major food crops, wheat's accumulation of arsenic in its grains is directly related to food safety, posing a serious challenge to agricultural production and human health in arsenic-contaminated areas.

[0003] To reduce the impact of arsenic pollution, traditional methods such as soil chemical washing and high-concentration plant adsorption are time-consuming and labor-intensive. Meanwhile, the low-accumulation varieties that "pollutation-safe planting" relies on often have problems such as poor disease resistance, weak environmental adaptability, and low yield, making it difficult to meet actual production needs.

[0004] In terms of breeding technology, traditional breeding relies on phenotypic identification, which is not only time-consuming and inefficient, but also makes it difficult to accurately screen genetic loci that control low arsenic accumulation. Although some studies have attempted to elucidate the genetic mechanisms of arsenic accumulation in wheat grains, most of the identified genetic loci have weak effects, insufficient stability, or are only effective in specific environments. There is a lack of stable genetic loci and corresponding molecular markers that can be directly used in breeding practices. At the same time, existing studies have not paid enough attention to the aggregation effect of dominant alleles, making it difficult to achieve targeted and efficient improvement of the low arsenic accumulation trait in wheat grains.

[0005] Furthermore, while marker-assisted selection (MAS) technology has made precision breeding possible, the lack of clear stable genetic loci, standardized molecular markers (such as KASP markers), and clear generation screening criteria limits its application in low arsenic accumulation breeding of wheat and prevents the efficient and targeted improvement of target traits.

[0006] Therefore, it is urgent to establish a breeding method based on clearly defined and stable genetic loci and standardized molecular markers to achieve precise and efficient breeding of wheat grains with low arsenic accumulation traits, and to solve the problem of safe wheat production in arsenic-polluted areas. Summary of the Invention

[0007] To address the aforementioned technical problems, this invention provides a breeding method for aggregating stable genetic loci with low arsenic accumulation in wheat grains.

[0008] A breeding method for aggregating stable genetic loci for low arsenic accumulation in wheat grains includes the following steps:

[0009] 1) Identification of dominant haplotypes of arsenic accumulation genetic loci in wheat germplasm materials: Using the following molecular markers and relying on the KASP genotyping system, dominant haplotypes (low arsenic accumulation haplotypes) of genetic loci were identified. Genotype was determined based on fluorescence signals: If a FAM signal (FAM fluorescent tag sequence GAAGGTGACCAAGTTCATGCT) was detected, the haplotype was identified as homozygous for the dominant haplotype; if a HEX signal (HEX fluorescent tag sequence GAAGGTCGGAGTCAACGGATT) was detected, the haplotype was identified as homozygous for the inferior haplotype; if a FAMHEX signal was detected, the haplotype was identified as heterozygous. The specific primer sequences for identification are shown below:

[0010] AX-110393422: F1 is GAAGGTGACCAAGTTCATGCTGTTCGCATCCTTCATTTCATCTG, F2 is GAAGGTCGGAGTCAACGGATTGTTCGCATCCTTCATTTCATCTA, and R is CCATGGATCCGAACAAAATGGA;

[0011] AX-110370420: F1 is GAAGGTGACCAAGTTCATGCTGGATTTAGGCTAGTTAGATGGTATGC, F2 is GAAGGTCGGAGTCAACGGATTGGATTTAGGCTAGTTAGATGGTATGT, and R is CTAACTAGAAGACCATCAGCGGCA;

[0012] AX-109339465: F1 is GAAGGTGACCAAGTTCATGCTGTTTCGGCCATTTGGTTAAATTC, F2 is GAAGGTCGGAGTCAACGGATTGTTTCGGTTAAATTTG, and R is CAGATATTCGGCGAATTTCAGC;

[0013] AX-109455432: F1 is GAAGGTGACCAAGTTCATGCTGAGTAGAGTCAAGTGAGAAC, F2 is GAAGGTCGGAGTCAACGGATTGAGTAGAGTCAAGTGAGAAT, and R is TGCGCTGGGTTGAGGAGGAG;

[0014] AX-109359598: F1 is GAAGGTGACCAAGTTCATGCTGAGACCGTAGTTGTTTGGACCG, F2 is GAAGGTCGGAGTCAACGGATTGAGACCGTAGTTGTTTGGACCA, and R is AGCATCTGCATAGCTCTTCTGC;

[0015] AX-111655266: F1 is GAAGGTGACCAAGTTCATGCTGAGCGGACCGAATAGATAAGGT, F2 is GAAGGTCGGAGTCAACGGATTGAGCGGACCGAATAGATAAGGC, and R is GGCTATAACATGGGCCCATC.

[0016] 2) Parental selection: Wheat materials carrying dominant haplotypes of stable low arsenic accumulation loci were selected as parents. The stable genetic loci were selected from at least one of AX-110393422, AX-110370420, AX-109339465, AX-109455432, AX-109359598, and AX-111655266.

[0017] 3) Hybridization and early generation screening: The parents from step 2) are hybridized to obtain the F1 generation. In the F2-F3 generations, individuals carrying at least one dominant haplotype at a target locus are screened using the KASP marker detection method.

[0018] 4) Intermediate generation aggregation: In the F3-F5 generation, individuals carrying two or more dominant haplotypes are screened by KASP marker detection. Combined with phenotypic verification (seed arsenic content determination), individuals with the target genotype are retained. The more dominant haplotypes that aggregate, the lower the arsenic content in the grain. Conversely, the more inferior haplotypes that contain, the higher the arsenic content in the grain.

[0019] 5) High-generation stabilization: KASP marker homozygosity was determined for F6 and above materials to screen families with homozygous genetic loci and no linkage of harmful genes in the upstream and downstream 5Mb intervals;

[0020] 6) Multi-environment verification: The families from step 5) were planted in arsenic-contaminated and non-contaminated soils respectively. Through phenotypic identification and genotypic verification, homozygous lines with stable low arsenic accumulation in grains and excellent agronomic traits were screened.

[0021] Preferably, in step 2), the parental selection needs to be verified by KASP marker detection to ensure that the parent carries at least one dominant haplotype homozygous or heterozygous genotype.

[0022] Preferably, in step 3), the early generation screening is based on the KASP marker detection results, and only the individuals with the selected target genotype are subjected to phenotypic verification to reduce the cost of invalid phenotypic identification.

[0023] Preferably, in step 4), “two or more dominant haplotypes” include AX-109339465 (2D) and AX-111655266 (6B), where AX-111655266 is the major site controlling low arsenic accumulation.

[0024] Preferably, in step 5), homozygosity identification is achieved by KASP marker detection, requiring the target locus homozygosity to be ≥95%.

[0025] Preferably, step 6) includes multi-environmental validation, including arsenic-contaminated soil (for phenotypic identification) and uncontaminated soil (for genetic stability validation), to ensure that the low-arsenic trait is stably expressed under different environments.

[0026] Preferably, in step 6), the agronomic traits that are excellent include plant height, plant type, number of ears per mu, number of grains per ear, weight of 100 grains and weight of 1000 grains, etc., which meet the breeding objectives and are also resistant to multiple diseases.

[0027] Preferably, the KASP marker sequence, PCR reaction parameters, and genotype-phenotype association of the stable genetic locus are all based on the information recorded in the disclosure document.

[0028] Preferably, the entire breeding process combines molecular marker-assisted selection and phenotypic identification. Early generations (F2-F3) are mainly detected by KASP markers, while higher generations (F6 and above) combine phenotypic verification to ensure trait stability.

[0029] Preferably, the final homozygous line must be verified for genetic stability by KASP markers to ensure that the homozygosity of the dominant haplotype is ≥95% and that the low arsenic accumulation trait in the grain can be stably inherited.

[0030] Compared with the prior art, the present invention has the following beneficial effects:

[0031] 1. Improve breeding efficiency: By combining molecular marker-assisted selection (MAS) with KASP marker detection technology, targeted screening of target genetic loci can be achieved, reducing the work of identifying invalid phenotypes and shortening the breeding cycle.

[0032] 2. Precise aggregation of dominant loci: By utilizing well-defined stable genetic loci and corresponding KASP markers, multiple low-arsenic accumulation dominant haplotypes can be precisely screened and aggregated to achieve targeted improvement of the low-arsenic accumulation trait in wheat grains.

[0033] 3. Ensure the stability of trait inheritance: Through high-generation homozygosity identification and multi-environment verification, ensure that the selected low arsenic accumulation trait can be stably inherited and maintain stable expression under different environmental conditions.

[0034] 4. Considering excellent agronomic traits: While screening for low arsenic accumulation sites, combine agronomic trait identification to ensure that the bred varieties not only have low arsenic accumulation characteristics, but also maintain excellent plant type, yield and other agronomic traits.

[0035] 5. High technical operability: Based on clear KASP marker sequences, PCR reaction parameters and generation screening standards, the breeding process is standardized and regulated, which facilitates practical promotion and application. Attached Figure Description

[0036] Figure 1 This is a KASP genotyping result image of the AX-110393422 locus in this invention;

[0037] Figure 2 This is a KASP genotyping result image of the AX-110370420 locus in this invention;

[0038] Figure 3 This is a KASP genotyping result image of the AX-109339465 locus in this invention;

[0039] Figure 4 This is a KASP genotyping result image of the AX-109455432 locus in this invention;

[0040] Figure 5 This is a KASP genotyping result image of the AX-109359598 locus in this invention;

[0041] Figure 6 This is a KASP typing result image of the AX-111655266 locus in this invention;

[0042] Figure 7 These are the GWAS Manhattan diagram and QQ diagram in this invention;

[0043] Figure 8 This is a linear regression analysis diagram of the dominant allele aggregation effect in this invention;

[0044] Figure 9 This is a linear regression analysis diagram of the aggregation effect of inferior alleles in this invention. Detailed Implementation

[0045] Please see Figures 1-9 The embodiments of the present invention will be described in further detail below with reference to the accompanying drawings and examples. The following examples are for illustrative purposes only and should not be construed as limiting the scope of the invention.

[0046] Parental selection and genotype verification:

[0047] Target locus screening: From existing wheat germplasm resources, wheat materials carrying the dominant haplotype of at least one of the following low-arsenic accumulation stable genetic loci: AX-110393422(2B), AX-110370420(3A), AX-109339465(2D), AX-109455432(3B), AX-109359598(4A), or AX-111655266(6B) are selected because... Figure 8 and Figure 9 As shown, the more dominant haplotypes that aggregate more genetic loci, the lower the arsenic content in the grains; conversely, the more inferior haplotypes that aggregate more genetic loci, the higher the arsenic content in the grains.

[0048] KASP marker detection: Genotyping of candidate materials is performed using KASP marker sequences and PCR reaction parameters. Specific steps include:

[0049] DNA extraction: Take wheat young leaf tissue and extract genomic DNA using the CTAB method or a commercial DNA extraction kit, ensuring a concentration ≥50 ng / μL and a purity OD260 / 280 between 1.8 and 2.0.

[0050] PCR reaction system: Configure the reaction system according to the parameters. For example, a 20 μL system includes: 10 μL 2×KASPMasterMix, 0.14 μL primer mix (containing specific primers and universal primers for the target site), 2 μL DNA template (50 ng / μL), and ddH2O to bring the total to 20 μL.

[0051] Amplification program: pre-denaturation at 94℃ for 15 minutes; followed by 94℃ for 20 seconds, then 61-55℃ (adjusted gradient according to primer) for 60 seconds, for a total of 10 cycles (annealing temperature decreased by 0.6℃ in each cycle); finally, 94℃ for 20 seconds, then 55℃ for 60 seconds, for a total of 30 cycles.

[0052] Genotype interpretation: The FAM and HEX channel signals were detected using a real-time PCR instrument. Based on the clustering results of allele-specific fluorescence intensity, the genotype of the target locus was determined (FAM fluorescence indicates a homozygous dominant haplotype, FAM fluorescence indicates a heterozygous haplotype, or HEX fluorescence indicates a homozygous inferior haplotype).

[0053] Parental verification: Ensure that the selected parents carry at least one homozygous or heterozygous dominant haplotype at the target locus. For example, for the AX-111655266 locus, materials with homozygous dominant haplotypes (such as AA) are preferentially selected as core parents, while heterozygous materials (such as Aa) are retained to broaden the genetic background.

[0054] Hybridization and early-generation molecular marker screening:

[0055] Hybrid seed production:

[0056] Parental configuration: Parental materials carrying different target loci are hybridized according to the designed combination. For example, the material carrying the dominant haplotype AX-111655266 (6B) is used as the maternal parent (AA), and the material carrying the dominant haplotype AX-109339465 (2D) is used as the paternal parent (BB).

[0057] Emasculation and pollination: When the flag leaf of the female parent is fully expanded and the florets are not yet open, manually emasculate the male parent using tweezers, removing all anthers. 1-2 days later, collect fresh pollen from the male parent and apply it evenly to the stigma of the female parent using a brush or pollinator. Then, isolate the female parent by bagging and label it with hybridization information.

[0058] F1 generation: Harvest the hybrid ears, thresh and store them separately to ensure the purity of F1 generation seeds.

[0059] F2-F3 generation screening:

[0060] Planting scale: F1 generation seeds were planted in isolated experimental fields and self-pollinated to obtain F2 generation populations (scale ≥1000 plants). F2 generation individual plants were harvested, and F3 generation plants were planted by family (each family ≥50 plants).

[0061] KASP marker detection: Target site detection is performed on single plants or mixed family samples from F2-F3 generations. For example, KASP markers at the AX-111655266 and AX-109339465 sites are used, and the detection is performed according to the reaction system and procedure described above.

[0062] Genotype screening: Individuals carrying at least one dominant haplotype at the target locus are preferentially retained. For example, in the F2 generation, individuals with the AA or Aa genotype at the AX-111655266 locus are selected, and combined with the results of other locus detection (individuals with the BB or Bb genotype at the AX-109339465 locus), the target genotype is initially aggregated.

[0063] Phenotypic validation: Phenotypic validation is performed only on individuals with the selected target genotype. For example, families in the F3 generation carrying the dominant haplotype AX-111655266 (AA) and simultaneously carrying the dominant haplotype AX-109339465 or heterozygous haplotype (BB or Bb) are selected, planted in potted arsenic-contaminated soil (e.g., containing 50 mg / kg of As), and the arsenic content of the grains is measured after harvest. Families with abnormal phenotypes are eliminated.

[0064] Intermediate generation aggregation and phenotypic validation:

[0065] Multiple marker detection: In generations F3-F5, candidate families are simultaneously tested for two or more target loci. For example, multiplex KASP detection technology is used to simultaneously analyze the genotypes of the AX-111655266 (6B) and AX-109339465 (2D) loci, and individuals carrying the dominant haplotype of both loci (AABB) are screened out.

[0066] Phenotypic validation system:

[0067] Pot experiment: Selected individuals were planted in pots containing arsenic-contaminated soil (e.g., irrigation water of 25-100 μg / L) and uncontaminated soil, with each treatment replicated three times. The arsenic content of the seeds was measured at maturity, and families with significantly lower arsenic content than the control (e.g., a reduction of more than 30%) were selected.

[0068] Field trials: In arsenic-contaminated fields (e.g., historical arsenic content ≥20 mg / kg), plot planting was conducted using a randomized block design to determine yield components (number of ears per mu, number of grains per ear, 100-grain weight, and 1000-grain weight) and disease resistance (e.g., stripe rust and Fusarium head blight resistance).

[0069] Genotype-phenotype association analysis: Combining KASP marker detection results with phenotypic data, an association model between genotype and grain arsenic content was established. For example, for a family (AABB) carrying both AX-111655266 and AX-109339465 dominant haplotypes, if its mean grain arsenic content is below 50 μg / kg (uncontaminated soil) or 100 μg / kg (contaminated soil), it is retained as a candidate material [National Food Safety Standard Limits for Contaminants in Food (GB2762-2022), the limit for arsenic in wheat is 0.1 mg / kg (100 μg / kg)].

[0070] High-generation stabilization and genetic background optimization:

[0071] Homozygosity determination:

[0072] Continuous self-pollination: The families retained from the F5 generation are continuously self-pollinated to the F6 generation and beyond, and KASP marker testing is performed in each generation to ensure that the homozygosity of the target locus is ≥95%. For example, for the AX-111655266 locus, families that show the AA genotype for three consecutive generations are considered homozygous and stable.

[0073] Flanking marker screening: KASP markers within a 5Mb interval upstream and downstream of the target site are used to detect linkage and exclude families closely linked to harmful genes (such as the dwarf gene Rht-B1b causing lodging).

[0074] Genetic background analysis:

[0075] Whole genome scanning: Using SNP microarray or simplified genome sequencing (GBS) technology, whole genome genetic background analysis is performed on high-generation families to ensure that the genetic background of the core breeding material has a similarity of ≥85% with the target parents.

[0076] Background selection: Targeted improvement of unfavorable alleles in non-target regions is carried out through molecular marker-assisted backcrossing or gene editing technology.

[0077] Multi-environment validation and variety finalization:

[0078] Experimental Design:

[0079] Environmental settings: Homozygous families of generation F6 and above were planted in at least three arsenic-contaminated ecological zones (e.g., Chenzhou, Hunan; Tongling, Anhui) and non-contaminated control zones (e.g., Zhengzhou, Henan; Jinan, Shandong). Each environmental setting was replicated three times, with a plot area ≥ 20m². 2 .

[0080] Field management: Water and fertilizer management should be carried out in accordance with local conventional cultivation practices to ensure consistent experimental conditions.

[0081] Phenotypic identification:

[0082] Low arsenic property: Grain samples were collected at maturity and the total arsenic content was determined by microwave digestion-ICP-MS method. The arsenic content of grains in contaminated soil was required to be ≤100μg / kg and ≤50μg / kg in uncontaminated soil.

[0083] Agronomic traits: Investigate plant height (≤85cm), plant type (compact or semi-compact), number of ears per mu (≥4.5 million), number of grains per ear (≥35), 100-grain weight, and 1000-grain weight (≥45). 3 g) and other indicators, and at the same time identify resistance to stripe rust, powdery mildew and Fusarium head blight (refer to the standards described in Appendix 7).

[0084] Genotype verification:

[0085] Stability testing: KASP marker retesting was performed on families that passed multi-environment validation to ensure that the homozygosity of the target locus was ≥95% and that there was no linkage of harmful genes in the upstream and downstream 5Mb intervals.

[0086] Genetic stability test: The final strain was planted continuously for 3 years, and the genotype and phenotype were tested every year to confirm that the low arsenic accumulation trait in the grains could be stably inherited.

[0087] Verification and application of the final strain:

[0088] Molecular marker verification: KASP marker identification was performed on the obtained homozygous lines to ensure that the homozygosity of the dominant haplotype was ≥95% and that there was no segregation at the target site.

[0089] Production trials: Large-scale production trials are conducted in the target promotion areas to verify the adaptability and stability of the strains. For example, in the southern Huang-Huai wheat region, the strains are required to have a yield of ≥500 kg / mu in arsenic-contaminated fields and ≥550 kg / mu in uncontaminated fields, while also meeting the standards of resistance to multiple diseases and excellent quality (strong or medium-strong gluten).

[0090] Variety Approval: Based on molecular marker detection and multi-year, multi-location phenotypic data, submit a variety approval application to ensure that the low arsenic accumulation trait passes national or provincial approval.

[0091] KASP marker specificity: annealing temperature was optimized using gradient PCR to ensure amplification specificity. For example, when the primer annealing temperature for the AX-111655266 locus was optimized to 58℃, it could effectively distinguish between AA, Aa, and aa genotypes.

[0092] Phenotypic detection accuracy: When using the ICP-MS method, the pretreatment process must be strictly controlled to ensure a recovery rate between 90% and 110% and a detection limit ≤ 0.006 μg / g.

[0093] Environmental adaptability: In multi-environment verification, the selection of arsenic-contaminated soils needs to cover different types (such as acidic red soil and alkaline alluvial soil) to ensure that the strains exhibit stable low arsenic accumulation under various soil conditions.

[0094] Example 1: Breeding of low-arsenic wheat with aggregated AX-111655266 (6B) and AX-109339465 (2D) sites:

[0095] Parental selection: The wheat variety 'Low Arsenic No. 1' carrying AX-111655266 (AA) and the variety 'Disease-Resistant No. 5' carrying AX-109339465 (BB or Bb) were selected as parents.

[0096] Hybridization and selection: F1 generation was self-crossed to obtain F2 population, and individuals carrying both AX-111655266 (AA) and AX-109339465 (BB) were selected by KASP marker.

[0097] Intermediate generation aggregation: In the F3-F5 generations, combining pot arsenic pollution test (100μg / LAs) and field disease resistance identification, families with grain arsenic content ≤100μg / kg and resistance to stripe rust were retained.

[0098] High-generation stabilization: In the F6 generation, the family 'Aggregation No. 1' with 100% homozygosity at the target locus and no harmful linkages upstream and downstream was selected.

[0099] Multiple environmental validations: Planted in Chenzhou, Hunan (arsenic-contaminated) and Zhengzhou, Henan (uncontaminated), the arsenic content of 'Juhe No. 1' grains was 90 μg / kg and 40 μg / kg respectively, with 4.01 million ears per mu, 36 grains per ear, and a 100-grain weight and 1000-grain weight of 42. 4 g has good overall disease resistance, with outstanding resistance to stripe rust and powdery mildew.

[0100] Example 2: Expanding the genetic background using heterozygous parents:

[0101] Parental selection: The wheat variety 'Kangbing 3' carrying AX-111655266(Aa) was crossed with the variety 'Gaochan 8' carrying AX-109359598(Cc).

[0102] Early screening: Select heterozygous individuals at both loci (AaCc, theoretically at least 25% of the individuals are of this genotype) in the F1 generation to achieve the initial aggregation of the two loci;

[0103] In the F2 generation, select single plants that simultaneously carry the dominant haplotypes AX-109339465 and AX-109359598 (AACC) or single plants with at least one homozygous dominant haplotype (AACc or AaCC).

[0104] Intermediate generation optimization: In the F3-F4 generation, multiple KASP tests were conducted to aggregate the AX-111655266 (AA) and AX-109359598 (CC) sites, obtaining the family 'AACC' with grain arsenic content ≤80μg / kg (under polluted soil conditions). This family can simultaneously possess the characteristics of low grain arsenic accumulation, high yield and disease resistance.

[0105] High-generation selection: In the F5-F6 generation, select families with excellent comprehensive agronomic traits, disease resistance and high yield.

[0106] Final verification: 'Juhe No. 2' showed stable performance in more than 3 years of environmental trials, with a homozygosity of 97% and excellent agronomic traits. When planted in Chenzhou, Hunan (arsenic-contaminated) and Zhengzhou, Henan (non-contaminated), the arsenic content in the grains was 85μg / kg and 40μg / kg, respectively. The number of ears per mu was 405,000, the number of grains per ear was 37.2, the 100-grain weight and 1000-grain weight were 45.6g. It has good high yield and stable yield, outstanding comprehensive disease resistance, and meets the national standards for the approval of new wheat varieties.

[0107] Highly efficient screening led by molecular markers: KASP marker detection is the main method used in early generations (F2-F3), which significantly reduces the workload of phenotypic identification and shortens the cycle by 2-3 years compared with traditional breeding.

[0108] Precision of multigene aggregation: Multiple target loci are screened simultaneously through multiple KASP detection, combined with upstream and downstream linkage analysis to ensure the stable inheritance of dominant haplotypes.

[0109] Environmental adaptability verification: Multiple environmental tests cover different levels of arsenic pollution and soil types to ensure the reliability of the bred lines in actual production.

[0110] Marker-trait association timeliness: The KASP marker database is updated regularly, and primer design is optimized based on the latest research results to ensure a strong association between markers and phenotypes.

[0111] Standardized field management: In multi-environment validation, strict control of cultivation measures such as fertilization and irrigation is implemented to reduce the impact of environmental errors on phenotypic identification.

[0112] Genetic stability monitoring: Long-term tracking of developed varieties, with whole-genome marker testing every 3 years to prevent genetic drift from causing trait degradation.

[0113] This invention achieves efficient breeding of low arsenic accumulation traits in wheat grains by systematically integrating molecular marker-assisted selection, multi-generational polymerization, and multi-environmental verification, providing a scientifically feasible technical solution for safe wheat production in arsenic-contaminated areas.

[0114] The embodiments of the present invention are given for illustrative and descriptive purposes only, and are not intended to be exhaustive or to limit the invention to the forms disclosed. Many modifications and variations will be apparent to those skilled in the art. The embodiments were chosen and described in order to better illustrate the principles and practical application of the invention, and to enable those skilled in the art to understand the invention and to design various embodiments with various modifications suitable for a particular purpose.

Claims

1. A breeding method for aggregating stable genetic loci for low arsenic accumulation in wheat grains, characterized by: Includes the following steps: 1) Identification of dominant haplotypes of arsenic accumulation genetic loci in wheat germplasm resources: Using the following molecular markers and relying on the KASP genotyping system, dominant haplotypes (low arsenic accumulation haplotypes) of genetic loci were identified. Genotypes were determined based on fluorescence signals. If a FAM signal (FAM fluorescent tag sequence GAAGGTGACCAAGTTCATGCT) was detected, the haplotype was identified as homozygous for the dominant haplotype. If a HEX signal (HEX fluorescent tag sequence GAAGGTCGGAGTCAACGGATT) was detected, the haplotype was identified as homozygous for the inferior haplotype. If a FAMHEX signal was detected, the haplotype was identified as heterozygous. The specific primer sequences for identification are shown below: AX-110393422: F1 is GAAGGTGACCAAGTTCATGCTGTTCGCATCCTTCATTTCATCTG, F2 is GAAGGTCGGAGTCAACGGATTGTTCGCATCCTTCATTTCATCTA, and R is CCATGGATCCGAACAAAATGGA; AX-110370420: F1 is GAAGGTGACCAAGTTCATGCTGGATTTAGGCTAGTTAGATGGTATGC, F2 is GAAGGTCGGAGTCAACGGATTGGATTTAGGCTAGTTAGATGGTATGT, and R is CTAACTAGAAGACCATCAGCGGCA; AX-109339465: F1 is GAAGGTGACCAAGTTCATGCTGTTTCGGCCATTTGGTTAAATTC, F2 is GAAGGTCGGAGTCAACGGATTGTTTCGGTTAAATTTG, and R is CAGATATTCGGCGAATTTCAGC; AX-109455432: F1 is GAAGGTGACCAAGTTCATGCTGAGTAGAGTCAAGTGAGAAC, F2 is GAAGGTCGGAGTCAACGGATTGAGTAGAGTCAAGTGAGAAT, and R is TGCGCTGGGTTGAGGAGGAG; AX-109359598: F1 is GAAGGTGACCAAGTTCATGCTGAGACCGTAGTTGTTTGGACCG, F2 is GAAGGTCGGAGTCAACGGATTGAGACCGTAGTTGTTTGGACCA, and R is AGCATCTGCATAGCTCTTCTGC; AX-111655266: F1 is GAAGGTGACCAAGTTCATGCTGAGCGGACCGAATAGATAAGGT, F2 is GAAGGTCGGAGTCAACGGATTGAGCGGACCGAATAGATAAGGC, and R is GGCTATAACATGGGCCCATC. 2) Parental selection: Wheat materials carrying dominant haplotypes of stable low arsenic accumulation loci were selected as parents. The stable genetic loci were selected from at least one of AX-110393422, AX-110370420, AX-109339465, AX-109455432, AX-109359598, and AX-111655266. 3) Hybridization and early generation screening: The parents from step 2) are hybridized to obtain the F1 generation. In the F2-F3 generations, individuals carrying at least one dominant haplotype at a target locus are screened using the KASP marker detection method. 4) Intermediate generation aggregation: In the F3-F5 generation, individuals carrying two or more dominant haplotypes are screened by KASP marker detection. Combined with phenotypic verification, individuals with the target genotype are retained. The more dominant haplotypes of genetic loci aggregated, the lower the arsenic content in the grain. Conversely, the more inferior haplotypes of genetic loci contained, the higher the arsenic content in the grain. 5) High-generation stabilization: KASP marker homozygosity was determined for F6 and above materials to screen families with homozygous genetic loci and no linkage of harmful genes in the upstream and downstream 5Mb intervals; 6) Multi-environment verification: The families from step 5) were planted in arsenic-contaminated and non-contaminated soils respectively. Through phenotypic identification and genotypic verification, homozygous lines with stable low arsenic accumulation in grains and excellent agronomic traits were screened.

2. The breeding method for aggregating stable genetic loci with low arsenic accumulation in wheat grains as described in claim 1, characterized in that, In steps 1) and 2), parental selection must be verified by KASP marker detection to ensure that the parent carries at least one dominant haplotype homozygous or heterozygous genotype.

3. The breeding method for aggregating stable genetic loci with low arsenic accumulation in wheat grains as described in claim 2, characterized in that, In step 3), early generation screening is mainly based on KASP marker detection results, and phenotypic verification is only performed on individuals with the selected target genotypes to reduce the cost of identifying invalid phenotypes.

4. The breeding method for aggregating stable genetic loci with low arsenic accumulation in wheat grains as described in claim 3, characterized in that, In step 4), two or more dominant haplotypes include AX-109339465 (2D) and AX-111655266 (6B), of which AX-111655266 is the major site controlling low arsenic accumulation.

5. The breeding method for aggregating stable genetic loci with low arsenic accumulation in wheat grains as described in claim 4, characterized in that, In step 5), homozygosity is determined by KASP marker detection, requiring the target locus to have a homozygosity of ≥95%.

6. The breeding method for aggregating stable genetic loci with low arsenic accumulation in wheat grains as described in claim 5, characterized in that, Step 6) involves multi-environmental validation, including arsenic-contaminated and uncontaminated soils, to ensure stable expression of the low-arsenic trait under different environments.

7. The breeding method for aggregating stable genetic loci with low arsenic accumulation in wheat grains as described in claim 6, characterized in that, In step 6), the agronomic traits that are excellent include plant height, plant type, number of ears per mu, number of grains per ear, weight of 100 grains and weight of 1000 grains, etc., which meet the breeding objectives and are also resistant to a variety of diseases.

8. The breeding method for aggregating stable genetic loci with low arsenic accumulation in wheat grains as described in claim 7, characterized in that, The KASP marker sequences, PCR reaction parameters, and genotype-phenotype associations of the stable genetic loci are all based on the information disclosed in the disclosure document.

9. The breeding method for aggregating stable genetic loci with low arsenic accumulation in wheat grains as described in claim 8, characterized in that, The entire breeding process combines molecular marker-assisted selection and phenotypic identification. Early generations (F2-F3) mainly use KASP marker detection, while higher generations (F6 and above) combine phenotypic verification to ensure trait stability.

10. The breeding method for aggregating stable genetic loci with low arsenic accumulation in wheat grains as described in claim 9, characterized in that, The resulting homozygous lines must be genetically stable using KASP markers to ensure that the homozygosity of the dominant haplotype is ≥95% and that the low arsenic accumulation trait in the grains can be stably inherited.

Images