SNP molecular marker combination and primer set for identifying robinia germplasm resources and application thereof
By developing 31 SNP sites and KASP primer combinations from the whole genome of Robinia pseudoacacia, a DNA fingerprint map of Robinia pseudoacacia germplasm resources was constructed, which solved the problem of lack of high polymorphic marker combinations in existing technologies and realized efficient and low-cost identification and management of germplasm resources.
Patent Information
- Application Number
- CN202511676900.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-17
- Publication Date
- 2026-02-24
- Estimated Expiration
- 2045-11-17
AI Technical Summary
Existing technologies lack highly polymorphic and discriminative KASP-SNP marker combinations and fingerprint mapping methods suitable for the identification of Robinia pseudoacacia germplasm resources, which limits germplasm resource management and breeding progress.
A combination of 31 SNP sites based on the whole genome of Robinia pseudoacacia and their corresponding KASP primer combinations was developed to construct DNA fingerprint maps of Robinia pseudoacacia germplasm resources. Genotyping and authenticity identification were performed using competitive allele-specific PCR technology.
It has enabled efficient and automated identification of black locust germplasm resources, improved typing efficiency, solved the problem of disordered germplasm resources, reduced costs, and realized the digital and standardized management of genetic information.
Smart Images

Figure CN121109654B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular marker development technology, and in particular relates to an SNP molecular marker combination and primer set for identifying Robinia pseudoacacia germplasm resources and its application. Background Technology
[0002] The information disclosed in this background section is intended only to enhance some understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that the information constitutes prior art known to those skilled in the art.
[0003] Black locust (Robinia pseudoacacia) possesses excellent salt and alkali resistance, strong adaptability, and rapid growth. Since its introduction to China, it has been widely planted and is now an important ecological afforestation species. However, as an introduced species, its introduction into many regions of my country has been unregulated, with widespread interspecific hybridization and a complex genetic background. This has led to a chaotic state of my country's black locust germplasm resources and significantly hindered breeding research and effective utilization. Identifying and utilizing black locust germplasm resources can fully leverage the advantages of my country's black locust germplasm resources and lay a material foundation for black locust variety improvement and breeding.
[0004] In the fields of genetics and genomics, single nucleotide polymorphisms (SNPs) are favored as universal and reliable molecular markers due to their codominant inheritance, high abundance, wide distribution, and suitability for high-throughput automated genotyping. With continuous advancements in sequencing technology, the identification capability of SNPs has been significantly improved, leading to their widespread application in agriculture, medicine, and evolutionary biology. Compared to traditional molecular markers, SNPs offer higher resolution and accuracy, making them an indispensable tool in modern genomics research and breeding projects.
[0005] Among various SNP genotyping methods, competitive allele-specific PCR (KASP) assays have become the global benchmark due to their high reliability, cost-effectiveness, simplicity, scalability, and flexibility. KASP technology utilizes the fluorescence resonance energy transfer (FRET) principle to detect predetermined codominant alleles at specific genomic loci. By employing quantitative PCR and allele-specific primers, it achieves accurate SNP detection. KASP technology not only maintains high reliability in large-scale genotyping but is also particularly suitable for distinguishing closely related or phenotypically similar local varieties of Robinia pseudoacacia. Therefore, KASP technology has broad prospects and significant value in applications such as germplasm resource characterization and marker-assisted selection (MAS).
[0006] However, successfully applying KASP technology to the identification of Robinia pseudoacacia germplasm resources faces a core challenge: the lack of a fully validated set of core SNP marker combinations with high polymorphism and discriminative power, along with their corresponding KASP primers. Currently, there are no reports of KASP-SNP marker combinations specifically designed for Robinia pseudoacacia germplasm resource identification, covering the entire genome, and whose identification efficiency has been validated on a large scale, nor are there any methods for constructing their fingerprint maps. Filling this technological gap is crucial for achieving the digital and information-based management of Robinia pseudoacacia germplasm resources and for advancing the molecular breeding process of Robinia pseudoacacia. Summary of the Invention
[0007] The purpose of this invention is to provide a method for constructing a DNA fingerprint map of Robinia pseudoacacia germplasm resources based on KASP primer combinations and its application, so as to solve the problems existing in the prior art, realize the genotyping and authenticity identification of Robinia pseudoacacia, and construct a DNA fingerprint map of Robinia pseudoacacia germplasm resources.
[0008] The technical solution adopted in this invention is as follows:
[0009] In a first aspect of the invention, a combination of SNP molecular markers for identifying Robinia pseudoacacia germplasm resources is provided, the combination consisting of 31 SNP sites located in the Robinia pseudoacacia genome, the physical locations of the 31 SNP sites being determined based on the whole genome sequence alignment of Robinia pseudoacacia, the project number of the whole genome of Robinia pseudoacacia on the Genome Sequence Archive being PRJCA011483, and the combination of SNP sites including Rp01-Rp31;
[0010] Rp01 is located at position 24743774 on chromosome 1, and its base is either A or G.
[0011] Rp02 is located at position 25073091 on chromosome 1, and its base is either T or C.
[0012] Rp03 is located at position 10092129 on chromosome 2, and its base is either G or A.
[0013] Rp04 is located at position 91986640 on chromosome 2, and its base is either T or A.
[0014] Rp05 is located at position 77754558 on chromosome 2, and its base is either T or C.
[0015] Rp06 is located at position 31665898 on chromosome 3, and its base is G or T.
[0016] Rp07 is located at position 51595394 on chromosome 3, and its base is either A or G.
[0017] Rp08 is located at position 58788005 on chromosome 3, and its base is either A or G.
[0018] Rp09 is located at position 13201378 on chromosome 4, and its base is either T or G.
[0019] Rp10 is located at position 50929921 on chromosome 4, and its base is C or T.
[0020] Rp11 is located at position 14062444 on chromosome 5, and its base is either T or G.
[0021] Rp12 is located at position 8770487 on chromosome 5, and its base is either G or A.
[0022] Rp13 is located at position 23451076 on chromosome 5, and its base is either G or A.
[0023] Rp14 is located at position 36805502 on chromosome 6, and its base is either T or C.
[0024] Rp15 is located at position 38935765 on chromosome 6, and its base is either A or G.
[0025] Rp16 is located at position 15159147 on chromosome 6, and its base is either G or A.
[0026] Rp17 is located at position 16475934 on chromosome 7, and its base is C or T.
[0027] Rp18 is located at position 32754651 on chromosome 7, and its base is either G or A.
[0028] Rp19 is located at position 33235428 on chromosome 7, and its base is C or T.
[0029] Rp20 is located at position 55265643 on chromosome 8, and its base is either A or G.
[0030] Rp21 is located at position 58008516 on chromosome 8, and its base is C or T.
[0031] Rp22 is located at position 27772901 on chromosome 8, and its base is either A or T.
[0032] Rp23 is located at position 83018029 on chromosome 8, and its base is C or T.
[0033] Rp24 is located at position 3365777 on chromosome 9, and its bases are either T or C.
[0034] Rp25 is located at position 37712675 on chromosome 9, and its base is G or C.
[0035] Rp26 is located at position 50778644 on chromosome 9, and its base is either T or C.
[0036] Rp27 is located at position 12726029 on chromosome 10, and its base is either G or A.
[0037] Rp28 is located at position 42009697 on chromosome 10, and its base is either A or G.
[0038] Rp29 is located at position 43720312 on chromosome 10, and its bases are either T or C.
[0039] Rp30 is located at position 58984753 on chromosome 11, and its base is G or T.
[0040] Rp31 is located at position 71873654 on chromosome 11, and its bases are either T or C.
[0041] In one or more embodiments of the present invention, the 31 SNP sites include a subset consisting of at least 12 SNP sites, which is capable of achieving 100% differentiation of the 105 Robinia pseudoacacia germplasm resources to be identified, and the subset consists of Rp22, Rp23, Rp13, Rp14, Rp28, Rp26, Rp04, Rp27, Rp16, Rp01, Rp21, and Rp24.
[0042] In a second aspect of the invention, a reagent for detecting the genotypes of 31 SNP loci in the Robinia pseudoacacia genome is provided for use in any of the following:
[0043] (1) Application in the preparation of a kit for detecting the genotype of SNP sites in Robinia pseudoacacia;
[0044] (2) Application in genotyping of Robinia pseudoacacia;
[0045] (3) Application in constructing a locust DNA fingerprint.
[0046] In a third aspect of the invention, a primer set for detecting the SNP molecular marker combination is provided, the primer set comprising primer pairs for KASP genotyping detection, each SNP site corresponding to a set of primers, each set of primers comprising two forward primers and one reverse primer;
[0047] The KASP primers used to detect Rp01 are two forward primers as shown in SEQ ID NO.1-2 and a reverse primer as shown in SEQ ID NO.3;
[0048] The KASP primers used to detect Rp02 are two forward primers as shown in SEQ ID NO.4-5 and a reverse primer as shown in SEQ ID NO.6;
[0049] The KASP primers used to detect Rp03 are two forward primers as shown in SEQ ID NO.7-8 and a reverse primer as shown in SEQ ID NO.9;
[0050] The KASP primers used to detect Rp04 are the two forward primers shown in SEQ ID NO.10-11 and the reverse primer shown in SEQ ID NO.12;
[0051] The KASP primers used to detect Rp05 are the two forward primers shown in SEQ ID NO.13-14 and the reverse primer shown in SEQ ID NO.15;
[0052] The KASP primers used to detect Rp06 are the two forward primers shown in SEQ ID NO.16-17 and the reverse primer shown in SEQ ID NO.18;
[0053] The KASP primers used to detect Rp07 are the two forward primers shown in SEQ ID NO.19-20 and the reverse primer shown in SEQ ID NO.21;
[0054] The KASP primers used to detect Rp08 are the two forward primers shown in SEQ ID NO.22-23 and the reverse primer shown in SEQ ID NO.24;
[0055] The KASP primers used to detect Rp09 are the two forward primers shown in SEQ ID NO.25-26 and the reverse primer shown in SEQ ID NO.27;
[0056] The KASP primers used to detect Rp10 are two forward primers as shown in SEQ ID NO.28-29 and a reverse primer as shown in SEQ ID NO.30;
[0057] The KASP primers used to detect Rp11 are the two forward primers shown in SEQ ID NO.31-32 and the reverse primer shown in SEQ ID NO.33;
[0058] The KASP primers used to detect Rp12 are two forward primers as shown in SEQ ID NO.34-35 and a reverse primer as shown in SEQ ID NO.36;
[0059] The KASP primers used to detect Rp13 are two forward primers as shown in SEQ ID NO.37-38 and a reverse primer as shown in SEQ ID NO.39;
[0060] The KASP primers used to detect Rp14 are the two forward primers shown in SEQ ID NO.40-41 and the reverse primer shown in SEQ ID NO.42;
[0061] The KASP primers used to detect Rp15 are two forward primers as shown in SEQ ID NO.43-44 and a reverse primer as shown in SEQ ID NO.45;
[0062] The KASP primers used to detect Rp16 are the two forward primers shown in SEQ ID NO.46-47 and the reverse primer shown in SEQ ID NO.48;
[0063] The KASP primers used to detect Rp17 are two forward primers as shown in SEQ ID NO.49-50 and a reverse primer as shown in SEQ ID NO.51;
[0064] The KASP primers used to detect Rp18 are the two forward primers shown in SEQ ID NO.52-53 and the reverse primer shown in SEQ ID NO.54;
[0065] The KASP primers used to detect Rp19 are two forward primers as shown in SEQ ID NO.55-56 and a reverse primer as shown in SEQ ID NO.57;
[0066] The KASP primers used to detect Rp20 are two forward primers as shown in SEQ ID NO. 58-59 and a reverse primer as shown in SEQ ID NO. 60;
[0067] The KASP primers used to detect Rp21 are two forward primers as shown in SEQ ID NO. 61-62 and a reverse primer as shown in SEQ ID NO. 63;
[0068] The KASP primers used to detect Rp22 are two forward primers as shown in SEQ ID NO. 64-65 and a reverse primer as shown in SEQ ID NO. 66;
[0069] The KASP primers used to detect Rp23 are two forward primers as shown in SEQ ID NO. 67-68 and a reverse primer as shown in SEQ ID NO. 69;
[0070] The KASP primers used to detect Rp24 are the two forward primers shown in SEQ ID NO.70-71 and the reverse primer shown in SEQ ID NO.72;
[0071] The KASP primers used to detect Rp25 are two forward primers as shown in SEQ ID NO.73-74 and a reverse primer as shown in SEQ ID NO.75;
[0072] The KASP primers used to detect Rp26 are two forward primers as shown in SEQ ID NO.76-77 and a reverse primer as shown in SEQ ID NO.78;
[0073] The KASP primers used to detect Rp27 are two forward primers as shown in SEQ ID NO.79-80 and a reverse primer as shown in SEQ ID NO.81;
[0074] The KASP primers used to detect Rp28 are two forward primers as shown in SEQ ID NO. 82-83 and a reverse primer as shown in SEQ ID NO. 84;
[0075] The KASP primers used to detect Rp29 are two forward primers as shown in SEQ ID NO. 85-86 and a reverse primer as shown in SEQ ID NO. 87;
[0076] The KASP primers used to detect Rp30 are two forward primers as shown in SEQ ID NO. 88-89 and a reverse primer as shown in SEQ ID NO. 90;
[0077] The KASP primers used to detect Rp31 are two forward primers as shown in SEQ ID NO. 91-92 and a reverse primer as shown in SEQ ID NO. 93.
[0078] In one or more embodiments of the present invention, the 5' ends of the two forward primers are respectively connected to different fluorescent tag sequences, the fluorescent tag sequences including FAM fluorescent tag sequences and HEX fluorescent tag sequences; the FAM fluorescent tag sequence is shown in SEQ ID No. 94, and the HEX fluorescent tag sequence is shown in SEQ ID No. 95.
[0079] In a fourth aspect of the invention, a kit comprising a primer set for detecting the SNP molecular marker combination is provided.
[0080] In one or more embodiments of the present invention, the kit further comprises at least one of the following: PCR reaction solution, DNA extraction reagent, positive control and / or negative control required for KASP genotyping detection.
[0081] In a fifth aspect of the invention, the use of the KASP primer combination or the kit described herein is provided in any of the following:
[0082] (1) Genotyping of black locust trees;
[0083] (2) Constructing a DNA fingerprint of Robinia pseudoacacia;
[0084] (3) Identify the authenticity of black locust germplasm resources.
[0085] In a sixth aspect of the present invention, a method for genotyping and constructing a DNA fingerprint of Robinia pseudoacacia is provided, comprising the following steps:
[0086] (1) Extract genomic DNA from the black locust sample to be tested;
[0087] (2) Using the genomic DNA obtained in step (1) as a template, at least one of the 31 SNP sites is amplified by competitive allele-specific PCR (KASP) using the KASP primer combination.
[0088] (3) Detect the fluorescence signal of the PCR amplification product and determine the genotype of the Robinia pseudoacacia sample at the corresponding SNP site based on the fluorescence signal;
[0089] (4) Based on the genotype results obtained in step (3), construct the DNA fingerprint of the locust sample.
[0090] In one or more embodiments of the present invention, in step (2), the KASP reaction system comprises 2×KASPMix, the Primer Mix in the KASP primer combination, the genomic DNA, and ddH2O, etc.
[0091] In one or more embodiments of the present invention, in step (2), the PCR amplification procedure includes: pre-denaturation at 95°C for 10 min; followed by 10 touchdown cycles: denaturation at 95°C for 20 s, annealing / extension at 61-55°C for 40 s, with a decrease of 0.6°C per cycle; and then 32 cycles: denaturation at 95°C for 20 s, annealing / extension at 55°C for 40 s.
[0092] In one or more embodiments of the present invention, in step (4), the DNA fingerprint is a core code that converts the genotype result into a digital code, wherein the wild-type genotype is coded as 01, the homozygous mutant genotype is coded as 10, and the heterozygous genotype is coded as 11.
[0093] In a seventh aspect of the present invention, a method for identifying black locust germplasm resources is provided, wherein the method is used to construct a DNA fingerprint of a black locust sample to be tested, and the fingerprint is compared with a standard DNA fingerprint of a known superior black locust variety, thereby realizing the identification or authentication of germplasm resources.
[0094] Compared with the related technologies known to the inventors, one of the technical solutions of the present invention has the following beneficial effects:
[0095] (1) This invention is the first to develop 31 core SNP markers applicable to Robinia pseudoacacia and a matching KASP primer combination. As a high-throughput genotyping platform, KASP technology can achieve rapid and automated detection, which greatly improves the genotyping efficiency and avoids the problems of low throughput, cumbersome operation and easy error of traditional molecular markers (such as SSR).
[0096] (2) The 31 SNP markers provided by this invention exhibit high polymorphism and are evenly distributed on chromosomes, fully covering the Robinia pseudoacacia genome. The DNA fingerprint constructed using these markers has extremely high information content. Experimental verification shows that the minimum combination of only 12 core markers (Rp22, Rp23, Rp13, Rp14, Rp28, Rp26, Rp04, Rp27, Rp16, Rp01, Rp21, and Rp24) selected from these 31 markers can achieve 100% complete differentiation of 105 Robinia pseudoacacia germplasm resources with complex genetic backgrounds. This demonstrates that the marker combination of this invention has extremely high identification efficiency, providing a core basis for developing low-cost, rapid detection kits.
[0097] (3) This invention systematically applies KASP technology to the field of black locust germplasm resource identification, solving the industrial problem of germplasm confusion caused by non-standard introduction and interspecific hybridization of black locust in my country.
[0098] (4) As verified by the experiment of this invention, the present invention only needs to use the minimum combination of 12 markers (Rp22, Rp23, Rp13, Rp14, Rp28, Rp26, Rp04, Rp27, Rp16, Rp01, Rp21, Rp24) to solve most identification needs, which can significantly reduce reagent costs and time costs.
[0099] (5) This invention converts the genotype results into DNA fingerprint core codes in the form of "01" codes, realizing the digitization and standardization of genetic information of Robinia pseudoacacia germplasm resources. Attached Figure Description
[0100] The accompanying drawings, which form part of this specification, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.
[0101] Figure 1 This is an example image of the KASP experimental test results.
[0102] Figure 2 To evaluate the identification efficiency of 105 Robinia pseudoacacia germplasm resources using 31 KASP markers. Detailed Implementation
[0103] It should be noted that the following detailed descriptions are exemplary and intended to provide further illustration of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0104] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the exemplary embodiments of the present invention. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, and / or combinations thereof.
[0105] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.
[0106] Example 1:
[0107] 1. Experimental Materials
[0108] This invention used 105 different Robinia pseudoacacia varieties for experiments. These 105 varieties covered core germplasm, local varieties, introduced germplasm, important breeding parents, and hybrid offspring from multiple major distribution areas in my country. Their sources were wide-ranging and diverse, representing the genetic diversity of existing Robinia pseudoacacia germplasm resources in my country to the greatest extent possible. The SNP markers screened from this population were based on their objective genomic polymorphisms, thus possessing the potential for efficient identification of similar Robinia pseudoacacia germplasm resources. Specific information is shown in Table 1.
[0109] Table 1. Names of 105 materials
[0110] ,
[0111] ,
[0112]
[0113] 2. Screening of candidate SNP sites
[0114] 105 resequencing data from *Robinia pseudoacacia* were compared with the *Robinia pseudoacacia* reference genome (PRJCA011483) to obtain a dataset containing all variant sites. Variant sites were filtered according to the following criteria: (1) sites with MAF > 0.05 were retained; (2) sites with miss > 0.2 were removed; (3) sites with PIC > 0.3 were retained; (4) sites with no other variations within 100 bp before and after the site were retained; and (5) SNP sites evenly distributed on the chromosome were further retained. After filtering, 145 variant sites remained, of which 136 were successfully used to design KASP primers, achieving a transformation success rate of 93.79%. Further screening of 65 sites with high polymorphism and even distribution on the chromosome resulted in KASP primer synthesis and initial screening, ultimately yielding 31 core KASP markers. DNA was extracted from young leaves of Robinia pseudoacacia samples using the Novizan D104 Plant Genomic DNA Extraction Kit. DNA quality was assessed using a 1% agarose gel electrophoresis. The concentration was then diluted to 20 ng / μL using a NanodropONEC (ThermoFisher, USA) micro-UV-Vis spectrophotometer for later use.
[0115] 3. KASP primer design and synthesis
[0116] One pair of KASP primers consists of two competing forward primers (recognizing different SNPs) and one common reverse primer. Primer sequences are shown in Table 2. They were synthesized by Jinan Tianyi Biotechnology Co., Ltd. A FAM fluorescent tag sequence, GAAGGTGACCAAGTTCATGCT (SEQ ID No. 94), was added to the 5' end of forward primer 1, and a HEX fluorescent tag sequence, GAAGGTCGGAGTCAACGGATT (SEQ ID No. 95), was added to the 5' end of forward primer 2.
[0117] Table 2 Core KASP marker primer sequences
[0118] ,
[0119] ,
[0120]
[0121] To further clarify the characteristics of the above markers, the base type of each SNP marker site plus the downstream 100bp sequence are shown in Table 3.
[0122] Table 3. Sequences of 100 bp before and after the mutation site
[0123] ,
[0124] ,
[0125] ,
[0126]
[0127] 4. PCR amplification and genotyping
[0128] KASP reaction system: Primer Mix was prepared, with 12 μL (100 μM) each of forward primer 1 and forward primer 2, 30 μL (100 μM) of reverse primer, and 46 μL of ddH2O. PCR was performed in 96-well plates with the following reaction well composition: 2 μL of DNA at a concentration of 20 ng / μL, 5.00 μL of 2×KASP Mix (Beijing Jiacheng Biotechnology Co., Ltd.), 0.14 μL of Primer Mix, and 3 μL of ddH2O. Two negative controls (NTCs) were included in each DNA sample.
[0129] The KASP genotyping instrument was a Bio-Rad CFX-96 real-time PCR instrument. The PCR cycle program was as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 s, annealing and extension at 61~55℃ for 40 s, 10 cycles, decreasing the temperature by 0.6℃ per cycle; 95℃ denaturation for 20 s, 55℃ annealing for 40 s, 32 cycles. After the PCR reaction, fluorescence data were read. If genotyping was insufficient, amplification was continued with the following program: 95℃ denaturation for 20 s, 55℃ annealing for 40 s, checking the genotyping status every 3 cycles until genotyping was clear.
[0130] 5. Data Statistics and Analysis
[0131] SNPs were filtered and analyzed using VCFtools and Excel software according to the KASP primer design rules. Genotypes were identified and read using the allele recognition mode of the Bio-Rad CFX Manager software that comes with the real-time PCR instrument. Figure 1 Example images of KASP test results: rhombus (NTC / deletion); circle (wild type); square (mutant); triangle (heterozygous).
[0132] 6. Fingerprint mapping
[0133] This invention utilizes the proposed fingerprint mapping method for black locust germplasm resources to construct fingerprint maps for 105 black locust germplasm resources (Table 1) preserved in Daqingshan State-owned Forest Farm, Feixian County, Shandong Province, and to draw their core codes.
[0134] Following the steps in "5. Data Statistics and Analysis", genotyping was performed on 105 Robinia pseudoacacia germplasm resources (Table 1) at the 31 SNP markers (Table 3). For the 31 SNP sites, genotype combinations were converted into 01 codes as the core code for the DNA fingerprint: wild type (consistent with the reference genome) was represented by 01, mutant by 10, heterozygous genotype by 11, and deletion sites were marked with "--". The results are shown in Table 4.
[0135] Table 4. Genotyping results of 31 SNP loci
[0136] ,
[0137] ,
[0138] ,
[0139] ,
[0140] ,
[0141] ,
[0142] ,
[0143] ,
[0144] ,
[0145]
[0146] 7. Identification efficiency of different primer combinations
[0147] To demonstrate the identification capability of the KASP markers used in the fingerprint database provided in this invention, this embodiment analyzes the identification efficiency of genotype data from 105 germplasm accessions using 31 KASP markers. Two primer pairs (Rp22, Rp23) yielded two unique genotypes; three primer pairs (Rp22, Rp23, Rp13) yielded 12 unique genotypes; four primer pairs (Rp22, Rp23, Rp13, Rp14) yielded 22 unique genotypes; five primer pairs (Rp22, Rp23, Rp13, Rp14, Rp28) yielded 35 unique genotypes; Rp22, Rp23, Rp23, Rp13, Rp14, Rp28... 3. Using 6 primer pairs (Rp13, Rp14, Rp28, Rp26), 48 unique genotypes were obtained; using 7 primer pairs (Rp22, Rp23, Rp13, Rp14, Rp28, Rp26, Rp04), 72 unique genotypes were obtained; using 8 primer pairs (Rp22, Rp23, Rp13, Rp14, Rp28, Rp26, Rp04, Rp27), 81 unique genotypes were obtained. Genotypes: 9 primer pairs (Rp22, Rp23, Rp13, Rp14, Rp28, Rp26, Rp04, Rp27, Rp16) yielded 91 unique genotypes; 10 primer pairs (Rp22, Rp23, Rp13, Rp14, Rp28, Rp26, Rp04, Rp27, Rp16, Rp01) yielded 95 unique genotypes; Rp22, Rp23 Eleven primer pairs (Rp13, Rp14, Rp28, Rp26, Rp04, Rp27, Rp16, Rp01, Rp21) yielded 104 unique genotypes; twelve primer pairs (Rp22, Rp23, Rp13, Rp14, Rp28, Rp26, Rp04, Rp27, Rp16, Rp01, Rp21, Rp24) yielded 105 unique genotypes. Ultimately, only 12 primer pairs were used to completely distinguish 105 accessions, achieving a 100% identification efficiency. Figure 2 As shown.
[0148] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.
Claims
1. A combination of SNP molecular markers for identifying Robinia pseudoacacia germplasm resources, characterized in that, The combination consists of DNA fragments shown in sequences 96 to 126 in Table 3 of the specification, where the SNP sites are in square brackets. The physical locations of the 31 SNP sites are determined based on the alignment of the whole genome sequence of Robinia pseudoacacia. The project number of the whole genome sequence of Robinia pseudoacacia on Genome SequenceArchive is PRJCA011483, and the combination of SNP sites is Rp01-Rp31. Rp01 is located at position 24743774 on chromosome 1, and its base is either A or G. Rp02 is located at position 25073091 on chromosome 1, and its base is either T or C. Rp03 is located at position 10092129 on chromosome 2, and its base is either G or A. Rp04 is located at position 91986640 on chromosome 2, and its base is either T or A. Rp05 is located at position 77754558 on chromosome 2, and its base is either T or C. Rp06 is located at position 31665898 on chromosome 3, and its base is G or T. Rp07 is located at position 51595394 on chromosome 3, and its base is either A or G. Rp08 is located at position 58788005 on chromosome 3, and its base is either A or G. Rp09 is located at position 13201378 on chromosome 4, and its base is either T or G. Rp10 is located at position 50929921 on chromosome 4, and its base is C or T. Rp11 is located at position 14062444 on chromosome 5, and its base is either T or G. Rp12 is located at position 8770487 on chromosome 5, and its base is either G or A. Rp13 is located at position 23451076 on chromosome 5, and its base is either G or A. Rp14 is located at position 36805502 on chromosome 6, and its base is either T or C. Rp15 is located at position 38935765 on chromosome 6, and its base is either A or G. Rp16 is located at position 15159147 on chromosome 6, and its base is either G or A. Rp17 is located at position 16475934 on chromosome 7, and its base is C or T. Rp18 is located at position 32754651 on chromosome 7, and its base is either G or A. Rp19 is located at position 33235428 on chromosome 7, and its base is C or T. Rp20 is located at position 55265643 on chromosome 8, and its base is either A or G. Rp21 is located at position 58008516 on chromosome 8, and its base is C or T. Rp22 is located at position 27772901 on chromosome 8, and its base is either A or T. Rp23 is located at position 83018029 on chromosome 8, and its base is C or T. Rp24 is located at position 3365777 on chromosome 9, and its bases are either T or C. Rp25 is located at position 37712675 on chromosome 9, and its base is G or C. Rp26 is located at position 50778644 on chromosome 9, and its base is either T or C. Rp27 is located at position 12726029 on chromosome 10, and its base is either G or A. Rp28 is located at position 42009697 on chromosome 10, and its base is either A or G. Rp29 is located at position 43720312 on chromosome 10, and its bases are either T or C. Rp30 is located at position 58984753 on chromosome 11, and its base is G or T. Rp31 is located at position 71873654 on chromosome 11, and its bases are either T or C.
2. The SNP molecular marker combination as described in claim 1, characterized in that, The 31 SNP loci include a subset of 12 SNP loci, which can achieve 100% differentiation of the 105 Robinia pseudoacacia germplasm resources to be identified. The subset consists of Rp22, Rp23, Rp13, Rp14, Rp28, Rp26, Rp04, Rp27, Rp16, Rp01, Rp21, and Rp24.
3. The use of a reagent for detecting the SNP molecular marker combination of claim 1 or 2 in the genome of *Robinia pseudoacacia* in any of the following: (1) Application in the preparation of a kit for detecting the genotype of SNP sites in Robinia pseudoacacia; (2) Application in genotyping of Robinia pseudoacacia; (3) Application in constructing a locust DNA fingerprint.
4. A primer set for detecting the SNP molecular marker combination as described in claim 1 or 2, characterized in that, The primer set contains primer pairs for KASP genotyping detection. Each SNP site corresponds to a set of primers, and each set of primers contains two forward primers and one reverse primer. The KASP primers used to detect Rp01 are two forward primers as shown in SEQ ID NO.1-2 and a reverse primer as shown in SEQ ID NO.3; The KASP primers used to detect Rp02 are two forward primers as shown in SEQ ID NO.4-5 and a reverse primer as shown in SEQ ID NO.6; The KASP primers used to detect Rp03 are two forward primers as shown in SEQ ID NO.7-8 and a reverse primer as shown in SEQ ID NO.9; The KASP primers used to detect Rp04 are the two forward primers shown in SEQ ID NO.10-11 and the reverse primer shown in SEQ ID NO.12; The KASP primers used to detect Rp05 are the two forward primers shown in SEQ ID NO.13-14 and the reverse primer shown in SEQ ID NO.15; The KASP primers used to detect Rp06 are the two forward primers shown in SEQ ID NO.16-17 and the reverse primer shown in SEQ ID NO.18; The KASP primers used to detect Rp07 are the two forward primers shown in SEQ ID NO.19-20 and the reverse primer shown in SEQ ID NO.21; The KASP primers used to detect Rp08 are the two forward primers shown in SEQ ID NO.22-23 and the reverse primer shown in SEQ ID NO.24; The KASP primers used to detect Rp09 are the two forward primers shown in SEQ ID NO.25-26 and the reverse primer shown in SEQ ID NO.27; The KASP primers used to detect Rp10 are two forward primers as shown in SEQ ID NO.28-29 and a reverse primer as shown in SEQ ID NO.30; The KASP primers used to detect Rp11 are two forward primers as shown in SEQ ID NO.31-32 and a reverse primer as shown in SEQ ID NO.33; The KASP primers used to detect Rp12 are two forward primers as shown in SEQ ID NO.34-35 and a reverse primer as shown in SEQ ID NO.36; The KASP primers used to detect Rp13 are the two forward primers shown in SEQ ID NO.37-38 and the reverse primer shown in SEQ ID NO.39; The KASP primers used to detect Rp14 are the two forward primers shown in SEQ ID NO.40-41 and the reverse primer shown in SEQ ID NO.42; The KASP primers used to detect Rp15 are two forward primers as shown in SEQ ID NO.43-44 and a reverse primer as shown in SEQ ID NO.45; The KASP primers used to detect Rp16 are two forward primers as shown in SEQ ID NO.46-47 and a reverse primer as shown in SEQ ID NO.48; The KASP primers used to detect Rp17 are two forward primers as shown in SEQ ID NO.49-50 and a reverse primer as shown in SEQ ID NO.51; The KASP primers used to detect Rp18 are two forward primers as shown in SEQ ID NO.52-53 and a reverse primer as shown in SEQ ID NO.54; The KASP primers used to detect Rp19 are two forward primers as shown in SEQ ID NO.55-56 and a reverse primer as shown in SEQ ID NO.57; The KASP primers used to detect Rp20 are two forward primers as shown in SEQ ID NO.58-59 and a reverse primer as shown in SEQ ID NO.60; The KASP primers used to detect Rp21 are two forward primers as shown in SEQ ID NO. 61-62 and a reverse primer as shown in SEQ ID NO. 63; The KASP primers used to detect Rp22 are two forward primers as shown in SEQ ID NO. 64-65 and a reverse primer as shown in SEQ ID NO. 66; The KASP primers used to detect Rp23 are two forward primers as shown in SEQ ID NO. 67-68 and a reverse primer as shown in SEQ ID NO. 69; The KASP primers used to detect Rp24 are the two forward primers shown in SEQ ID NO.70-71 and the reverse primer shown in SEQ ID NO.72; The KASP primers used to detect Rp25 are two forward primers as shown in SEQ ID NO.73-74 and a reverse primer as shown in SEQ ID NO.75; The KASP primers used to detect Rp26 are two forward primers as shown in SEQ ID NO.76-77 and a reverse primer as shown in SEQ ID NO.78; The KASP primers used to detect Rp27 are two forward primers as shown in SEQ ID NO.79-80 and a reverse primer as shown in SEQ ID NO.81; The KASP primers used to detect Rp28 are two forward primers as shown in SEQ ID NO.82-83 and a reverse primer as shown in SEQ ID NO.84; The KASP primers used to detect Rp29 are two forward primers as shown in SEQ ID NO.85-86 and a reverse primer as shown in SEQ ID NO.87; The KASP primers used to detect Rp30 are two forward primers as shown in SEQ ID NO. 88-89 and a reverse primer as shown in SEQ ID NO. 90; The KASP primers used to detect Rp31 are two forward primers as shown in SEQ ID NO. 91-92 and a reverse primer as shown in SEQ ID NO.
93.
5. The primer set for detecting the SNP molecular marker combination of claim 1 or 2 as described in claim 4, characterized in that, The 5' ends of the two forward primers are connected to different fluorescent tag sequences, including a FAM fluorescent tag sequence and a HEX fluorescent tag sequence; the FAM fluorescent tag sequence is shown in SEQ ID No. 94, and the HEX fluorescent tag sequence is shown in SEQ ID No.
95.
6. A kit comprising a primer set for detecting the SNP molecular marker combination of claim 4 or 5.
7. The use of the primer set of claim 4 or 5 or the kit of claim 6 in any of the following: (1) Genotyping of black locust trees; (2) Constructing a DNA fingerprint of Robinia pseudoacacia; (3) Identify the authenticity of black locust germplasm resources.
8. A method for genotyping and constructing a DNA fingerprint of Robinia pseudoacacia, characterized in that, Includes the following steps: (1) Extract genomic DNA from the black locust sample to be tested; (2) Using the genomic DNA obtained in step (1) as a template, the subset consisting of 12 SNP sites described in claim 2 is amplified by competitive allele-specific PCR (KASP) using the primer set described in claim 4 or 5. (3) Detect the fluorescence signal of the PCR amplification product and determine the genotype of the Robinia pseudoacacia sample at the corresponding SNP site based on the fluorescence signal; (4) Based on the genotype results obtained in step (3), construct the DNA fingerprint of the locust sample.
9. The method for genotyping and constructing a DNA fingerprint of Robinia pseudoacacia as described in claim 8, characterized in that, The DNA fingerprint is the core code that converts the genotype results into digital codes, wherein the wild-type genotype is coded as 01, the homozygous mutant genotype is coded as 10, and the heterozygous genotype is coded as 11.
10. A method for identifying black locust germplasm resources, characterized in that, The DNA fingerprint of the black locust sample to be tested is constructed using the method described in claim 8 or 9, and the fingerprint is compared with the standard DNA fingerprint of a known superior black locust variety, thereby realizing the identification or authenticity of germplasm resources.
Citation Information
Patent Citations
SSR (Simple Sequence Repeat) primesr of platygaster robiniae buhl and duso and application thereof to population genetic diversity analysis
CN108588234A
Robinia pseudoacacia core germplasm characteristic fingerprint spectrum and construction method thereof
CN119530425A