RNAi agents for inhibiting expression of mitochondrial amidoxime reducing component 1 (MARC1), pharmaceutical compositions and methods of use thereof

Abstract

The present disclosure relates to RNAi agents, e.g., double-stranded RNAi agents, capable of inhibiting the expression of a mitochondrial amidoxime reducing component 1 (MARC1) gene. Also disclosed are pharmaceutical compositions comprising the MARC1 RNAi agent and methods of using the same. In some embodiments, the MARC1 RNAi agents disclosed herein can be conjugated to targeting ligands, including ligands comprising N-acetyl-galactosamine, to facilitate delivery to hepatocytes. Delivery of the MARC1 RNAi agent in vivo provides inhibition of MARC1 gene expression. RNAi agents may be used in methods of treating diseases, disorders or conditions mediated in part by MARC1 gene expression, including non-alcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD), alcoholic fatty liver disease, autoimmune hepatitis, hepatic fibrosis, cirrhosis, elevated blood cholesterol levels, hypertriglyceridemia, liver disease, and / or other MARC1 related diseases.

Description

[0001] Cross-reference of related applications This application claims the benefit of priority to U.S. Provisional Patent Application Serial No. 63 / 490,694, filed March 16, 2023, the contents of which are incorporated herein by reference in their entirety.

[0002] sequence list This application contains a sequence list (compliant with standard ST26) submitted in XML format and hereby referenced in its entirety. The XML sequence list is named 30716-WO_SeqListing.xml, created on March 5, 2024, and has a size of 6388 kb. Technical Field

[0003] This disclosure relates to RNA interference (RNAi) agents for inhibiting mitochondrial micamine oxime reducing component 1 (MARC1), such as double-stranded RNAi agents, like chemically modified small (or short) interfering RNA (siRNA), pharmaceutical compositions including MARC1 RNAi agents, and methods of use for treating MARC1-related diseases or disorders. Background Technology

[0004] The mitochondrial amine oxime reducing component (MARC) protein was first discovered and described in 2006 as a molybdenum-containing cofactor component in the mitochondrial benzamide oxime prodrug conversion system. The human genome contains two MARC genes: MTARC1 and 2 (commonly referred to as MARC1 and MARC2, respectively), which encode MARC1 and MARC2 proteins that share significant sequence and functional homology.

[0005] Researchers have identified a rare missense variant (called the p.A165T mutation) in the MARC1 protein that leads to loss of function of the MARC1 protein. This mutation is associated with prevention of cirrhosis, reduction of liver fat, and reduction of various other liver disease biomarkers. (Emdin CA et al., A missense variant in Mitochondrial Amidoxime Reducing Component 1 gene and protection against liver disease, PLoS Genet. (April 2020); 16(4):e1008629). Individuals homozygous for this loss-of-function mutation in MARC1 exhibit lower levels of liver fat and are less likely to be diagnosed with fatty liver by physicians. Loss-of-function mutations in MARC1 are also associated with lower blood levels of alanine aminotransferase, alkaline phosphatase, total cholesterol, and LDL-cholesterol.

[0006] Although the exact mechanisms by which MARC1 is associated with liver disease progression are not fully understood, the reported associations with MARC1 have been further validated by recent genome-wide association studies focusing on liver disease and autoimmune hepatitis. This further confirms that missense mutations in MARC1 and the resulting loss of function are protective against liver injury and cirrhosis (Janik et al., MARC1 p.A165T variant is associated with decreased markers of liver injury and enhanced antioxidant capacity in autoimmune hepatitis. Sci Rep (2021);11:24407). These pooled data suggest that reducing MARC1 protein may lower blood cholesterol levels and protect the liver from cirrhosis, and that inhibiting MARC1 may be a potential therapeutic target for treating liver disease. Summary of the Invention

[0007] There is a need for novel RNA interference (RNAi) agents (referred to as RNAi agents, RNAi triggers, or triggers) capable of selectively and effectively inhibiting MARC1 gene expression, such as double-stranded RNAi agents, like chemically modified siRNA. Furthermore, there is a need for compositions of novel MARC1-specific RNAi agents for use as therapeutics or drugs to treat MARC1-related diseases or disorders, such as non-alcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD), alcoholic fatty liver disease, autoimmune hepatitis, liver fibrosis, cirrhosis, elevated blood cholesterol levels, hypertriglyceridemia, liver disease, and / or other MARC1-related disorders.

[0008] The nucleotide sequences and chemical modifications of the MARC1 RNAi agents disclosed herein differ from those previously disclosed or known in the art. The MARC1 RNAi agents disclosed herein provide highly specific, potent, and effective in vivo and / or in vitro inhibition of MARC1 gene expression.

[0009] In some embodiments, the sense strand comprises a nucleotide sequence of at least 15 consecutive nucleotides that differ from any of the sense strand sequences in Tables 2, 4, 5 or 6D by 0 or 1 nucleotide, and wherein the sense strand has a region that is at least 85% complementary to the antisense strand on the 15 consecutive nucleotides.

[0010] In some embodiments, this document discloses RNAi agents for inhibiting MARC1 gene expression, which comprise: The antisense strand, wherein nucleotides 1-19 of the antisense strand comprise nucleotides 1-19 of the antisense strand sequences in Tables 2, 3, or 6D, and The sense strand contains a nucleotide sequence that is at least partially complementary to the antisense strand. All or substantially all nucleotides of the antisense strand and / or sense strand are modified nucleotides, and the RNAi agent is linked to a targeting ligand containing N-acetyl-galactosamine.

[0011] In some embodiments, this document discloses RNAi agents for inhibiting MARC1 gene expression, which contain... A sense strand is a nucleotide sequence of at least 15 consecutive nucleotides that differ from any of the sense strand sequences in Tables 2, 4, 5 or 6D by 0 or 1 nucleotide, wherein the sense strand has a region on the 15 consecutive nucleotides that is at least 85% complementary to the antisense strand.

[0012] In some implementations, at least one nucleotide of the MARC1 RNAi agent includes a modified nucleoside linker.

[0013] In some embodiments, the modified nucleotides of the MARC1 RNAi agents disclosed herein are selected from: 2'-O-methyl nucleotides, 2'-fluoronucleotides, 2'-deoxynucleotides, 2',3'-open-ring nucleotide mimics, locked nucleotides, 2'-F-arabinonucleotides, 2'-methoxyethyl nucleotides, debased nucleotides, ribitols, reverse nucleotides, reverse 2'-O-methyl nucleotides, reverse 2'-deoxynucleotides, 2'-amino-modified nucleotides, 2'-alkyl-modified nucleotides, morpholinonucleotides, vinylphosphonate-containing nucleotides, cyclopropylphosphonate-containing nucleotides, and 3'-O-methyl nucleotides.

[0014] In other embodiments, all or substantially all modified nucleotides of the RNAi agents disclosed herein are 2'-O-methyl nucleotides, 2'-fluoro nucleotides, or combinations thereof.

[0015] In some implementations, the antisense strand consists of, is substantially composed of, or contains any of the modified antisense strand sequences in Table 3 or Table 6D.

[0016] In some implementations, the sense strand consists of, is substantially composed of, or contains any of the modified sense strand sequences in Tables 4, 5, or 6D.

[0017] In some implementations, the antisense strand contains a nucleotide sequence of any of the modified sequences in Table 3 or Table 6D, and the sense strand contains a nucleotide sequence of any of the modified sequences in Table 4 or Table 6D.

[0018] The RNAi agents disclosed herein are linked to a targeting ligand comprising N-acetyl-galactosamine. In further embodiments, the targeting ligand is linked to the sense strand. In some embodiments, the targeting ligand is linked to the 5' end of the sense strand.

[0019] In some embodiments, the sense strand is 15-30 nucleotides long, and the antisense strand is 19-30 nucleotides long. In other embodiments, the sense strand and antisense strand are each 21-27 nucleotides long. In other embodiments, the sense strand and antisense strand are each 21-24 nucleotides long. In still other embodiments, the sense strand and antisense strand are each 21 nucleotides long.

[0020] In some implementations, the RNAi agent has two blunt ends.

[0021] In some embodiments, the sense chain includes one or two end caps. In other embodiments, the sense chain includes one or two reverse debase residues.

[0022] In some embodiments, the RNAi agent comprises a sense strand and an antisense strand that form a double-stranded sequence that creates the double-stranded structure shown in Tables 6A, 6B, 6C, or 6D.

[0023] In some implementations, the sense strand further includes a reverse debasement residue at the 3' end, the 5' end, or both of the nucleotide sequence.

[0024] In a further embodiment, the targeting ligand comprises or is composed of the following: (NAG37), or (NAG37s).

[0025] This article also discloses compositions comprising the disclosed RNAi agent, wherein the compositions further comprise pharmaceutically acceptable excipients.

[0026] Additionally, this article provides a method for inhibiting MARC1 gene expression in hepatocytes in human subjects in vivo, the method comprising introducing an effective amount of the disclosed MARC1 RNAi agent or the disclosed composition into the subject.

[0027] This article further provides a method for treating MARC1-related diseases, disorders, or symptoms, comprising administering a therapeutically effective amount of the disclosed composition to a human subject who requires it.

[0028] In some implementations, the disease is non-alcoholic steatohepatitis (NASH), alcoholic and non-alcoholic fatty liver disease (NAFLD), fatty liver disease, cirrhosis, elevated blood cholesterol levels, hypertriglyceridemia, liver disease, and / or other MARC1-related diseases.

[0029] In some embodiments, the RNAi agent is administered at a dose of about 0.05 mg / kg to about 5.0 mg / kg of human subject weight. In some embodiments, the MARC1 RNAi agent disclosed herein is administered as a single injection of a fixed dose containing about 50 mg, about 100 mg, about 200 mg, about 300 mg, or about 400 mg of MARC1 RNAi agent.

[0030] This article also provides the use of the disclosed RNAi agents or compositions for the treatment of diseases, disorders, or symptoms that are at least partially mediated by MARC1 gene expression.

[0031] This document further provides the use of the disclosed RNAi agents or the disclosed compositions in the preparation of pharmaceutical compositions for treating at least a portion of diseases, disorders, or symptoms mediated by MARC1 gene expression. Detailed Implementation

[0032] The disclosed RNAi agents, their compositions, and methods of use can be more readily understood by referring to the specific embodiments that form part of this disclosure. It should be understood that this disclosure is not limited to what is specifically described and / or shown herein, and the terminology used herein is for the purpose of describing particular embodiments by way of example only and is not intended to be limiting.

[0033] It should be appreciated that although some features of this disclosure included herein are described in the context of individual embodiments for clarity, they may also be provided in combination in individual embodiments. Conversely, various features of the disclosed methods described in the context of individual embodiments for brevity may also be provided individually or in any sub-combination.

[0034] definition As used herein, “RNAi agent” means a chemical composition containing RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecules capable of degrading or inhibiting (e.g., under appropriate conditions) the translation of messenger RNA (mRNA) transcripts of target mRNA in a sequence-specific manner. As used herein, RNAi agents may act via RNA interference mechanisms (i.e., by interacting with RNA interference pathway mechanisms in mammalian cells, such as RNA-induced silencing complexes or RISC) or through any alternative mechanism or pathway. Although RNAi agents (as used herein) are believed to act primarily through RNA interference mechanisms, the disclosed RNAi agents are not bound to or limited by any particular pathway or mechanism of action. The RNAi agents disclosed herein contain sense and antisense strands and include, but are not limited to, small (or short) interfering RNAs (siRNA), double-stranded RNAs (dsRNA), microRNAs (miRNA), short hairpin RNAs (shRNA), and dicer substrates. The antisense strand of the RNAi agents described herein is at least partially complementary to the targeted mRNA (i.e., MARC1 mRNA). RNAi agents may include one or more modified nucleotides and / or one or more non-phosphodiester linkages.

[0035] As used herein, when referring to the expression of a given gene, the terms “silence,” “reduction,” “inhibition,” “downregulation,” or “knockdown” mean that when a cell, cell population, tissue, organ, or subject is treated with the RNAi agent described herein, the expression of that gene is reduced compared to a second cell, cell population, tissue, organ, or subject that has not been so treated, as measured by the level of RNA transcribed from that gene or the level of polypeptides, proteins, or protein subunits translated from mRNA in the cell, cell population, tissue, organ, or subject in which the gene is transcribed.

[0036] As used herein, the terms "sequence" and "nucleotide sequence" refer to a continuous sequence or order of nucleobases or nucleotides, described using standard nomenclature as a continuous sequence of letters. Nucleic acid molecules may contain unmodified and / or modified nucleotides. Nucleotide sequences may contain unmodified and / or modified nucleotides.

[0037] As used herein, “base,” “nucleotide base,” or “nucleobase” refers to a heterocyclic pyrimidine or purine compound that is a component of a nucleotide, and includes the major purine bases adenine and guanine, and the major pyrimidine bases cytosine, thymine, and uracil. Nucleobases may be further modified to include, without limitation, universal bases, hydrophobic bases, hybrid bases, size-extended bases, and fluorinated bases. (See, for example, Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008). The synthesis of such modified nucleobases (including phosphorous amide compounds containing modified nucleobases) is known in the art.

[0038] As used herein, the term "nucleotide" has the same meaning as commonly understood in the art. Therefore, as used herein, the term "nucleotide" refers to a glycoside comprising a sugar moiety, a base moiety, and a covalently linked group (linkage group) such as a phosphate ester or thiophosphate nucleoside linker, and encompasses both naturally occurring nucleotides (such as DNA or RNA) and non-naturally occurring nucleotides comprising modified sugar and / or base moieties (which are also referred to herein as nucleotide analogs). In this document, a single nucleotide may be referred to as a monomer or unit.

[0039] As used herein, and unless otherwise specified, the term "complementary" when used to describe a first nucleobase or nucleotide sequence (e.g., a sense strand or targeted mRNA of an RNAi agent) relative to a second nucleobase or nucleotide sequence (e.g., an antisense strand or single-stranded antisense oligonucleotide of an RNAi agent) means the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize with an oligonucleotide comprising the second nucleotide sequence under certain standard conditions (forming base-pair hydrogen bonds under mammalian physiological conditions (or other suitable in vivo or in vitro conditions)) and to form a double-stranded or double-helical structure. Those skilled in the art will be able to select the set of conditions most suitable for the hybridization test. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs and include native or modified nucleotides or nucleotide mimics to at least the extent required to satisfy the hybridization requirements described above. Sequence identity or complementarity is independent of modification. For example, for the purpose of determining identity or complementarity, a and Af, as defined herein, are complementary to U (or T) and identical to A.

[0040] As used herein, “perfectly complementary” or “completely complementary” means that in a hybridization pair of nucleobase or nucleotide sequences, all (100%) bases in the first oligonucleotide sequence will hybridize with the same number of bases in the second oligonucleotide sequence. The sequence may contain all or part of the first or second nucleotide sequence.

[0041] As used herein, "partially complementary" means that in a hybridization pair of nucleobase or nucleotide sequence molecules, at least 70% (but not all) of the bases in the first oligonucleotide sequence will hybridize with the same number of bases in the second oligonucleotide sequence. The sequence may contain all or part of the first or second nucleotide sequence.

[0042] As used herein, “substantially complementary” means that in a hybridization pair of nucleobase or nucleotide sequence molecules, at least 85% (but not all) of the bases in the first oligonucleotide sequence will hybridize with the same number of bases in the second oligonucleotide sequence. The sequence may contain all or part of the first or second nucleotide sequence.

[0043] As used herein, the terms “complementary,” “fully complementary,” “partially complementary,” and “substantially complementary” refer to the matching of nucleobases or nucleotides between the sense and antisense strands of the RNAi agent or between the antisense strand of the RNAi agent and the MARC1 mRNA sequence.

[0044] As used herein, the terms "substantially identical" or "substantially identical" when applied to nucleic acid sequences mean that a nucleotide sequence (or a portion thereof) has at least about 85% sequence identity or more when compared to a reference sequence, for example, at least 90%, at least 95%, or at least 99% identity. The percentage of sequence identity is determined by comparing two best-aligned sequences in a comparison window. The percentage is calculated by determining the number of positions in both sequences where the same type of nucleic acid bases appear to obtain the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. The invention disclosed herein covers those nucleotide sequences that are substantially identical to those disclosed herein.

[0045] As used herein, the terms “individual,” “patient,” and “subject” are used interchangeably to refer to a member of any animal species, including but not limited to birds, humans, and other primates, as well as other mammals, including commercially relevant mammals or animal models such as mice, rats, monkeys, cattle, pigs, horses, sheep, cats, and dogs. Preferably, the subject is a human.

[0046] As used herein, the terms “treat” and “treatment” mean a method or procedure taken to provide relief or reduction in the number, severity, and / or frequency of one or more symptoms of a disease in a subject. As used herein, “treat” and “treatment” can include prevention, management, preventive treatment, and / or suppression or reduction of the number, severity, and / or frequency of one or more symptoms of a disease in a subject.

[0047] As used herein, the phrase “introduced into cells” when referring to RNAi agents means the functional delivery of the RNAi agent into cells. The phrase “functional delivery” means the delivery of the RNAi agent into cells in a manner that enables the RNAi agent to have the desired biological activity (e.g., sequence-specific inhibition of gene expression).

[0048] Unless otherwise stated, the symbols used herein shall be as follows. The use of means that any one or more groups may be attached to it, which is consistent with the scope of the invention described herein.

[0049] As used herein, the term "isomer" refers to compounds that have the same molecular formula but differ in the properties or bonding order of their atoms, or in the spatial arrangement of their atoms. Isomers that differ in the spatial arrangement of their atoms are called "stereoisomers." Stereoisomers that are not mirror images of each other are called "diastereomers," and stereoisomers that are non-overlapping mirror images are called "enantiomers," or sometimes optical isomers. The carbon atom bonded to four different substituents is called a "chiral center."

[0050] As used herein, unless specifically identified as having a particular conformation, for each structure in which an asymmetry center is present and thus produces enantiomers, diastereomers, or other stereoisomer configurations, each structure disclosed herein is intended to represent all such possible isomers, including their optically pure and racemic forms. For example, the structures disclosed herein are intended to cover mixtures of diastereomers as well as single stereoisomers.

[0051] As used in the claims herein, the phrase “consisting of” excludes any element, step, or ingredient not specified in the claim. When used in the claims herein, the phrase “consisting substantially of” limits the scope of the claim to the specified materials or steps and those materials or steps that do not substantially affect the essential and novel features of the claimed invention.

[0052] Those skilled in the art will readily understand and recognize that the compounds and compositions disclosed herein may have certain atoms in a protonated or deprotonated state (e.g., N, O, or S atoms), depending on the environment in which the compound or composition is situated. Therefore, as used herein, the structures disclosed contemplate certain functional groups that can be protonated or deprotonated, such as OH, SH, or NH. As those skilled in the art will readily understand, the disclosure herein is intended to cover the disclosed compounds and compositions regardless of their protonation state based on the environment (e.g., pH). Accordingly, compounds described herein having unstable protons or basic atoms should also be understood to represent salt forms of the corresponding compounds. The compounds described herein may be in the form of free acids, free bases, or salts. Pharmaceutically acceptable salts of the compounds described herein should be understood to be within the scope of this invention.

[0053] As used herein, the terms “link” or “combination” when referring to a connection between two compounds or molecules mean that the two compounds or molecules are connected by a covalent bond. Unless otherwise stated, the terms “link” and “combination” as used herein may refer to a connection between a first compound and a second compound, with or without any intermediate atoms or groups.

[0054] As used herein, the term “including” is used to mean the phrase “including but not limited to” and is used interchangeably with it. The term “or” is used herein to mean the term “and / or” and is used interchangeably with it unless the context clearly indicates otherwise.

[0055] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While those similar to or equivalent to the methods and materials described herein may be used in the practice or testing of this invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated herein by reference in their entirety. In case of conflict, the definitions included in this specification shall prevail. Furthermore, materials, methods, and examples are illustrative only and are not intended to be limiting.

[0056] Where a value is explicitly listed, it should be understood that values ​​that are approximately the same quantity or amount as the listed value are also within the scope of this disclosure. Where a combination is disclosed, each sub-combination of elements in that combination is also specifically disclosed and within the scope of this disclosure. Conversely, where different elements or groups of elements are disclosed individually, their combinations are also disclosed. Where any disclosed element is disclosed to have multiple substitutes, instances in which each substitute is excluded individually or in any combination with other substitutes are also hereby disclosed; more than one element may be disclosed with such exclusion, and all combinations of elements with such exclusion are hereby disclosed.

[0057] Other objects, features, aspects and advantages of the invention will become apparent from the following detailed description, the accompanying drawings and the claims.

[0058] Detailed description RNAi agents This document describes RNAi agents for inhibiting MARC1 gene expression. Each MARC1 RNAi agent comprises a sense strand and an antisense strand. The sense strand can be 15-49 nucleotides in length. The antisense strand can be 19-49 nucleotides in length. The sense and antisense strands can be the same length or they can be different lengths. In some embodiments, the sense and antisense strands are each independently 19-27 nucleotides in length. In some embodiments, both the sense and antisense strands are each 21-26 nucleotides in length. In some embodiments, both the sense and antisense strands are each 21-24 nucleotides in length. In some embodiments, the sense strand is about 19 nucleotides in length and the antisense strand is about 21 nucleotides in length. In some embodiments, the sense strand is about 21 nucleotides in length and the antisense strand is about 23 nucleotides in length. In some embodiments, the sense strand is 23 nucleotides in length and the antisense strand is 21 nucleotides in length. In some embodiments, both the sense and antisense strands are each 21 nucleotides in length. In some embodiments, the length of the antisense strand of the RNAi agent is independently 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In some embodiments, the length of the sense strand of the RNAi agent is independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides. The sense and antisense strands are annealed to form a double strand, and in some embodiments, the double-stranded RNAi agent has a double strand length of about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides.

[0059] Examples of nucleotide sequences used to form the MARC1 RNAi agent are provided in Tables 2, 3, 4, and 5. Examples of RNAi agent duplexes including the sense and antisense strand sequences in Tables 2, 3, 4, and 5 are shown in Tables 6A and 6B.

[0060] In some implementations, the region of perfect complementarity, substantially complementarity, or partial complementarity between the sense and antisense strands is 15-26 nucleotides long (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26) and is located at or near the 5' end of the antisense strand (e.g., this region may be separated from the 5' end of the antisense strand by 0, 1, 2, 3, or 4 imperfectly complementary, substantially complementary, or partially complementary nucleotides).

[0061] The sense strand of the MARC1 RNAi agent described herein comprises at least 15 consecutive nucleotides having at least 85% identity with a core segment sequence (also referred to herein as the "core segment" or "core sequence") of the same number of nucleotides in the MARC1 mRNA. In some embodiments, the sense strand core segment sequence is 100% (perfectly) complementary to or at least about 85% (substantially) complementary to the core segment sequence in the antisense strand, and therefore the sense strand core segment sequence is generally perfectly identical to or has at least about 85% identity with a nucleotide sequence of the same length present in the MARC1 mRNA target (sometimes referred to, for example, the target sequence). In some embodiments, the length of the sense strand core segment is 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides. In some embodiments, the length of the sense strand core segment is 17 nucleotides. In some embodiments, the length of the sense strand core segment is 19 nucleotides. In some embodiments, the length of the sense strand core segment is 21 nucleotides.

[0062] The antisense strand of the MARC1 RNAi agent described herein comprises a core segment of the same number of nucleotides as that in MARC1 mRNA and at least 15 consecutive nucleotides having at least 85% complementarity to a core segment of the same number of nucleotides as that in the corresponding sense strand. In some embodiments, the antisense strand core segment is 100% (perfectly) complementary or at least about 85% (substantially) complementary to a nucleotide sequence of the same length present in the MARC1 mRNA target (e.g., the target sequence). In some embodiments, the length of the antisense strand core segment is 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides. In some embodiments, the length of the antisense strand core segment is 21 nucleotides. In some embodiments, the length of the antisense strand core segment is 19 nucleotides. The sense strand core segment sequence may be the same length as the corresponding antisense core sequence, or it may be of a different length.

[0063] MARC1 RNAi agents anneal the sense and antisense strands to form a doublet. The sense and antisense strands of MARC1 RNAi agents can be partially, substantially, or completely complementary to each other. Within the complementary doublet region, the sense core sequence is at least 85% or 100% complementary to the antisense core sequence. In some embodiments, the sense core sequence contains a sequence of at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 nucleotides, which is at least 85% or 100% complementary to the corresponding 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotide sequence of the antisense core sequence (i.e., the sense and antisense core sequences of the MARC1 RNAi agent have regions with at least 85% or 100% base pairing of at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 nucleotides).

[0064] In some embodiments, the antisense strand of the MARC1 RNAi agent disclosed herein differs from any antisense strand sequence in Table 2 or Table 3 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of the MARC1 RNAi agent disclosed herein differs from any sense strand sequence in Table 2, Table 4, or Table 5 by 0, 1, 2, or 3 nucleotides.

[0065] In some implementations, the sense strand and / or antisense strand may optionally and independently contain an additional 1, 2, 3, 4, 5, or 6 nucleotides (extensions) at the 3', 5', or both 3' and 5' ends of the core region sequence. The additional nucleotides of the antisense strand (if present) may be complementary to or not complementary to the corresponding sequence in the MARC1 mRNA. The additional nucleotides of the sense strand (if present) may be identical to or different from the corresponding sequence in the MARC1 mRNA. The additional nucleotides of the antisense strand (if present) may be complementary to or not complementary to the additional nucleotides of the corresponding sense strand (if present).

[0066] As used herein, the extension comprises 1, 2, 3, 4, 5, or 6 nucleotides at the 5' and / or 3' ends of the sense strand core segment sequence and / or the antisense strand core segment sequence. The extended nucleotides on the sense strand may be complementary or non-complementary to nucleotides in the corresponding antisense strand, which are either core segment sequence nucleotides or extended nucleotides. Conversely, the extended nucleotides on the antisense strand may be complementary or non-complementary to nucleotides in the corresponding sense strand, which are either core segment nucleotides or extended nucleotides. In some embodiments, both the sense and antisense strands of the RNAi agent contain 3' and 5' extensions. In some embodiments, one or more of the 3' extended nucleotides of one strand pair with one or more 5' extended nucleotide bases of the other strand. In other embodiments, one or more of the 3' extended nucleotides of one strand do not pair with one or more 5' extended nucleotide bases of the other strand. In some embodiments, the MARC1 RNAi agent has an antisense strand with a 3' extension and a sense strand with a 5' extension. In some embodiments, one or more of the extended nucleotides are unpaired and form overhangs. As used herein and in the art, "protruding end" refers to an extension of one or more unpaired nucleotide segments located at the end of the sense or antisense strand that does not form part of the hybridization or double-stranded portion of the RNAi agent disclosed herein.

[0067] In some embodiments, the MARC1 RNAi agent comprises a 3' extended antisense strand having a length of 1, 2, 3, 4, 5, or 6 nucleotides. In other embodiments, the MARC1 RNAi agent comprises a 3' extended antisense strand having a length of 1, 2, or 3 nucleotides. In some embodiments, one or more of the antisense strand extended nucleotides comprise nucleotides complementary to the corresponding MARC1 mRNA sequence. In some embodiments, one or more of the antisense strand extended nucleotides comprise nucleotides not complementary to the corresponding MARC1 mRNA sequence.

[0068] In some embodiments, the MARC1 RNAi agent comprises a 3' extended sense strand having a length of 1, 2, 3, 4, or 5 nucleotides. In some embodiments, one or more of the sense strand extending nucleotides comprise adenosine, uracil, or thymidine nucleotides, AT dinucleotides, or nucleotides corresponding to or identical to nucleotides in the MARC1 mRNA sequence. In some embodiments, the 3' sense strand extension includes, but is not limited to, one or more of the following sequences or constitutes thereof: T, UT, TT, UU, UUT, TTT, or TTTT (each listed from 5' to 3').

[0069] The sense strand may have a 3' extension and / or a 5' extension. In some embodiments, the MARC1 RNAi agent comprises a sense strand with a 5' extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides contain nucleotides that correspond to or are identical to nucleotides in the MARC1 mRNA sequence.

[0070] Examples of sequences used to form MARC1 RNAi agents are provided in Tables 2, 3, 4, 5, and 6D. In some embodiments, the antisense strand of the MARC1 RNAi agent comprises any sequence from Tables 2, 3, or 6D. In some embodiments, the antisense strand of the MARC1 RNAi agent comprises or consists of any of the modified sequences from Tables 3 or 6D. In some embodiments, the antisense strand of the MARC1 RNAi agent comprises nucleotides (from 5' to 3') 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, or 2-21 from any sequence from Tables 2, 3, or 6D. In some embodiments, the sense strand of the MARC1 RNAi agent comprises any sequence from Tables 2, 4, 5, or 6D. In some embodiments, the sense strand of the MARC1 RNAi agent comprises nucleotides (from 5' to 3') 1-18, 1-19, 1-20, 1-21, 2-19, 2-20, 2-21, 3-20, 3-21, or 4-21 from any sequence in Tables 2, 4, 5, or 6D. In some embodiments, the sense strand of the MARC1 RNAi agent contains or is composed of any of the modified sequences in Tables 4, 5, or 6D.

[0071] In some embodiments, the sense and antisense strands of the RNAi agent described herein contain the same number of nucleotides. In some embodiments, the sense and antisense strands of the RNAi agent described herein contain different numbers of nucleotides. In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of the RNAi agent form blunt ends. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of the RNAi agent form blunt ends. In some embodiments, both ends of the RNAi agent are blunt ends. In some embodiments, neither end of the RNAi agent is blunt end. As used herein, "blunt end" refers to the end of a double-stranded RNAi agent in which the terminal nucleotides of the two annealed strands are complementary (forming complementary base pairs).

[0072] In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of the RNAi agent form a sporadic end. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of the RNAi agent form a sporadic end. In some embodiments, both ends of the RNAi agent form sporadic ends. In some embodiments, neither end of the RNAi agent is a sporadic end. As used herein, a sporadic end refers to the end of a double-stranded RNAi agent in which the terminal nucleotides of the two annealed strands form a pair (i.e., no overhang) but are not complementary (i.e., a non-complementary pair). In some embodiments, one or more unpaired nucleotides at the end of one strand of the double-stranded RNAi agent form an overhang. The unpaired nucleotides may form 3' or 5' overhangs on either the sense or antisense strand. In some embodiments, the RNAi agent contains: a blunt end and a detached end, a blunt end and a 5' overhang, a blunt end and a 3' overhang, a detached end and a 5' overhang, a detached end and a 3' overhang, two 5' overhangs, two 3' overhangs, a 5' overhang and a 3' overhang, two detached ends, or two blunt ends. Generally, when present, the overhang is located at the 3' end of the sense strand, the antisense strand, or both the sense and antisense strands.

[0073] The MARC1 RNAi agents disclosed herein may also contain one or more modified nucleotides. In some embodiments, substantially all nucleotides of the sense strand and substantially all nucleotides of the antisense strand of the MARC1 RNAi agent are modified nucleotides. The MARC1 RNAi agents disclosed herein may further contain one or more modified internucleotide links, such as one or more phosphate thioester links. In some embodiments, the MARC1 RNAi agent contains one or more modified nucleotides and one or more modified internucleotide links. In some embodiments, a 2'-modified nucleotide is combined with a modified internucleotide link.

[0074] In some embodiments, the MARC1 RNAi agent is prepared or provided as a salt, a mixed salt, or a free acid. In some embodiments, the MARC1 RNAi agent is prepared as a pharmaceutically acceptable salt. In some embodiments, the MARC1 RNAi agent is prepared as a pharmaceutically acceptable sodium salt. Such forms, well known in the art, are within the scope of the invention disclosed herein.

[0075] Modified nucleotides When used in various oligonucleotide constructs, the modified nucleotides can preserve the activity of the compounds in cells while increasing the serum stability of these compounds, and can also minimize the possibility of activating interferon activity in humans after administration of the oligonucleotide constructs.

[0076] In some embodiments, the MARC1 RNAi agent contains one or more modified nucleotides. As used herein, “modified nucleotide” refers to a nucleotide other than a ribonucleotide (2'-hydroxynucleotide). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides are modified nucleotides. As used herein, modified nucleotides may include, but are not limited to, deoxyribonucleotides, nucleotide mimics, debased nucleotides, 2'-modified nucleotides, reverse nucleotides, nucleotides containing modified nucleosides, bridging nucleotides, peptide nucleic acids (PNAs), 2',3'-open-ring nucleotide mimics (non-locked nucleobase analogs), locked nucleotides, 3'-O-methoxy (2' nucleoside-linked) nucleotides, 2'-F-arabinonucleotides, 5'-Me,2'-fluoronucleotides, morpholinonucleotides, vinylphosphonate deoxyribonucleotides, vinylphosphonate-containing nucleotides, and cyclopropylphosphonate-containing nucleotides. 2'-Modified nucleotides (i.e., nucleotides having a group other than a hydroxyl group at the 2' position of a five-membered sugar ring) include, but are not limited to, 2'-O-methyl nucleotides (also referred to herein or in the art as 2'-methoxynucleotides), 2'-fluoronucleotides (also referred to herein or in the art as 2'-deoxy-2'-fluoronucleotides), 2'-deoxynucleotides, 2'-methoxyethyl (2'-O-2-methoxyethyl) nucleotides (also referred to herein or in the art as 2'-MOE nucleotides), 2'-aminonucleotides, and 2'-alkylnucleotides. All positions in a given compound need not be uniformly modified. Instead, more than one modification may be incorporated into a single MARC1 RNAi agent or even a single nucleotide thereof. The sense and antisense strands of a MARC1 RNAi agent can be synthesized and / or modified by methods known in the art. A modification at one nucleotide is independent of a modification at another nucleotide.

[0077] Modified nucleobases include synthetic and natural nucleobases, such as 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines (e.g., 2-aminopropyladenine, 5-propynyluracil, or 5-propynylcytosine), 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, inosine, xanthine, hypoxanthine, 2-aminoadenine, adenine, and guanine 6-alkyl (e.g., 6-methyl, 6-ethyl, 6-isopropyl, or 6-n-butyl) derivatives, 2-alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl, or 2-n-butyl) and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiouracil, etc. Thymine, 2-thiocytosine, 5-halogenated uracil, cytosine, 5-propynyluracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halogenated, 8-amino, 8-mercapto, 8-thioalkyl, 8-hydroxy and other 8-substituted adenine and guanine, 5-halogenated (e.g., 5-bromo), 5-trifluoromethyl and other 5-substituted uracil and cytosine, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazoguanine, 7-deazoadenine, 3-deazoguanine and 3-deazoadenine.

[0078] In some embodiments, the 5' and / or 3' ends of the antisense strand may include a debase residue (Ab), which may also be referred to as a "debase site" or "debase nucleotide". A debase residue (Ab) is a nucleotide or nucleoside lacking a nucleotide base at the 1' position of the sugar moiety. In some embodiments, the debase residue may be placed inside the nucleotide sequence. In some embodiments, Ab or AbAb may be added to the 3' end of the antisense strand. In some embodiments, the 5' end of the sense strand may include one or more additional debase residues (e.g., (Ab) or (AbAb)). In some embodiments, UUAb, UAb, or Ab is added to the 3' end of the sense strand. In some embodiments, the debase (deoxyribose) residue may be replaced with a ribitol (debase ribose) residue.

[0079] In some embodiments, all or substantially all nucleotides of the RNAi agent are modified nucleotides. As used herein, an RNAi agent in which substantially all nucleotides are modified nucleotides is an RNAi agent having four or fewer (i.e., 0, 1, 2, 3, or 4) ribonucleotides (i.e., unmodified) in both the sense and antisense strands. As used herein, a sense strand in which substantially all nucleotides are modified nucleotides is a sense strand having two or fewer (i.e., 0, 1, or 2) unmodified ribonucleotides in the sense strand. As used herein, an antisense strand in which substantially all nucleotides are modified nucleotides is an antisense strand having two or fewer (i.e., 0, 1, or 2) unmodified ribonucleotides in the antisense strand. In some embodiments, one or more nucleotides of the RNAi agent are unmodified ribonucleotides. The chemical structures of some modified nucleotides are shown in Table 7 herein.

[0080] Modified nucleoside linkages In some embodiments, one or more nucleotides of the MARC1 RNAi agent are linked via non-standard links or a backbone (i.e., modified internucleotide links or a modified backbone). Modified internucleotide links or backbones include, but are not limited to, thiophosphate groups (represented herein as lowercase "s"), chiral thiophosphates, thiophosphates, dithiophosphates, phosphate triesters, aminoalkyl phosphate triesters, alkylphosphonates (e.g., methylphosphonates or 3'-alkylenephosphonates), chiral phosphonates, phosphonites, aminophosphates (e.g., 3'-aminoaminophosphates, aminoalkylaminophosphates, or thiocarbonylaminophosphates), thiocarbonyl alkylphosphonates, thiocarbonyl alkyl phosphate triesters, morpholino links, borane phosphates with normal 3'-5' links, borane phosphate analogs with 2'-5' links, or borane phosphates with reverse polarity (where adjacent nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'). In some embodiments, the modified internucleotide links or backbones lack a phosphorus atom. Modified internucleotide linkages lacking phosphorus atoms include, but are not limited to, linkages between short-chain alkyl or cycloalkyl sugars, linkages between mixed heteroatoms and alkyl or cycloalkyl sugars, or linkages between one or more short-chain heteroatoms or heterocyclic sugars. In some embodiments, the modified internucleotide backbone includes, but is not limited to, siloxane backbones, sulfide backbones, sulfoxide backbones, sulfone backbones, formacetyl and thioformacetyl backbones, methyleneformacetyl and thioformacetyl backbones, olefin-containing backbones, aminosulfonate backbones, methyleneimino and methylenehydrazine backbones, sulfonate and sulfonamide backbones, amide backbones, and other backbones having mixed N, O, S, and CH2 components.

[0081] In some embodiments, the sense strand of the MARC1 RNAi agent may contain 1, 2, 3, 4, 5, or 6 phosphate-thioester links, and the antisense strand of the MARC1 RNAi agent may contain 1, 2, 3, 4, 5, or 6 phosphate-thioester links, or both the sense and antisense strands may independently contain 1, 2, 3, 4, 5, or 6 phosphate-thioester links. In some embodiments, the sense strand of the MARC1 RNAi agent may contain 1, 2, 3, or 4 phosphate-thioester links, and the antisense strand of the MARC1 RNAi agent may contain 1, 2, 3, or 4 phosphate-thioester links, or both the sense and antisense strands may independently contain 1, 2, 3, or 4 phosphate-thioester links.

[0082] In some embodiments, the sense strand of the MARC1 RNAi agent contains at least two phosphate-thioester nucleoside links. In some embodiments, the phosphate-thioester nucleoside links are located between nucleotides at positions 1-3 starting from the 3' end of the sense strand. In some embodiments, one phosphate-thioester nucleoside link is located at the 5' end of the sense strand nucleotide sequence, and another phosphate-thioester link is located at the 3' end of the sense strand nucleotide sequence. In some embodiments, two phosphate-thioester nucleoside links are located at the 5' end of the sense strand, and another phosphate-thioester link is located at the 3' end of the sense strand. In some embodiments, the sense strand does not contain any phosphate-thioester nucleoside links between nucleotides, but contains one, two, or three phosphate-thioester links between the terminal nucleotides at both the 5' and 3' ends and optionally, a reverse debasement residue cap. In some embodiments, the targeting ligand is linked to the sense strand via phosphate-thioester links.

[0083] In some embodiments, the antisense strand of the MARC1 RNAi agent contains four phosphate-thioester nucleoside links. In some embodiments, the four phosphate-thioester nucleoside links are between nucleotides at positions 1-3 from the 5' end of the antisense strand, and between nucleotides at positions 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 from the 5' end. In some embodiments, three phosphate-thioester nucleoside links are located between positions 1-4 from the 5' end of the antisense strand, and a fourth phosphate-thioester nucleoside link is located between positions 20-21 from the 5' end of the antisense strand. In some embodiments, the MARC1 RNAi agent contains at least three or four phosphate-thioester nucleoside links in the antisense strand.

[0084] Capped residues or parts In some embodiments, the sense chain may include one or more capping residues or portions, sometimes referred to in the art as “cap,” “terminal cap,” or “capped residue.” As used herein, a “capped residue” is a nonnucleotide compound or other portion that may be incorporated at one or more ends of the nucleotide sequence of the RNAi agent disclosed herein. In some cases, the capping residue may provide the RNAi agent with certain beneficial properties, such as protection against exonuclease degradation. In some embodiments, an inverse ablation residue (invAb) (also referred to in the art as an “inverse ablation site”) is added as a capping residue. (See, for example, F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16; U.S. Patent No. 5,998,203). Capping residues are generally known in the art and include, for example, inverse ablation residues and carbon chains, such as terminal C3H7 (propyl), C6H… 13 (Hexyl) or C 12 H 25 (Dodecyl). In some embodiments, the capping residue is present at the 5' end, 3' end, or both of the 5' and 3' ends of the sense chain. In some embodiments, the 5' end and / or 3' end of the sense chain may include more than one reverse debased deoxyribose moiety as a capping residue.

[0085] In some embodiments, one or more inverse debase residues (invAbs) are added to the 3' end of the sense strand. In some embodiments, one or more inverse debase residues (invAbs) are added to the 5' end of the sense strand. In some embodiments, one or more inverse debase residues or inverse debase sites are inserted between the nucleotide sequences of the target ligand and the sense strand of the RNAi agent. In some embodiments, including one or more inverse debase residues or inverse debase sites at or near one or more ends of the sense strand of the RNAi agent enables enhancement of the activity of the RNAi agent or other desired properties.

[0086] In some embodiments, one or more inverse debase residues (invAb) are added to the 5' end of the sense strand. In some embodiments, one or more inverse debase residues may be inserted between the nucleotide sequences of the target ligand and the sense strand of the RNAi agent. The inverse debase residues may be linked via phosphate esters, thiophosphate esters (e.g., shown herein as (invAb)s), or other nucleoside linkages. In some embodiments, including one or more inverse debase residues at or near one or more ends of the sense strand of the RNAi agent may enable enhancement of the activity or other desired properties of the RNAi agent. In some embodiments, the inverse debase (deoxyribose) residue may be replaced with an inverse ribitol (debase ribose) residue. In some embodiments, the 3' end of the core segment sequence of the antisense strand, or the 3' end of the antisense strand sequence, may include an inverse debase residue. The chemical structures of the inverse debase deoxyribose residues are shown in Table 7 below.

[0087] MARC1 RNAi agent The MARC1 RNAi agents disclosed in this paper are designed to target specific locations on the MARC1 gene (e.g., SEQ ID NO:1).

[0088] Homo sapiens ( Homo sapiens ), Mitochondrial methylamine oxime reducing component 1 (MARC1), mRNA transcript (SEQ ID NO: 1) (7287 bases), NCBI Reference Sequence: NM_022746.4: 1 cttgccgccg ccacctcgcg gagaagccag ccatgggcgc cgccggctcc tccgcgctgg 61 cgcgctttgt cctcctcgcg caatcccggc ccgggtggct cggggttgcc gcgctgggcc 121 tgaccgcggt ggcgctgggg gctgtcgcct ggcgccgcgc atggcccacg cggcgccggc 181 ggctgctgca gcaggtgggc acagtggcgc agctctggat ctaccctgtg aaatcctgca 241 aggggggtgcc ggtgagcgag gcggagtgca cggccatggg gctgcgcagc ggcaacctgc 301 gggacaggtt ttggcttgtg atcaaccagg agggaaacat ggttactgct cgccaggaac 361 ctcgcctggt cctgatttcc ctgacctgcg atggtgacac cctgactctc agtgcagcct 421 acacaaagga cctactactg cctatcaaaa cgcccaccac aaatgcagtg cacaagtgca 481 gagtgcacgg cctggagata gagggcaggg actgtggcga ggccaccgcc cagtggataa 541 ccagcttcct gaagtcacag ccctaccgcc tggtgcactt cgagcctcac atgcgaccga 601 gacgtcctca tcaaatagca gacttgttcc gacccaagga ccagattgct tactcagaca 661 ccagcccatt cttgatcctt tctgaggcgt cgctggcgga tctcaactcc aggctagaga 721 agaaagttaa agcaaccaac ttcaggccca atattgtaat ttcaggatgc gatgtctatg 781 cagaggattc ttgggatgag cttcttattg gtgacgtgga actgaaaagg gtgatggctt 841 gttccagatg cattttaacc acagtggacc cagacaccgg tgtcatgagc aggaaggaac 901 cgctggaaac actgaagagt tatcgccagt gtgacccttc agaacgaaag ttatatggaa 961 aatcaccact ctttgggcag tattttgtgc tggaaaaccc agggaccatc aaagtgggag 1021 accctgtgta cctgctgggc cattaatggg aaccgtatgt cctggaatattagatgcctt 1081 ttaaaaatgt tctcaaaaat gacaacactt gaagcatggt gtttcagaactgagacctct 1141 acattttctt taaatttgtg attttcacat ttttcgtctt ttggacttctggtgtctcaa 1201 tgcttcaatg tcccagtgca aaaagtaaag aaatatagtc tcaataacttagtaggactt 1261 cattaagtca cttaaatgac aagacaggat tctgaaaact ccccgtttaactgattatgg 1321 aatagttctt tctcctgctt ctccgtttat ctaccaagag cgcagacttgcatcctgtca 1381 1441 atcctagaat gtgttattgc ccctgttcat gaggtacgca atgaaaattaaattgcaccc 1501 1561 ggcataaaga ctgaggtgac cttcaggaag cactgcagat attaattttcatagatctg 1621 gatctggccc tgctgcttct cagacagcat tggatttcct aaaggtgctcaggaggatgg 1681 ttgtgtagtc atggaggacc cctggatcct tgccattccc ctcagctaatgacggagtgc 1741 tccttctcca gttccgggtg aaaaagttct gaattctgtg gaggagaagaaaagtgattc 1801 agtgatttca gatagactac tgaaaacctt taaaggggga aaaggaaagcatatgtcagt 1861 tgtttaaaac ccaatatcta ttttttaact gattgtataa ctctaagatctgatgaagta 1921 tattttttat tgccattttg tcctttgatt atattgggaa gttgactaaacttgaaaaat 1981 gtttttaaaa ctgtgaataa atggaagcta ctttgactag tttcagatcttactaacttc 2041 ttggcacaaa gttagactgt gaaagctgac tgaggctggg cacaggggctcatgcctgta 2101 attccagcac tttgggaggc caaggtggga gaatggcttg agcccaggagtttgagacca 2161 gcccagaaaa tataatggga tcctgtcgct acaaaatgtt tttaaaatgcactcggtgtg 2221 gtggtgtgtg cctgcagtcc tggctatggc tactcgggag gatgaggtagaaggattggt 2281 tgagcccagg agcgggagat tgaggctgca gtgagttatg attgcaccactacactccag 2341 cctgagtgat agagtgagac cctatctcta aaaaagaaac aggaaaaaaaaagaaagctg 2401 actgaggtga atgggcaaag ccagtaattc tgacacctga ccacagctgggtcttctgca 2461 taatgacct cctcacccac agcctcccag gcaagcaccc atgtttgaaggactatcaag 2521 tcaacatgct ttttaccaaa agctgcacat ttttcacttt gattttataaaagaggtcag 2581 taatcgctga aatctagctg agccctgaag taaagttctg agcaaagaggtgcatgtgct 2641 tgttttatgg ttggtgaatt attacagttt gttttctgca tgcttggcatgaggtgaata 2701 attacatcaa ttttccagag aacctgggcc atcaccttcc ccaacaagtccagttgatgt 2761 tgaaactaca gatagattga gacaaagcga agtgttcagc aagtagcattactaatggga 2821 ccgggggacc cgtgggagag tgagtgtaca caggatttag gaaaccatgtgaatatgggc 2881 tctctgggaa tagccaatag gtagggagca atcagaaacc caaggtttggtggctcttcc 2941 taggtattta taattagtgg caagtgaaag ccttagtcct gaatttctaaccacttgtaa 3001 gaactaacag ccacttctct gtgccccgtc cgggcagtaa ccatcattctccatggacag 3061 gctctcgggg tagctagctc tgcagggcag cacccacgtg gaagggagcacccagaacc 3121 ctcctcactg ggcagacctg tccttctgtg cctcacagtg tgaggaagattcctgtttga 3181 agagagaagt tccagtgacc tctagaatct cagagtagtt gccaagctttctgtcagtga 3241 gatttaaagg ccatttactt gtgtttatt tatatttaat gagttggttaatgccagaga 3301 caaagctgat atcccattta ttttggatac tgagcatttg cacactattccacttgaaat 3361 atagaatcag gaatgtaggc catccagac tttcagatct tacaacagcaaatgacagat 3421 gtttgagatc aggccaaaat atccaccctc ggtgggcatc tcctctgtgtggcaacttat 3481 gctgcagcca cagtggggag tcacaaactc agagctggag gtcttgaaaaggacaatgtg 3541 ggccaggctc cggaggggct gcctaaaggc ttgcttttgt gactctcctgcagaaaatgt 3601 tagaaacttc caaccgaaag acgaggcag caacttatac acacgaaggcagaaagaaat 3661 tgggggaaggg gaggctgttg gaattcaggc cgttgtccta tagggagaaatactctcct 3721 ctccttctcc ctttactgat aacggggcat ggtgaggaga tgagcttgtgagggtctgcc 3781 agtttggtaa gagtgcatgg ggaggttggg taaattagac tagccaaatgggacttcggg 3841 aaaccattta tgaggctgtc accaacagtg atggcaggct gaaattccaggcaagtgctc 3901 ccagcattcc aagagtgtat caaaaaag caacccatga tggtggagaacagatacatt 3961 aaagttcctt gaaaatgaca gagtggctct cagaccagac cttgattgtgggtataatcg 4021 gagtgttgct accaccct aacactgcat ttcccgtgtt ttatggtccatggaattct 4081 4141 tcctgcgtgc ctcacttctc ttcaaaggca aaaggctctg gagaggccttcatgaagaca 4201 tctgtgttta atgctgccct tcccaaaggt ctgtttttga ctgtcttttgagaaatgatc 4261 ctctgatctc taggcagaat gccagtgagc caaggaatcc cagttagcaggaggggtgca 4321 4381 cacttccct tgtcctctcc cttgcccctc ttgctggagt aaaaggatggaactgggact 4441 tgataggtta aaggaggtgt ggagaagtgt cttagaccag ctctcctgttgtgggcctta 4501 gggagaagca ctctctttct tcgggatcat tttccaaaca tgcatttttggatggatagg 4561 gtggatcagg gtgagggaag ggaaccaaa ctctctctaa ccttgcccttacagcaatac 4621 ctgtgatgta agttacaaaa ccacctgtga tgaaagtgct ccaggatgcttcatgcacca 4681 gggaggggtg ccctgtttct cttctgctag cttctccttt cttttttttttttcttcttt 4741 tttttgagac agtgtctcac tctgttgcca ggctggagtg cagtggtgagatctcagctc 4801 actgcagcct ctgcctccca ggttcaagca attcttctgc ctcagcctcccgagtagctg 4861 gtgtgtctgg agttggttcc ttctggtggg ttcttggtct cgctgacttcaagaatgaag 4921 ccacagacct tcgcagtgag tgttacagct cttaaaggtg gcacggacccaaagtgagca 4981 gtagcaagat ttattgtgga gagcgaaaga acaaagcttc ggaaggggacccaaatgggc 5041 tgctgctgct ggctggggtg gccacctttt attcccttat ttgtccctgcccatgtcctg 5101 ctgattgctc cattttacag agtgctgatt ggtccatttt acagagtgctgattggtgca 5161 tttacaatcc tttagctaga cacagagtgc cgattggtga gtttttacagtgctgattgg 5221 tgcatttaca atcctttagc tagacacaga acactgactg gtgcatttataatcctctag 5281 ctagaaagaa aagttctcca agtccccact agacccagga agtccagctggcttcacctc 5341 tcactgggac tacaggtgca caccaccaca cccagctaat tttgtatttttagtagaga 5401 cggggttca ccatgttgtt caggatgtc tcgactt gatctcgtgatcccccc 5461 tcggccccc aaagtgctgg gattacagtt gtgagccacc acggcccggcccttttc 5521 ctttctgttg caagtcctct caactgt tgccttccac cctacaagcagaattacct 5581 cagaagtcct atggccctga cttatctat gtctgcacaa agcactactgtgctttgctg 5641 tctgcaagaa cagagattgt ttgctcaac cactctct gatgatgaatgagttatg 5701 atgatatcta aagttaccca atttcaagca agaggaagaa tctggctcggtaccacacagat 5761 gttcttggaa ttgggatagt aaaaagtcc ctgaggcatc ccttggtctgctctgaccac 5821 actctctca caggaagagg cttgggccac agctctgact atactctgctcttcctcca 5881 aacacagctg aggaattggg tggtggggca cctgctccca tgctgtggctggctcag 5941 agagagagt tgccttaatt acattattat tctcctgga caggctgtaggttgtgtaaa 6001 gtaacaaaa gggactgagaa gtgactccc attcagccctc ttccaggccattttgata 6061 ggcaggtcaa attcactcac atttggttat ttgttggcca gtctagtgcattcacccttg 6121 ctggtcctca gtcatgctcc tttaccttta cagagcatcc tagactgctcttcctcttac 6181 cttccttgtg aaacccacaa cccctagtcc ctccccttcc ctggcatttgttatgccctc 6241 taccaatccc tgacctggta ttggtcagtc tccaatcctg gtggatccctgtgggaacta 6301 agttaagtct aacttttgtc tccctcttta gaatttactg ggagtactgtaaataaacta 6361 ttgttgttat aattatttct gattaacatt tttacaccta acaaagtctcagagagattg 6421 aatttactgg gttgaaggga ggagcacctt ccacatgacc tgcccagcaattaaagccgc 6481 ttgttagtcc gaggcccagg acggccgagg acagctggag agctcttcgttgcaggcagc 6541 tctggttaac atcaaccggg aaagctcttt gtaaacacat gaataattgatcgtccagcg 6601 ctcacatagc taccgcggat ctgagcccgt atgactcatt tgcgagccattcctgtcgtc 6661 tggatgccat aacattggag gaatgatgat cgtttcttgg aggttcttctgtggccagag 6721 ttgccaagac caaggctgta atggtttgtt atgatgacct ttgttattccattaggctca 6781 attgctttaa aaaatgatgt gtgcatactt taggaacgtt tttaccctttatgttgacct 6841 gacatcatag tttatattat aaaatgtatt aatgacagaa gagtgttttcatgtcccaag 6901 gacaaatttt aacaaccata atctgccctc agtcatcata aatataaatgtattggtcaa 6961 acagatctcg ttaatgtggc caagataaat gcaagtctat attttaaggcagtcgaagtc 7021 ctagagaata tatctggagc ttttgtgggg ctaagagatc ttgtatatatgctatcaaaa 7081 ggctgagaaa attaacatgt tcccccctct gattttgcat tggacagatataaatgtctt 7141 ggggatgtca agtaagattg ttcacatagt ttctggacac cattaatgcctgatggggtg 7201 aatcttagtt cttaaagcta tattctgctc attatgctca cagggcttttgaaaagagaa 7261 caaaataaag atttcaagtc ttagcaa As defined herein, an antisense sequence is designed to target the gene at a given position on the gene when the 5' terminal nucleobase of the antisense is aligned with a position 21 nucleotides downstream (towards the 3' end) from the given position on the gene when it pairs with a base of the MARC1 gene. For example, as shown in Tables 1 and 2 of this document, an antisense sequence designed to target the MARC1 gene at position 1275 requires that the 5' terminal nucleobase of the antisense is aligned with position 1295 of the MARC1 gene when it pairs with a base of the gene.

[0089] As provided in this article, the MARC1 RNAi agent does not require the nucleotide at position 1 (5'→ 3') of the antisense strand to be complementary to the gene, provided that the antisense strand and the gene have at least 85% complementarity over a core segment sequence of at least 15 consecutive nucleotides (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% complementarity). For example, for the MARC1 RNAi agent disclosed herein designed to target position 1275 of the MARC1 gene, the 5' nucleotide of the antisense strand of the MARC1 RNAi agent must be aligned with position 1295 of the gene; however, the 5' nucleotide of the antisense strand may, but is not required to, be complementary to position 1295 of the MARC1 gene, provided that the antisense strand and the gene have at least 85% complementarity over a core segment sequence of at least 15 consecutive nucleotides (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity). In particular, as illustrated in the embodiments disclosed herein and as is well known in the art, the specific site of gene binding of the antisense strand of the MARC1 RNAi agent (e.g., regardless of whether the MARC1 RNAi agent is designed to target the MARC1 gene at position 1275, 1190, or some other location) is important for the level of inhibition achieved by the MARC1 RNAi agent and the toxicity profile achieved by the molecule. (See, for example, Kamola et al.) The siRNA Non-seed Region and Its Target Sequences are Auxiliary Determinants of Off-Target Effects , PLOS Computational Biology, 11(12), Figure 1 (2015)).

[0090] In some embodiments, the MARC1 RNAi agents disclosed herein target the MARC1 gene at or near the location of the MARC1 gene sequence shown in Table 1. In some embodiments, the antisense strand of the MARC1 RNAi agents disclosed herein includes a core segment sequence that is completely, substantially, or at least partially complementary to the target MARC1 19-mer sequence disclosed in Table 1.

[0091] Table 1. Target sequence of MARC1 19-mer mRNA (taken from Homo sapiens MARC1, mRNA, GenBank NM_022746.4 (SEQ ID NO:1)) SEQ ID No. MARC1 19-mer target sequence (5'→3') Corresponding position of the sequence on SEQ ID NO: 1 Gene position targeted (as referred to herein) 2 GGUUUUGGCUUGUGAUCAA 307-325 305 3 GUUUUGGCUUGUGAUCAAC 308-326 306 4 UUUUGGCUUGUGAUCAACC 309-327 307 5 CAGGAGGGAAACAUGGUUA 327-345 325 6 UCUCAGUGCAGCCUACACA 407-425 405 7 CUCAGUGCAGCCUACACAA 408-426 406 8 AGUGCAGCCUACACAAAGG 411-429 409 9 UGCAGCCUACACAAAGGAC 413-431 411 10 ACACAAAGGACCUACUACU 421-439 419 11 UAACCAGCUUCCUGAAGUC 538-556 536 12 CCGCCUGGUGCACUUCGAG 566-584 564 13 CGCCUGGUGCACUUCGAGC 567-585 565 14 GCCUGGUGCACUUCGAGCC 568-586 566 15 CCUGGUGCACUUCGAGCCU 569-587 567 16 CGUCCUCAUCAAAUAGCAG 603-621 601 17 UCAAAUAGCAGACUUGUUC 611-629 609 18 CAAAUAGCAGACUUGUUCC 612-630 610 19 AAAUAGCAGACUUGUUCCG 613-631 611 20 GGACCAGAUUGCUUACUCA 638-656 636 21 CAGAUUGCUUACUCAGACA 642-660 640 22 UUGCUUACUCAGACACCAG 646-664 644 23 GGCUAGAGAAGAAAGUUAA 712-730 710 24 AGAGAAGAAAGUUAAAGCA 716-734 714 25 AGAAGAAAGUUAAAGCAAC 718-736 716 26 GCCCAAUAUUGUAAUUUCA 746-764 744 27 CAGGAUGCGAUGUCUAUGC 763-781 761 28 UCCAGAUGCAUUUUAACCA 843-861 841 29 CUGGAAACACUGAAGAGUU 903-921 901 30 ACCCUUCAGAACGAAAGUU 934-952 932 31 CCCUUCAGAACGAAAGUUA 935-953 933 32 CAGAACGAAAGUUAUAUGG 940-958 938 33 GAACGAAAGUUAUAUGGAA 942-960 940 34 AAAGUUAUAUGGAAAAUCA 947-965 945 35 UGGAAAAUCACCACUCUUU 956-974 954 36 GAAAAUCACCACUCUUUGG 958-976 956 37 CAAAGUGGGAGACCCUGUG 1010-1028 1008 38 AAAGUGGGAGACCCUGUGU 1011-1029 1009 39 GUGGGAGACCCUGUGUACC 1014-1032 1012 40 UGGGAGACCCUGUGUACCU 1015-1033 1013 41 GGGAGACCCUGUGUACCUG 1016-1034 1014 42 GUCCUGGAAUAUUAGAUGC 1059-1077 1057 43 UCCUGGAAUAUUAGAUGCC 1060-1078 1058 44 CCUGGAAUAUUAGAUGCCU 1061-1079 1059 45 CUGGAAUAUUAGAUGCCUU 1062-1080 1060 46 UCUCAAAAAUGACAACACU 1091-1109 1089 47 UGACAACACUUGAAGCAUG 1100-1118 1098 48 AACACUUGAAGCAUGGUGU 1104-1122 1102 49 GAAGCAUGGUGUUUCAGAA 1111-1129 1109 50 AGCAUGGUGUUUCAGAACU 1113-1131 1111 51 AGAACUGAGACCUCUACAU 1126-1144 1124 52 AGACCUCUACAUUUUCUUU 1133-1151 1131 53 UGAUUUUCACAUUUUUCGU 1159-1177 1157 54 GUGUCUCAAUGCUUCAAUG 1192-1210 1190 55 UCUCAAUGCUUCAAUGUCC 1195-1213 1193 56 CUUAGUAGGACUUCAGUAA 1248-1266 1246 57 AUGACAAGACAGGAUUCUG 1276-1294 1274 58 UGACAAGACAGGAUUCUGA 1277-1295 1275 59 GACAAGACAGGAUUCUGAA 1278-1296 1276 60 ACAGGAUUCUGAAAACUCC 1284-1302 1282 61 CGUUUAACUGAUUAUGGAA 1304-1322 1302 62 UGAUUAUGGAAUAGUUCUU 1312-1330 1310 63 UUAUGGAAUAGUUCUUUCU 1315-1333 1313 64 UAUGGAAUAGUUCUUUCUC 1316-1334 1314 65 CCUGCUUCUCCGUUUAUCU 1334-1352 1332 66 GAAGAAUAUCCUAGAAUGU 1434-1452 1432 67 UUUCCAUAGAUCUGGAUCU 1607-1625 1605 68 GCUUCUCAGACAGCAUUGG 1635-1653 1633 69 UUCUCAGACAGCAUUGGAU 1637-1655 1635 70 ACAGCAUUGGAUUUCCUAA 1644-1662 1642 71 CAUUGGAUUUCCUAAAGGU 1648-1666 1646 72 UUGGAUUUCCUAAAGGUGC 1650-1668 1648 73 ACUGAAAACCUUUAAAGGG 1819-1837 1817 74 GGAAAGCAUAUGUCAGUUG 1844-1862 1842 75 UGUCAGUUGUUUAAAACCC 1854-1872 1852 76 AACUCUAAGAUCUGAUGAA 1899-1917 1897 77 ACUCUAAGAUCUGAUGAAG 1900-1918 1898 78 UCUAAGAUCUGAUGAAGUA 1902-1920 1900 79 AUUGCCAUUUUGUCCUUUG 1929-1947 1927 80 CCAUUUUGUCCUUUGAUUA 1933-1951 1931 81 GGGAAGUUGACUAAACUUG 1956-1974 1954 82 GGAAGUUGACUAAACUUGA 1957-1975 1955 83 UGUGAAUAAAUGGAAGCUA 1992-2010 1990 84 ACUAGUUUCAGAUCUUACU 2016-2034 2014 85 GUUUCAGAUCUUACUAACU 2020-2038 2018 86 UUCAGAUCUUACUAACUUC 2022-2040 2020 87 GCAUGUGCUUGUUUUAUGG 2632-2650 2630 88 GACAAAGCGAAGUGUUCAG 2781-2799 2779 89 CCAGUGACCUCUAGAAUCU 3192-3210 3190 90 GCAUUUGCACACUAUUCCA 3334-3352 3332 91 GACAGAUGUUUGAGAUCAG 3414-3432 3412 92 UGUGUGGCAACUUAUGCUG 3466-3484 3464 93 GACCAGACCUUGAUUGUGG 3993-4011 3991 94 GGAGAAGCACUCUCUUUCU 4502-4520 4500 95 AACCAAACUCUCUCUAACC 4584-4602 4582 96 CAAACUCUCUCUAACCUUG 4587-4605 4585 97 GAUGUAAGUUACAAAACCA 4625-4643 4623 98 CCACCUGUGAUGAAAGUGC 4641-4659 4639 99 ACUGGUGCAUUUAUAAUCC 5257-5275 5255 100 AGCUCUGACUAUAACUCUG 5851-5869 5849 101 CCUUUACAGAGCAUCCUAG 6145-6163 6143 102 AACUAAGUUAAGUCUAACU 6296-6314 6294 103 CAGAGAGAUUGAAUUUACU 6410-6428 6408 104 GCUCUGGUUAACAUCAACC 6539-6557 6537 105 UGACCUGACAUCAUAGUUU 6835-6853 6833 106 AUAAAAUGUAUUAAUGACA 6959-6977 6957 107 UCUUAAAGCUAUAUUCUGC 7210-7228 7208 In some embodiments, the MARC1 RNAi agent includes an antisense strand, wherein position 19 (5'→ 3') of the antisense strand is capable of forming a base pair with position 1 of the 19-mer target sequence disclosed in Table 1.

[0092] In some embodiments, the MARC1 RNAi agent includes an antisense strand, wherein positions 2 (5'→ 3') of the antisense strand are capable of forming a base pair with position 18 of the 19-mer target sequence disclosed in Table 1. In some embodiments, the MARC1 RNAi agent includes an antisense strand, wherein positions 2 to 18 (5'→ 3') of the antisense strand are capable of forming a base pair with the respective complementary bases located at positions 18 to 2 of the 19-mer target sequence disclosed in Table 1.

[0093] For the RNAi agents disclosed herein, the nucleotide at position 1 (5' → 3') of the antisense strand may be perfectly complementary to the MARC1 gene or non-complementary to the MARC1 gene. In some embodiments, the nucleotide at position 1 (5' → 3') of the antisense strand is U, A, or dT. In some embodiments, the nucleotide at position 1 (5' → 3') of the antisense strand forms an A:U or U:A base pair with the sense strand.

[0094] In some embodiments, the MARC1 RNAi antisense strand comprises nucleotides (from 5' to 3') of any antisense strand sequence in Table 2 or Table 3, specifically sequences of 2-18, 2-19, 2-20, or 2-21. In some embodiments, the MARC1 RNAi sense strand comprises nucleotides (from 5' to 3') of any sense strand sequence in Tables 2, 4, 5, or 6D, specifically sequences of 3-21, 2-21, 1-21, 3-20, 2-20, 1-20, 3-19, 2-19, 1-19, 3-18, 2-18, or 1-18.

[0095] In some embodiments, the MARC1 RNAi antisense strand comprises nucleotides (from 5' to 3') 2-18, 2-19, 2-20, or 2-21 of any antisense strand sequence from Table 2 or Table 3. In some embodiments, the MARC1 RNAi sense strand comprises nucleotides (from 5' to 3') 3-21, 2-21, 1-21, 3-20, 2-20, 1-20, 3-19, 2-19, 1-19, 3-18, 2-18, or 1-18 of any sense strand sequence from Table 2, Table 4, Table 5, or Table 6D.

[0096] In some implementations, the MARC1 RNAi agent comprises: (i) an antisense strand comprising a sequence of nucleotides (from 5' to 3') 2-18 or 2-19 of any antisense strand sequence in Tables 2, 3, or 6D; and (ii) a sense strand comprising a sequence of nucleotides (from 5' to 3') 3-21, 2-21, 1-21, 3-20, 2-20, 1-20, 3-19, 2-19, 1-19, 3-18, 2-18, or 1-18 of any sense strand sequence in Tables 2, 4, 5, or 6D.

[0097] In some implementations, the MARC1 RNAi agent comprises: (i) an antisense strand comprising nucleotides (from 5' to 3') of sequence 2-18 or 2-19 of any antisense strand sequence in Tables 2, 3, or 6D; and (ii) a sense strand comprising nucleotides (from 5' to 3') of sequence 3-21, 2-21, 1-21, 3-20, 2-20, 1-20, 3-19, 2-19, 1-19, 3-18, 2-18, or 1-18 of any sense strand sequence in Tables 2, 4, 5, or 6D.

[0098] In some implementations, the MARC1 RNAi agent includes the core 19-mer nucleotide sequence shown in Table 2 below.

[0099] Table 2. Base sequences of the core regions of the antisense and sense strands of MARC1 RNAi agents (N = any nucleobase) MARC1 RNAi agents containing or composed of sequences from Table 2 may have modified or unmodified nucleotides in their sense and antisense strands. In some embodiments, MARC1 RNAi agents having sense and antisense strand sequences containing or composed of sequences from Table 2 are all or substantially all modified nucleotides.

[0100] In some embodiments, the antisense strand of the MARC1 RNAi agent disclosed herein differs from any antisense strand sequence in Table 2 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of the MARC1 RNAi agent disclosed herein differs from any sense strand sequence in Table 2 by 0, 1, 2, or 3 nucleotides.

[0101] As used herein, each N listed in the sequences disclosed in Table 2 may be independently selected from any and all nucleotides (including those found on both modified and unmodified nucleotides). In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have nucleotides complementary to the N nucleotides at the corresponding position on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have nucleotides not complementary to the N nucleotides at the corresponding position on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have the same nucleotides as the N nucleotides at the corresponding position on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have nucleotides different from the N nucleotides at the corresponding position on the other strand.

[0102] The antisense strands of certain modified MARC1 RNAi agents, along with their underlying unmodified nucleotide sequences, are provided in Table 3. The sense strands of certain modified MARC1 RNAi agents, along with their underlying unmodified nucleotide sequences, are provided in Table 4. In the formation of MARC1 RNAi agents, each nucleotide in each underlying nucleotide sequence listed in Tables 3 and 4 above, as well as in Table 2, can be a modified nucleotide.

[0103] The MARC1 RNAi agent described herein is formed by annealing the antisense strand with the sense strand. A sense strand containing a sequence listed in Table 2, Table 4, or Table 6D may hybridize with any antisense strand containing a sequence listed in Table 2, Table 3, or Table 6D, provided that the two sequences have regions of at least 85% complementarity over 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotide sequences.

[0104] In some implementations, the antisense strand of the MARC1 RNAi agent contains a nucleotide sequence of any sequence in Table 2, Table 3, or Table 6D.

[0105] In some embodiments, the MARC1 RNAi agent comprises or is composed of a duplex having a sense and antisense nucleobase sequence of any of the sequences in Tables 2, 3, 4, or 6D. In some embodiments, the MARC1 RNAi agent comprises or is composed of a duplex sequence prepared or provided as a sodium salt, mixed salt, or free acid.

[0106] Examples of antisense strands containing modified nucleotides are provided in Tables 3 and 6D. Examples of sense strands containing modified nucleotides are provided in Tables 4, 5, and 6D.

[0107] As used in Tables 3, 4, and 5, the following symbols are used to represent modified nucleotides and linking groups: A = adenosine-3'-phosphate; C = cytidine-3'-phosphate; G = guanosine-3'-phosphate; U = uridine-3'-phosphate I = Inosine-3'-phosphate a = 2-O-methyladenosine-3'-phosphate as = 2'-O-methyladenosine-3'-thiophosphate c = 2'-O-methylcytidine-3'-phosphate cs = 2'-O-methylcytidine-3'-thiophosphate g = 2'-O-methylguanosine-3'-phosphate gs = 2'-O-methylguanosine-3'-thiophosphate t = 2'-O-methyl-5-methyluridine-3'-phosphate ts = 2'-O-methyl-5-methyluridine-3'-thiophosphate u = 2'-O-methyluridine-3'-phosphate us = 2'-O-methyluridine-3'-thiophosphate i = 2'-O-methylinosine-3'-phosphate is = 2'-O-methylinosine-3'-thiophosphate Af = 2'-fluoroadenosine-3'-phosphate Afs = 2'-Fluoroadenosine-3'-Thiophosphate Cf = 2'-Fluorocytidine-3'-phosphate Cfs = 2'-Fluorocytidine-3'-Thiophosphate Gf = 2'-Fluoroguanosine-3'-phosphate Gfs = 2'-Fluoroguanosine-3'-Thiophosphate Tf = 2'-Fluoro-5'-methyluridine-3'-phosphate Tfs = 2'-fluoro-5'-methyluridine-3'-thiophosphate Uf = 2'-fluorouridine-3'-phosphate Ufs = 2'-fluorouridine-3'-thiophosphate A UNA = 2',3'-open-ring-adenosine-3'-phosphate, see Table 7 A UNA s = 2',3'-open-ring-adenosine-3'-thiophosphate, see Table 7 C UNA = 2',3'-open ring-cytidine-3'-phosphate, see Table 7 C UNA s = 2',3'-open-ring-cytidine-3'-thiophosphate, see Table 7 G UNA = 2',3'-open-ring-guanosine-3'-phosphate, see Table 7 G UNA s = 2',3'-open-ring-guanosine-3'-thiophosphate, see Table 7 U UNA = 2',3'-open-ring-uridine-3'-phosphate, see Table 7 U UNA s = 2',3'-open-ring-uridine-3'-thiophosphate, see Table 7 a_2N = 2'-O-methyl-2-aminoadenosine-3'-phosphate, see Table 7 a_2Ns = 2'-O-methyl-2-aminoadenosine-3'-thiophosphate, see Table 7 (invAb) = reverse debasing deoxyribonucleotide, see Table 7. (invAb)s = reverse debased deoxyribonucleotide-5'-thiophosphate ester, see Table 7 cPrpa = 5'-cyclopropylphosphonate-2'-O-methyladenosine-3'-phosphate (see Table 7) cPrpas = 5'-cyclopropylphosphonate-2'-O-methyladenosine-3'-thiophosphate (see Table 7) cPrpu = 5'-cyclopropylphosphonate-2'-O-methyluridine-3'-phosphate (see Table 7) cPrpus = 5'-cyclopropylphosphonate-2'-O-methyluridine-3'-thiophosphate (see Table 7) As will be readily understood by those skilled in the art, unless otherwise specified by sequence (e.g., by linking "s" via thiophosphate), nucleotide monomers in oligonucleotides are linked to each other via 5'-3'-phosphodiester bonds. As will be clearly understood by those skilled in the art, the thiophosphate linking shown in the modified nucleotide sequences disclosed herein replaces the phosphodiester linking generally present in oligonucleotides. Furthermore, it will be readily understood by those skilled in the art that, in vitro, the terminal nucleotide at the 3' end of a given oligonucleotide sequence will generally have a hydroxyl group (-OH) at the corresponding 3' position of the given monomer instead of a phosphate ester moiety. Additionally, for the embodiments disclosed herein, when considering the 5'→3' of the corresponding chain, a reverse debasement residue is inserted such that the 3' position of the deoxyribose is linked to the 3' end of the preceding monomer on the corresponding chain (see, for example, Table 7). Furthermore, as will be readily understood and appreciated by those skilled in the art, although the chemical structures of thiophosphates described herein generally show anions on sulfur atoms, the inventions disclosed herein cover all thiophosphate tautomers and resonance structures (e.g., where the sulfur atom has a double bond and the anion is on the oxygen atom). Unless otherwise expressly indicated herein, this understanding by those skilled in the art is used in describing the MARC1 RNAi agents and compositions thereof disclosed herein.

[0108] Examples of targeting ligands, targeting groups, and linker groups used with the MARC1 RNAi agents disclosed herein are provided in Table 7 below. More specifically, the targeting groups and linker groups (which together form a targeting ligand) include (NAG37) and (NAG37)s, the chemical structures of which are provided in Table 7 below. Each sense strand and / or antisense strand may have any of the targeting ligands, targeting groups, or linker groups listed herein, as well as other groups, conjugated to the 5' and / or 3' ends of the sequence.

[0109] Table 3. Antisense strand sequence of MARC1 RNAi agent Table 4. Sense sequences of MARC1 RNAi agents (linkers, conjugates, or capped portions are not shown). Table 5. Sense strand sequence of MARC1 RNAi agent (shown together with (NAG37) targeting ligand (see Table 7 for structural information)). The MARC1 RNAi agent described herein is formed by annealing the antisense strand with the sense strand. A sense strand containing the sequences listed in Tables 2, 4, or 5 may hybridize with any antisense strand containing the sequences listed in Table 2 or 3, provided that the two sequences have regions of at least 85% complementarity over 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotide sequences.

[0110] In some embodiments, the antisense strand of the MARC1 RNAi agent disclosed herein differs from any antisense strand sequence in Table 3 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of the MARC1 RNAi agent disclosed herein differs from any sense strand sequence in Table 4 or Table 5 by 0, 1, 2, or 3 nucleotides.

[0111] In some embodiments, the MARC1 RNAi agent antisense strand comprises a nucleotide sequence of any sequence in Table 2 or Table 3. In some embodiments, the MARC1 RNAi agent antisense strand comprises a sequence of nucleotides (from 5' to 3') 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, or 2-21 from any sequence in Table 2 or Table 3. In some embodiments, the MARC1 RNAi agent antisense strand comprises or consists of any of the modified sequences in Table 3.

[0112] In some embodiments, the sense strand of the MARC1 RNAi agent comprises the nucleotide sequence of any sequence in Tables 2, 4, or 5. In some embodiments, the sense strand of the MARC1 RNAi agent comprises the nucleotide sequence (from 5' to 3') 1-17, 2-17, 3-17, 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 3-20, 4-20, 1-21, 2-21, 3-21, or 4-21 from any of the modified sequences in Tables 4 or 5. In some embodiments, the sense strand of the MARC1 RNAi agent comprises or consists of any of the modified sequences in Tables 4 or 5.

[0113] For the MARC1 RNAi agents disclosed herein, the nucleotide at position 1 (5' → 3') of the antisense strand may be perfectly complementary to the MARC1 gene or non-complementary to the MARC1 gene. In some embodiments, the nucleotide at position 1 (5' → 3') of the antisense strand is U, A, or dT (or a modified version thereof). In some embodiments, the nucleotide at position 1 (5' → 3') of the antisense strand forms an A:U or U:A base pair with the sense strand.

[0114] A sense strand containing sequences listed in Tables 2, 4, or 5 may hybridize with any antisense strand containing sequences listed in Table 2 or 3, provided that the two sequences have regions of at least 85% complementarity over 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotide sequences. In some embodiments, the MARC1 RNAi agent has a sense strand consisting of a modified sequence from any of the modified sequences in Tables 4 or 5, and an antisense strand consisting of a modified sequence from any of the modified sequences in Table 3. Some representative sequence pairings are illustrated by the duplex ID numbers shown in Tables 6A or 6B.

[0115] In some embodiments, the MARC1 RNAi agent comprises, consists of, or is substantially composed of a duplex represented by any of the duplex ID numbers presented herein. In some embodiments, the MARC1 RNAi agent comprises sense and antisense nucleotide sequences of any duplex represented by any duplex ID number presented herein. In some embodiments, the MARC1 RNAi agent comprises sense and antisense nucleotide sequences of any duplex represented by any duplex ID number presented herein, along with a targeting group and / or a linker group, wherein the targeting group and / or linker group is covalently linked (i.e., conjugated) to the sense or antisense strand. In some embodiments, the MARC1 RNAi agent includes sense and antisense modified nucleotide sequences of any duplex ID number presented herein. In some embodiments, the MARC1 RNAi agent comprises sense and antisense modified nucleotide sequences of any duplex ID number presented herein, along with a targeting group and / or a linker group, wherein the targeting group and / or linker group is covalently linked to the sense or antisense strand.

[0116] In some embodiments, the MARC1 RNAi agent comprises an antisense strand and a sense strand of a nucleotide sequence having any antisense / sense duplex as shown in Table 2 or Tables 6A and 6B, and further comprises a targeting group or targeting ligand. In some embodiments, the MARC1 RNAi agent comprises an antisense strand and a sense strand of a nucleotide sequence having any antisense / sense duplex as shown in Table 2 or Tables 6A and 6B, and further comprises a desialylate glycoprotein receptor ligand targeting group.

[0117] A targeting group, with or without a connector, may be attached to the 5' or 3' end of any sense and / or antisense strand disclosed in Tables 2, 3, 4, or 5. A connector, with or without a targeting group, may be attached to the 5' or 3' end of any sense and / or antisense strand disclosed in Tables 2, 3, 4, and 5.

[0118] In some embodiments, the MARC1 RNAi agent comprises an antisense strand and a sense strand having any antisense / sense duplex nucleotide sequence as shown in Table 2, Table 6A or Table 6B, and further comprises a targeting ligand selected from (NAG37) and (NAG37)s, each as defined in Table 7.

[0119] In some implementations, the MARC1 RNAi agent comprises an antisense strand and a sense strand having any of the antisense strand and / or sense strand nucleotide sequences in Table 3 or Table 4.

[0120] In some embodiments, the MARC1 RNAi agent comprises the antisense and sense strands of any antisense and / or sense strand nucleotide sequences having any duplexes of Tables 6A and 6B, and further comprises a desialylate glycoprotein receptor ligand targeting group.

[0121] In some implementations, the MARC1 RNAi agent comprises, consists of, or is substantially composed of any of the duplexes in Tables 6A and 6B.

[0122] Table 6A. MARC1 RNAi agent duplexes and their corresponding sense and antisense strand IDs, as well as the sequence IDs of modified and unmodified nucleotide sequences. AS ID AS modified SEQ ID NO: AS unmodified SEQ ID NO: SS ID SS modified SEQ ID NO: SS unmodified SEQ ID NO: AM16712-AS 1056 1542 AM16711-SS-NL 1252 1667 AM16714-AS 1057 1543 AM16713-SS-NL 1253 1668 AM16716-AS 1058 1544 AM16715-SS-NL 1254 1669 AM16718-AS 1059 1545 AM16717-SS-NL 1255 1670 AM16720-AS 1060 1546 AM16719-SS-NL 1256 1671 AM16722-AS 1061 1547 AM16721-SS-NL 1257 1672 AM16724-AS 1062 1548 AM16723-SS-NL 1258 1673 AM16726-AS 1063 1549 AM16725-SS-NL 1259 1674 AM16728-AS 1064 1550 AM16727-SS-NL 1260 1675 AM16730-AS 1065 1551 AM16729-SS-NL 1261 1676 AM16732-AS 1066 1552 AM16731-SS-NL 1262 1677 AM16734-AS 1067 1553 AM16733-SS-NL 1263 1678 AM16736-AS 1068 1554 AM16735-SS-NL 1264 1679 AM16738-AS 1069 1555 AM16737-SS-NL 1265 1680 AM16740-AS 1070 1556 AM16739-SS-NL 1266 1681 AM16742-AS 1071 1557 AM16741-SS-NL 1267 1682 AM16744-AS 1072 1558 AM16743-SS-NL 1268 1683 AM16746-AS 1073 1559 AM16745-SS-NL 1269 1684 AM16748-AS 1074 1560 AM16747-SS-NL 1270 1685 AM16750-AS 1075 1561 AM16749-SS-NL 1271 1686 AM16752-AS 1076 1562 AM16751-SS-NL 1272 1687 AM16754-AS 1077 1563 AM16753-SS-NL 1273 1688 AM16756-AS 1078 1564 AM16755-SS-NL 1274 1689 AM16758-AS 1079 1565 AM16757-SS-NL 1275 1690 AM16760-AS 1080 1566 AM16759-SS-NL 1276 1691 AM16762-AS 1081 1567 AM16761-SS-NL 1277 1692 AM16764-AS 1082 1568 AM16763-SS-NL 1278 1693 AM16766-AS 1083 1569 AM16765-SS-NL 1279 1694 AM16768-AS 1084 1570 AM16767-SS-NL 1280 1695 AM16770-AS 1085 1571 AM16769-SS-NL 1281 1696 AM16772-AS 1086 1572 AM16771-SS-NL 1282 1697 AM16774-AS 1087 1573 AM16773-SS-NL 1283 1698 AM17404-AS 1088 1556 AM16739-SS-NL 1266 1681 AM17405-AS 1089 1556 AM16739-SS-NL 1266 1681 AM17406-AS 1090 1560 AM16747-SS-NL 1270 1685 AM17407-AS 1091 1560 AM16747-SS-NL 1270 1685 AM17408-AS 1092 1563 AM16753-SS-NL 1273 1688 AM17409-AS 1093 1563 AM16753-SS-NL 1273 1688 AM17410-AS 1094 1564 AM16755-SS-NL 1274 1689 AM17411-AS 1095 1564 AM16755-SS-NL 1274 1689 AM17488-AS 1096 1574 AM17487-SS-NL 1284 1699 AM17490-AS 1097 1575 AM17489-SS-NL 1285 1700 AM17492-AS 1098 1576 AM17491-SS-NL 1286 1701 AM17494-AS 1099 1577 AM17493-SS-NL 1287 1702 AM17496-AS 1100 1578 AM17495-SS-NL 1288 1703 AM17498-AS 1101 1579 AM17497-SS-NL 1289 1704 AM17500-AS 1102 1580 AM17499-SS-NL 1290 1705 AM17502-AS 1103 1581 AM17501-SS-NL 1291 1706 AM17504-AS 1104 1582 AM17503-SS-NL 1292 1707 AM17498-AS 1101 1579 AM17505-SS-NL 1293 1708 AM17808-AS 1105 1583 AM17807-SS-NL 1294 1709 AM17810-AS 1106 1584 AM17809-SS-NL 1295 1710 AM17812-AS 1107 1585 AM17811-SS-NL 1296 1711 AM17814-AS 1108 1586 AM17813-SS-NL 1297 1712 AM17816-AS 1109 1587 AM17815-SS-NL 1298 1713 AM17818-AS 1110 1588 AM17817-SS-NL 1299 1714 AM17820-AS 1111 1589 AM17819-SS-NL 1300 1715 AM17822-AS 1112 1590 AM17821-SS-NL 1301 1716 AM17824-AS 1113 1591 AM17823-SS-NL 1302 1717 AM17826-AS 1114 1592 AM17825-SS-NL 1303 1718 AM17828-AS 1115 1593 AM17827-SS-NL 1304 1719 AM17830-AS 1116 1594 AM17829-SS-NL 1305 1720 AM17832-AS 1117 1595 AM17831-SS-NL 1306 1721 AM17834-AS 1118 1596 AM17833-SS-NL 1307 1722 AM17864-AS 1119 1597 AM17863-SS-NL 1308 1723 AM17866-AS 1120 1598 AM17865-SS-NL 1309 1724 AM17868-AS 1121 1599 AM17867-SS-NL 1310 1725 AM17870-AS 1122 1600 AM17869-SS-NL 1311 1726 AM17872-AS 1123 1601 AM17871-SS-NL 1312 1727 AM17874-AS 1124 1602 AM17873-SS-NL 1313 1728 AM17876-AS 1125 1603 AM17875-SS-NL 1314 1729 AM17878-AS 1126 1604 AM17877-SS-NL 1315 1730 AM17880-AS 1127 1605 AM17879-SS-NL 1316 1731 AM17882-AS 1128 1606 AM17881-SS-NL 1317 1732 AM18384-AS 1129 1574 AM17487-SS-NL 1284 1699 AM18385-AS 1130 1574 AM17487-SS-NL 1284 1699 AM18386-AS 1131 1574 AM17487-SS-NL 1284 1699 AM18387-AS 1132 1574 AM17487-SS-NL 1284 1699 AM18388-AS 1133 1580 AM17499-SS-NL 1290 1705 AM18389-AS 1134 1580 AM17499-SS-NL 1290 1705 AM18390-AS 1135 1580 AM17499-SS-NL 1290 1705 AM18391-AS 1136 1580 AM17499-SS-NL 1290 1705 AM18393-AS 1137 1607 AM18392-SS-NL 1318 1733 AM18394-AS 1138 1607 AM18392-SS-NL 1318 1733 AM18398-AS 1139 1564 AM16755-SS-NL 1274 1689 AM18399-AS 1140 1564 AM16755-SS-NL 1274 1689 AM18401-AS 1141 1608 AM18400-SS-NL 1319 1734 AM18402-AS 1142 1608 AM18400-SS-NL 1319 1734 AM18403-AS 1143 1608 AM18400-SS-NL 1319 1734 AM18404-AS 1144 1556 AM16739-SS-NL 1266 1681 AM18405-AS 1145 1556 AM16739-SS-NL 1266 1681 AM18407-AS 1146 1609 AM18406-SS-NL 1320 1735 AM18408-AS 1147 1609 AM18406-SS-NL 1320 1735 AM18409-AS 1148 1609 AM18406-SS-NL 1320 1735 AM18410-AS 1149 1609 AM18406-SS-NL 1320 1735 AM18411-AS 1150 1609 AM18406-SS-NL 1320 1735 AM18412-AS 1151 1609 AM18406-SS-NL 1320 1735 AM18413-AS 1152 1609 AM18406-SS-NL 1320 1735 AM18606-AS 1153 1578 AM17495-SS-NL 1288 1703 AM18607-AS 1154 1578 AM17495-SS-NL 1288 1703 AM18608-AS 1155 1578 AM17495-SS-NL 1288 1703 AM18609-AS 1156 1578 AM17495-SS-NL 1288 1703 AM18610-AS 1157 1578 AM17495-SS-NL 1288 1703 AM18611-AS 1158 1582 AM17503-SS-NL 1292 1707 AM18612-AS 1159 1582 AM17503-SS-NL 1292 1707 AM18614-AS 1160 1610 AM18613-SS-NL 1321 1736 AM18616-AS 1161 1611 AM18615-SS-NL 1322 1737 AM18629-AS 1162 1564 AM16755-SS-NL 1274 1689 AM18629-AS 1162 1564 AM18630-SS-NL 1323 1689 AM18629-AS 1162 1564 AM18631-SS-NL 1324 1689 AM18632-AS 1163 1564 AM16755-SS-NL 1274 1689 AM18632-AS 1163 1564 AM18630-SS-NL 1323 1689 AM18632-AS 1163 1564 AM18631-SS-NL 1324 1689 AM18634-AS 1164 1612 AM18633-SS-NL 1325 1738 AM18636-AS 1165 1613 AM18635-SS-NL 1326 1739 AM18638-AS 1166 1614 AM18637-SS-NL 1327 1740 AM18878-AS 1167 1615 AM18877-SS-NL 1328 1741 AM18880-AS 1168 1616 AM18879-SS-NL 1329 1742 AM18882-AS 1169 1617 AM18881-SS-NL 1330 1743 AM18884-AS 1170 1618 AM18883-SS-NL 1331 1744 AM18886-AS 1171 1619 AM18885-SS-NL 1332 1745 AM18888-AS 1172 1620 AM18887-SS-NL 1333 1746 AM18890-AS 1173 1621 AM18889-SS-NL 1334 1747 AM18892-AS 1174 1622 AM18891-SS-NL 1335 1748 AM18894-AS 1175 1623 AM18893-SS-NL 1336 1749 AM18896-AS 1176 1624 AM18895-SS-NL 1337 1750 AM18898-AS 1177 1625 AM18897-SS-NL 1338 1751 AM18900-AS 1178 1626 AM18899-SS-NL 1339 1752 AM18902-AS 1179 1627 AM18901-SS-NL 1340 1753 AM18904-AS 1180 1628 AM18903-SS-NL 1341 1754 AM18906-AS 1181 1629 AM18905-SS-NL 1342 1755 AM18908-AS 1182 1630 AM18907-SS-NL 1343 1756 AM18910-AS 1183 1631 AM18909-SS-NL 1344 1757 AM18912-AS 1184 1632 AM18911-SS-NL 1345 1758 AM18914-AS 1185 1633 AM18913-SS-NL 1346 1759 AM18916-AS 1186 1634 AM18915-SS-NL 1347 1760 AM18918-AS 1187 1635 AM18917-SS-NL 1348 1761 AM18920-AS 1188 1636 AM18919-SS-NL 1349 1762 AM18922-AS 1189 1637 AM18921-SS-NL 1350 1763 AM18924-AS 1190 1638 AM18923-SS-NL 1351 1764 AM18944-AS 1191 1639 AM18943-SS-NL 1352 1765 AM18946-AS 1192 1640 AM18945-SS-NL 1353 1766 AM18948-AS 1193 1641 AM18947-SS-NL 1354 1767 AM18950-AS 1194 1642 AM18949-SS-NL 1355 1768 AM18952-AS 1195 1643 AM18951-SS-NL 1356 1769 AM18954-AS 1196 1644 AM18953-SS-NL 1357 1770 AM18956-AS 1197 1645 AM18955-SS-NL 1358 1771 AM18958-AS 1198 1646 AM18957-SS-NL 1359 1772 AM18960-AS 1199 1647 AM18959-SS-NL 1360 1773 AM17500-AS 1102 1580 AM19119-SS-NL 1361 1774 AM19120-AS 1200 1580 AM19119-SS-NL 1361 1774 AM19121-AS 1201 1580 AM19119-SS-NL 1361 1774 AM19122-AS 1202 1580 AM19119-SS-NL 1361 1774 AM19123-AS 1203 1580 AM17499-SS-NL 1290 1705 AM19123-AS 1203 1580 AM19124-SS-NL 1362 1705 AM19121-AS 1201 1580 AM17499-SS-NL 1290 1705 AM19121-AS 1201 1580 AM19124-SS-NL 1362 1705 AM19125-AS 1204 1596 AM17833-SS-NL 1307 1722 AM19126-AS 1205 1596 AM17833-SS-NL 1307 1722 AM19127-AS 1206 1596 AM17833-SS-NL 1307 1722 AM19128-AS 1207 1596 AM17833-SS-NL 1307 1722 AM19127-AS 1206 1596 AM19129-SS-NL 1363 1722 AM19127-AS 1206 1596 AM19130-SS-NL 1364 1775 AM19131-AS 1208 1648 AM17833-SS-NL 1307 1722 AM19132-AS 1209 1649 AM17833-SS-NL 1307 1722 AM19181-AS 1210 1578 AM17495-SS-NL 1288 1703 AM19182-AS 1211 1578 AM17495-SS-NL 1288 1703 AM19183-AS 1212 1578 AM17495-SS-NL 1288 1703 AM19185-AS 1213 1650 AM19184-SS-NL 1365 1776 AM19186-AS 1214 1650 AM19184-SS-NL 1365 1776 AM18610-AS 1157 1578 AM19187-SS-NL 1366 1703 AM19189-AS 1215 1651 AM19188-SS-NL 1367 1777 AM19191-AS 1216 1652 AM19190-SS-NL 1368 1778 AM19193-AS 1217 1653 AM19192-SS-NL 1369 1779 AM19193-AS 1217 1653 AM19194-SS-NL 1370 1779 AM19219-AS 1218 1654 AM19218-SS-NL 1371 1780 AM19221-AS 1219 1655 AM19220-SS-NL 1372 1781 AM19223-AS 1220 1656 AM19222-SS-NL 1373 1782 AM18410-AS 1149 1609 AM19404-SS-NL 1374 1735 AM19405-AS 1221 1609 AM18406-SS-NL 1320 1735 AM19406-AS 1222 1609 AM18406-SS-NL 1320 1735 AM19407-AS 1223 1606 AM17881-SS-NL 1317 1732 AM19408-AS 1224 1606 AM17881-SS-NL 1317 1732 AM19408-AS 1224 1606 AM19409-SS-NL 1375 1732 AM19410-AS 1225 1606 AM17881-SS-NL 1317 1732 AM19411-AS 1226 1606 AM17881-SS-NL 1317 1732 AM19536-AS 1227 1650 AM19184-SS-NL 1365 1776 AM19538-AS 1228 1657 AM19537-SS-NL 1376 1783 AM19538.1-AS 1229 1658 AM19537-SS-NL 1376 1783 AM19539-AS 1230 1653 AM19194-SS-NL 1370 1779 AM19656-AS 1231 1604 AM17877-SS-NL 1315 1730 AM19657-AS 1232 1604 AM17877-SS-NL 1315 1730 AM19658-AS 1233 1560 AM16747-SS-NL 1270 1685 AM19659-AS 1234 1560 AM16747-SS-NL 1270 1685 AM19661-AS 1235 1659 AM19660-SS-NL 1377 1784 AM19663-AS 1236 1660 AM19662-SS-NL 1378 1785 CA004443 1237 1651 CS914989-NL 1394 1777 CA004444 1238 1652 CS914991-NL 1395 1778 CA004446 1239 1661 CS004445-NL 1379 1786 CA004447 1240 1651 CS914989-NL 1394 1777 CA004449 1241 1662 CS004448-NL 1380 1787 CA004481 1242 1663 CS004480-NL 1381 1788 CA004483 1243 1664 CS004482-NL 1382 1789 CA004798 1244 1658 CS915323-NL 1396 1783 CA005198 1245 1665 CS005197-NL 1383 1790 CA008056 1246 1585 CS913717-NL 1390 1711 CA008057 1247 1591 CS913729-NL 1391 1717 CA008058 1248 1596 CS913739-NL 1392 1722 CA008429 1249 1666 CS008428-NL 1389 1791 CA008430 1250 1608 CS914289-NL 1393 1734 Table 6B. MARC1 RNAi agent duplexes and their corresponding sense and antisense strand IDs, as well as the sequence IDs of modified and unmodified nucleotide sequences. double chain AS ID AS-modified SEQ ID NO: AS unmodified SEQ ID NO: SS ID SS-modified SEQ ID NO: SS unmodified SEQ ID NO: AD11764 AM16712-AS 1056 1542 AM16711-SS 1397 1667 AD11765 AM16714-AS 1057 1543 AM16713-SS 1398 1668 AD11766 AM16716-AS 1058 1544 AM16715-SS 1399 1669 AD11767 AM16718-AS 1059 1545 AM16717-SS 1400 1670 AD11768 AM16720-AS 1060 1546 AM16719-SS 1401 1671 AD11769 AM16722-AS 1061 1547 AM16721-SS 1402 1672 AD11770 AM16724-AS 1062 1548 AM16723-SS 1403 1673 AD11771 AM16726-AS 1063 1549 AM16725-SS 1404 1674 AD11772 AM16728-AS 1064 1550 AM16727-SS 1405 1675 AD11773 AM16730-AS 1065 1551 AM16729-SS 1406 1676 AD11774 AM16732-AS 1066 1552 AM16731-SS 1407 1677 AD11775 AM16734-AS 1067 1553 AM16733-SS 1408 1678 AD11776 AM16736-AS 1068 1554 AM16735-SS 1409 1679 AD11777 AM16738-AS 1069 1555 AM16737-SS 1410 1680 AD11778 AM16740-AS 1070 1556 AM16739-SS 1411 1681 AD11779 AM16742-AS 1071 1557 AM16741-SS 1412 1682 AD11780 AM16744-AS 1072 1558 AM16743-SS 1413 1683 AD11781 AM16746-AS 1073 1559 AM16745-SS 1414 1684 AD11782 AM16748-AS 1074 1560 AM16747-SS 1415 1685 AD11783 AM16750-AS 1075 1561 AM16749-SS 1416 1686 AD11784 AM16752-AS 1076 1562 AM16751-SS 1417 1687 AD11785 AM16754-AS 1077 1563 AM16753-SS 1418 1688 AD11786 AM16756-AS 1078 1564 AM16755-SS 1419 1689 AD11787 AM16758-AS 1079 1565 AM16757-SS 1420 1690 AD11788 AM16760-AS 1080 1566 AM16759-SS 1421 1691 AD11789 AM16762-AS 1081 1567 AM16761-SS 1422 1692 AD11790 AM16764-AS 1082 1568 AM16763-SS 1423 1693 AD11791 AM16766-AS 1083 1569 AM16765-SS 1424 1694 AD11792 AM16768-AS 1084 1570 AM16767-SS 1425 1695 AD11793 AM16770-AS 1085 1571 AM16769-SS 1426 1696 AD11794 AM16772-AS 1086 1572 AM16771-SS 1427 1697 AD11795 AM16774-AS 1087 1573 AM16773-SS 1428 1698 AD12285 AM17404-AS 1088 1556 AM16739-SS 1411 1681 AD12286 AM17405-AS 1089 1556 AM16739-SS 1411 1681 AD12287 AM17406-AS 1090 1560 AM16747-SS 1415 1685 AD12288 AM17407-AS 1091 1560 AM16747-SS 1415 1685 AD12289 AM17408-AS 1092 1563 AM16753-SS 1418 1688 AD12290 AM17409-AS 1093 1563 AM16753-SS 1418 1688 AD12291 AM17410-AS 1094 1564 AM16755-SS 1419 1689 AD12292 AM17411-AS 1095 1564 AM16755-SS 1419 1689 AD12363 AM17488-AS 1096 1574 AM17487-SS 1429 1699 AD12364 AM17490-AS 1097 1575 AM17489-SS 1430 1700 AD12365 AM17492-AS 1098 1576 AM17491-SS 1431 1701 AD12366 AM17494-AS 1099 1577 AM17493-SS 1432 1702 AD12367 AM17496-AS 1100 1578 AM17495-SS 1433 1703 AD12368 AM17498-AS 1101 1579 AM17497-SS 1434 1704 AD12369 AM17500-AS 1102 1580 AM17499-SS 1435 1705 AD12370 AM17502-AS 1103 1581 AM17501-SS 1436 1706 AD12371 AM17504-AS 1104 1582 AM17503-SS 1437 1707 AD12372 AM17498-AS 1101 1579 AM17505-SS 1438 1708 AD12583 AM17808-AS 1105 1583 AM17807-SS 1439 1709 AD12584 AM17810-AS 1106 1584 AM17809-SS 1440 1710 AD12585 AM17812-AS 1107 1585 AM17811-SS 1441 1711 AD12586 AM17814-AS 1108 1586 AM17813-SS 1442 1712 AD12587 AM17816-AS 1109 1587 AM17815-SS 1443 1713 AD12588 AM17818-AS 1110 1588 AM17817-SS 1444 1714 AD12589 AM17820-AS 1111 1589 AM17819-SS 1445 1715 AD12590 AM17822-AS 1112 1590 AM17821-SS 1446 1716 AD12591 AM17824-AS 1113 1591 AM17823-SS 1447 1717 AD12592 AM17826-AS 1114 1592 AM17825-SS 1448 1718 AD12593 AM17828-AS 1115 1593 AM17827-SS 1449 1719 AD12594 AM17830-AS 1116 1594 AM17829-SS 1450 1720 AD12595 AM17832-AS 1117 1595 AM17831-SS 1451 1721 AD12596 AM17834-AS 1118 1596 AM17833-SS 1452 1722 AD12625 AM17864-AS 1119 1597 AM17863-SS 1453 1723 AD12626 AM17866-AS 1120 1598 AM17865-SS 1454 1724 AD12627 AM17868-AS 1121 1599 AM17867-SS 1455 1725 AD12628 AM17870-AS 1122 1600 AM17869-SS 1456 1726 AD12629 AM17872-AS 1123 1601 AM17871-SS 1457 1727 AD12630 AM17874-AS 1124 1602 AM17873-SS 1458 1728 AD12631 AM17876-AS 1125 1603 AM17875-SS 1459 1729 AD12632 AM17878-AS 1126 1604 AM17877-SS 1460 1730 AD12633 AM17880-AS 1127 1605 AM17879-SS 1461 1731 AD12634 AM17882-AS 1128 1606 AM17881-SS 1462 1732 AD12953 AM18384-AS 1129 1574 AM17487-SS 1429 1699 AD12954 AM18385-AS 1130 1574 AM17487-SS 1429 1699 AD12955 AM18386-AS 1131 1574 AM17487-SS 1429 1699 AD12956 AM18387-AS 1132 1574 AM17487-SS 1429 1699 AD12957 AM18388-AS 1133 1580 AM17499-SS 1435 1705 AD12958 AM18389-AS 1134 1580 AM17499-SS 1435 1705 AD12959 AM18390-AS 1135 1580 AM17499-SS 1435 1705 AD12960 AM18391-AS 1136 1580 AM17499-SS 1435 1705 AD12961 AM18393-AS 1137 1607 AM18392-SS 1463 1733 AD12962 AM18394-AS 1138 1607 AM18392-SS 1463 1733 AD12972 AM18398-AS 1139 1564 AM16755-SS 1419 1689 AD12973 AM18399-AS 1140 1564 AM16755-SS 1419 1689 AD12974 AM18401-AS 1141 1608 AM18400-SS 1464 1734 AD12975 AM18402-AS 1142 1608 AM18400-SS 1464 1734 AD12976 AM18403-AS 1143 1608 AM18400-SS 1464 1734 AD12977 AM18404-AS 1144 1556 AM16739-SS 1411 1681 AD12978 AM18405-AS 1145 1556 AM16739-SS 1411 1681 AD12979 AM18407-AS 1146 1609 AM18406-SS 1465 1735 AD12980 AM18408-AS 1147 1609 AM18406-SS 1465 1735 AD12981 AM18409-AS 1148 1609 AM18406-SS 1465 1735 AD12982 AM18410-AS 1149 1609 AM18406-SS 1465 1735 AD12983 AM18411-AS 1150 1609 AM18406-SS 1465 1735 AD12984 AM18412-AS 1151 1609 AM18406-SS 1465 1735 AD12985 AM18413-AS 1152 1609 AM18406-SS 1465 1735 AD13113 AM18606-AS 1153 1578 AM17495-SS 1433 1703 AD13114 AM18607-AS 1154 1578 AM17495-SS 1433 1703 AD13115 AM18608-AS 1155 1578 AM17495-SS 1433 1703 AD13116 AM18609-AS 1156 1578 AM17495-SS 1433 1703 AD13117 AM18610-AS 1157 1578 AM17495-SS 1433 1703 AD13118 AM18611-AS 1158 1582 AM17503-SS 1437 1707 AD13119 AM18612-AS 1159 1582 AM17503-SS 1437 1707 AD13120 AM18614-AS 1160 1610 AM18613-SS 1466 1736 AD13121 AM18616-AS 1161 1611 AM18615-SS 1467 1737 AD13137 AM18629-AS 1162 1564 AM16755-SS 1419 1689 AD13138 AM18629-AS 1162 1564 AM18630-SS 1468 1689 AD13139 AM18629-AS 1162 1564 AM18631-SS 1469 1689 AD13140 AM18632-AS 1163 1564 AM16755-SS 1419 1689 AD13141 AM18632-AS 1163 1564 AM18630-SS 1468 1689 AD13142 AM18632-AS 1163 1564 AM18631-SS 1469 1689 AD13143 AM18634-AS 1164 1612 AM18633-SS 1470 1738 AD13144 AM18636-AS 1165 1613 AM18635-SS 1471 1739 AD13145 AM18638-AS 1166 1614 AM18637-SS 1472 1740 AD13278 AM18878-AS 1167 1615 AM18877-SS 1473 1741 AD13279 AM18880-AS 1168 1616 AM18879-SS 1474 1742 AD13280 AM18882-AS 1169 1617 AM18881-SS 1475 1743 AD13281 AM18884-AS 1170 1618 AM18883-SS 1476 1744 AD13282 AM18886-AS 1171 1619 AM18885-SS 1477 1745 AD13283 AM18888-AS 1172 1620 AM18887-SS 1478 1746 AD13284 AM18890-AS 1173 1621 AM18889-SS 1479 1747 AD13285 AM18892-AS 1174 1622 AM18891-SS 1480 1748 AD13286 AM18894-AS 1175 1623 AM18893-SS 1481 1749 AD13287 AM18896-AS 1176 1624 AM18895-SS 1482 1750 AD13288 AM18898-AS 1177 1625 AM18897-SS 1483 1751 AD13289 AM18900-AS 1178 1626 AM18899-SS 1484 1752 AD13290 AM18902-AS 1179 1627 AM18901-SS 1485 1753 AD13291 AM18904-AS 1180 1628 AM18903-SS 1486 1754 AD13292 AM18906-AS 1181 1629 AM18905-SS 1487 1755 AD13293 AM18908-AS 1182 1630 AM18907-SS 1488 1756 AD13294 AM18910-AS 1183 1631 AM18909-SS 1489 1757 AD13295 AM18912-AS 1184 1632 AM18911-SS 1490 1758 AD13296 AM18914-AS 1185 1633 AM18913-SS 1491 1759 AD13297 AM18916-AS 1186 1634 AM18915-SS 1492 1760 AD13298 AM18918-AS 1187 1635 AM18917-SS 1493 1761 AD13299 AM18920-AS 1188 1636 AM18919-SS 1494 1762 AD13300 AM18922-AS 1189 1637 AM18921-SS 1495 1763 AD13301 AM18924-AS 1190 1638 AM18923-SS 1496 1764 AD13322 AM18944-AS 1191 1639 AM18943-SS 1497 1765 AD13323 AM18946-AS 1192 1640 AM18945-SS 1498 1766 AD13324 AM18948-AS 1193 1641 AM18947-SS 1499 1767 AD13325 AM18950-AS 1194 1642 AM18949-SS 1500 1768 AD13326 AM18952-AS 1195 1643 AM18951-SS 1501 1769 AD13327 AM18954-AS 1196 1644 AM18953-SS 1502 1770 AD13328 AM18956-AS 1197 1645 AM18955-SS 1503 1771 AD13329 AM18958-AS 1198 1646 AM18957-SS 1504 1772 AD13330 AM18960-AS 1199 1647 AM18959-SS 1505 1773 AD13444 AM17500-AS 1102 1580 AM19119-SS 1506 1774 AD13445 AM19120-AS 1200 1580 AM19119-SS 1506 1774 AD13446 AM19121-AS 1201 1580 AM19119-SS 1506 1774 AD13447 AM19122-AS 1202 1580 AM19119-SS 1506 1774 AD13448 AM19123-AS 1203 1580 AM17499-SS 1435 1705 AD13449 AM19123-AS 1203 1580 AM19124-SS 1507 1705 AD13450 AM19121-AS 1201 1580 AM17499-SS 1435 1705 AD13451 AM19121-AS 1201 1580 AM19124-SS 1507 1705 AD13452 AM19125-AS 1204 1596 AM17833-SS 1452 1722 AD13453 AM19126-AS 1205 1596 AM17833-SS 1452 1722 AD13454 AM19127-AS 1206 1596 AM17833-SS 1452 1722 AD13455 AM19128-AS 1207 1596 AM17833-SS 1452 1722 AD13456 AM19127-AS 1206 1596 AM19129-SS 1508 1722 AD13457 AM19127-AS 1206 1596 AM19130-SS 1509 1775 AD13458 AM19131-AS 1208 1648 AM17833-SS 1452 1722 AD13459 AM19132-AS 1209 1649 AM17833-SS 1452 1722 AD13507 AM19181-AS 1210 1578 AM17495-SS 1433 1703 AD13508 AM19182-AS 1211 1578 AM17495-SS 1433 1703 AD13509 AM19183-AS 1212 1578 AM17495-SS 1433 1703 AD13510 AM19185-AS 1213 1650 AM19184-SS 1510 1776 AD13511 AM19186-AS 1214 1650 AM19184-SS 1510 1776 AD13512 AM18610-AS 1157 1578 AM19187-SS 1511 1703 AD13513 AM19189-AS 1215 1651 AM19188-SS 1512 1777 AD13514 AM19191-AS 1216 1652 AM19190-SS 1513 1778 AD13515 AM19193-AS 1217 1653 AM19192-SS 1514 1779 AD13516 AM19193-AS 1217 1653 AM19194-SS 1515 1779 AD13535 AM19219-AS 1218 1654 AM19218-SS 1516 1780 AD13536 AM19221-AS 1219 1655 AM19220-SS 1517 1781 AD13537 AM19223-AS 1220 1656 AM19222-SS 1518 1782 AD13705 AM18410-AS 1149 1609 AM19404-SS 1519 1735 AD13706 AM19405-AS 1221 1609 AM18406-SS 1465 1735 AD13707 AM19406-AS 1222 1609 AM18406-SS 1465 1735 AD13708 AM19407-AS 1223 1606 AM17881-SS 1462 1732 AD13709 AM19408-AS 1224 1606 AM17881-SS 1462 1732 AD13710 AM19408-AS 1224 1606 AM19409-SS 1520 1732 AD13711 AM19410-AS 1225 1606 AM17881-SS 1462 1732 AD13712 AM19411-AS 1226 1606 AM17881-SS 1462 1732 AD13804 AM19536-AS 1227 1650 AM19184-SS 1510 1776 AD13805 AM19538-AS 1228 1657 AM19537-SS 1521 1783 AD13805.1 AM19538.1-AS 1229 1658 AM19537-SS 1521 1783 AD13806 AM19539-AS 1230 1653 AM19194-SS 1515 1779 AD13921 AM19656-AS 1231 1604 AM17877-SS 1460 1730 AD13922 AM19657-AS 1232 1604 AM17877-SS 1460 1730 AD13923 AM19658-AS 1233 1560 AM16747-SS 1415 1685 AD13924 AM19659-AS 1234 1560 AM16747-SS 1415 1685 AD13925 AM19661-AS 1235 1659 AM19660-SS 1522 1784 AD13926 AM19663-AS 1236 1660 AM19662-SS 1523 1785 AC003589 CA004443 1237 1651 CS914989 1539 1777 AC003590 CA004444 1238 1652 CS914991 1540 1778 AC003591 CA004446 1239 1661 CS004445 1524 1786 AC003592 CA004447 1240 1651 CS914989 1539 1777 AC003593 CA004449 1241 1662 CS004448 1525 1787 AC003625 CA004481 1242 1663 CS004480 1526 1788 AC003626 CA004483 1243 1664 CS004482 1527 1789 AC003891 CA004798 1244 1658 CS915323 1541 1783 AC004186 CA005198 1245 1665 CS005197 1528 1790 AC006749 CA008056 1246 1585 CS913717 1535 1711 AC006750 CA008057 1247 1591 CS913729 1536 1717 AC006751 CA008058 1248 1596 CS913739 1537 1722 AC007084 CA008429 1249 1666 CS008428 1534 1791 AC007085 CA008430 1250 1608 CS914289 1538 1734 Table 6C. MARC1 RNAi agent duplexes and corresponding sense and antisense strand IDs at the target location on the MARC1 gene (SEQ ID NO: 1). Double-chain ID antiskewing ID Youyi Chain ID Targeted MARC1 gene location (SEQ ID NO:1) AD11764 AM16712-AS AM16711-SS 325 AD11765 AM16714-AS AM16713-SS 536 AD11766 AM16716-AS AM16715-SS 609 AD11767 AM16718-AS AM16717-SS 611 AD11768 AM16720-AS AM16719-SS 636 AD11769 AM16722-AS AM16721-SS 640 AD11770 AM16724-AS AM16723-SS 644 AD11771 AM16726-AS AM16725-SS 710 AD11772 AM16728-AS AM16727-SS 841 AD11773 AM16730-AS AM16729-SS 932 AD11774 AM16732-AS AM16731-SS 940 AD11775 AM16734-AS AM16733-SS 945 AD11776 AM16736-AS AM16735-SS 954 AD11777 AM16738-AS AM16737-SS 1057 AD11778 AM16740-AS AM16739-SS 1089 AD11779 AM16742-AS AM16741-SS 1098 AD11780 AM16744-AS AM16743-SS 1102 AD11781 AM16746-AS AM16745-SS 1111 AD11782 AM16748-AS AM16747-SS 1190 AD11783 AM16750-AS AM16749-SS 1193 AD11784 AM16752-AS AM16751-SS 1282 AD11785 AM16754-AS AM16753-SS 1310 AD11786 AM16756-AS AM16755-SS 1313 AD11787 AM16758-AS AM16757-SS 1605 AD11788 AM16760-AS AM16759-SS 1635 AD11789 AM16762-AS AM16761-SS 1646 AD11790 AM16764-AS AM16763-SS 1648 AD11791 AM16766-AS AM16765-SS 1852 AD11792 AM16768-AS AM16767-SS 1897 AD11793 AM16770-AS AM16769-SS 1898 AD11794 AM16772-AS AM16771-SS 1955 AD11795 AM16774-AS AM16773-SS 1990 AD12285 AM17404-AS AM16739-SS 1089 AD12286 AM17405-AS AM16739-SS 1089 AD12287 AM17406-AS AM16747-SS 1190 AD12288 AM17407-AS AM16747-SS 1190 AD12289 AM17408-AS AM16753-SS 1310 AD12290 AM17409-AS AM16753-SS 1310 AD12291 AM17410-AS AM16755-SS 1313 AD12292 AM17411-AS AM16755-SS 1313 AD12363 AM17488-AS AM17487-SS 305 AD12364 AM17490-AS AM17489-SS 761 AD12365 AM17492-AS AM17491-SS 956 AD12366 AM17494-AS AM17493-SS 1109 AD12367 AM17496-AS AM17495-SS 1275 AD12368 AM17498-AS AM17497-SS 1633 AD12369 AM17500-AS AM17499-SS 1817 AD12370 AM17502-AS AM17501-SS 1900 AD12371 AM17504-AS AM17503-SS 1954 AD12372 AM17498-AS AM17505-SS 1633 AD12583 AM17808-AS AM17807-SS 405 AD12584 AM17810-AS AM17809-SS 406 AD12585 AM17812-AS AM17811-SS 409 AD12586 AM17814-AS AM17813-SS 411 AD12587 AM17816-AS AM17815-SS 564 AD12588 AM17818-AS AM17817-SS 565 AD12589 AM17820-AS AM17819-SS 566 AD12590 AM17822-AS AM17821-SS 567 AD12591 AM17824-AS AM17823-SS 901 AD12592 AM17826-AS AM17825-SS 1008 AD12593 AM17828-AS AM17827-SS 1009 AD12594 AM17830-AS AM17829-SS 1012 AD12595 AM17832-AS AM17831-SS 1013 AD12596 AM17834-AS AM17833-SS 1014 AD12625 AM17864-AS AM17863-SS 610 AD12626 AM17866-AS AM17865-SS 714 AD12627 AM17868-AS AM17867-SS 716 AD12628 AM17870-AS AM17869-SS 744 AD12629 AM17872-AS AM17871-SS 933 AD12630 AM17874-AS AM17873-SS 938 AD12631 AM17876-AS AM17875-SS 1302 AD12632 AM17878-AS AM17877-SS 1642 AD12633 AM17880-AS AM17879-SS 1927 AD12634 AM17882-AS AM17881-SS 1931 AD12953 AM18384-AS AM17487-SS 305 AD12954 AM18385-AS AM17487-SS 305 AD12955 AM18386-AS AM17487-SS 305 AD12956 AM18387-AS AM17487-SS 305 AD12957 AM18388-AS AM17499-SS 1817 AD12958 AM18389-AS AM17499-SS 1817 AD12959 AM18390-AS AM17499-SS 1817 AD12960 AM18391-AS AM17499-SS 1817 AD12961 AM18393-AS AM18392-SS 1817 AD12962 AM18394-AS AM18392-SS 1817 AD12972 AM18398-AS AM16755-SS 1313 AD12973 AM18399-AS AM16755-SS 1313 AD12974 AM18401-AS AM18400-SS 1313 AD12975 AM18402-AS AM18400-SS 1313 AD12976 AM18403-AS AM18400-SS 1313 AD12977 AM18404-AS AM16739-SS 1089 AD12978 AM18405-AS AM16739-SS 1089 AD12979 AM18407-AS AM18406-SS 1089 AD12980 AM18408-AS AM18406-SS 1089 AD12981 AM18409-AS AM18406-SS 1089 AD12982 AM18410-AS AM18406-SS 1089 AD12983 AM18411-AS AM18406-SS 1089 AD12984 AM18412-AS AM18406-SS 1089 AD12985 AM18413-AS AM18406-SS 1089 AD13113 AM18606-AS AM17495-SS 1275 AD13114 AM18607-AS AM17495-SS 1275 AD13115 AM18608-AS AM17495-SS 1275 AD13116 AM18609-AS AM17495-SS 1275 AD13117 AM18610-AS AM17495-SS 1275 AD13118 AM18611-AS AM17503-SS 1954 AD13119 AM18612-AS AM17503-SS 1954 AD13120 AM18614-AS AM18613-SS 306 AD13121 AM18616-AS AM18615-SS 307 AD13137 AM18629-AS AM16755-SS 1313 AD13138 AM18629-AS AM18630-SS 1313 AD13139 AM18629-AS AM18631-SS 1313 AD13140 AM18632-AS AM16755-SS 1313 AD13141 AM18632-AS AM18630-SS 1313 AD13142 AM18632-AS AM18631-SS 1313 AD13143 AM18634-AS AM18633-SS 1314 AD13144 AM18636-AS AM18635-SS 1314 AD13145 AM18638-AS AM18637-SS 1314 AD13278 AM18878-AS AM18877-SS 2014 AD13279 AM18880-AS AM18879-SS 2018 AD13280 AM18882-AS AM18881-SS 2020 AD13281 AM18884-AS AM18883-SS 2630 AD13282 AM18886-AS AM18885-SS 2779 AD13283 AM18888-AS AM18887-SS 3190 AD13284 AM18890-AS AM18889-SS 3332 AD13285 AM18892-AS AM18891-SS 3412 AD13286 AM18894-AS AM18893-SS 3464 AD13287 AM18896-AS AM18895-SS 3991 AD13288 AM18898-AS AM18897-SS 4500 AD13289 AM18900-AS AM18899-SS 4582 AD13290 AM18902-AS AM18901-SS 4585 AD13291 AM18904-AS AM18903-SS 4623 AD13292 AM18906-AS AM18905-SS 4639 AD13293 AM18908-AS AM18907-SS 5255 AD13294 AM18910-AS AM18909-SS 5849 AD13295 AM18912-AS AM18911-SS 6143 AD13296 AM18914-AS AM18913-SS 6294 AD13297 AM18916-AS AM18915-SS 6408 AD13298 AM18918-AS AM18917-SS 6537 AD13299 AM18920-AS AM18919-SS 6833 AD13300 AM18922-AS AM18921-SS 6957 AD13301 AM18924-AS AM18923-SS 7208 AD13322 AM18944-AS AM18943-SS 419 AD13323 AM18946-AS AM18945-SS 601 AD13324 AM18948-AS AM18947-SS 1124 AD13325 AM18950-AS AM18949-SS 1131 AD13326 AM18952-AS AM18951-SS 1157 AD13327 AM18954-AS AM18953-SS 1246 AD13328 AM18956-AS AM18955-SS 1332 AD13329 AM18958-AS AM18957-SS 1432 AD13330 AM18960-AS AM18959-SS 1842 AD13444 AM17500-AS AM19119-SS 1817 AD13445 AM19120-AS AM19119-SS 1817 AD13446 AM19121-AS AM19119-SS 1817 AD13447 AM19122-AS AM19119-SS 1817 AD13448 AM19123-AS AM17499-SS 1817 AD13449 AM19123-AS AM19124-SS 1817 AD13450 AM19121-AS AM17499-SS 1817 AD13451 AM19121-AS AM19124-SS 1817 AD13452 AM19125-AS AM17833-SS 1014 AD13453 AM19126-AS AM17833-SS 1014 AD13454 AM19127-AS AM17833-SS 1014 AD13455 AM19128-AS AM17833-SS 1014 AD13456 AM19127-AS AM19129-SS 1014 AD13457 AM19127-AS AM19130-SS 1014 AD13458 AM19131-AS AM17833-SS 1014 AD13459 AM19132-AS AM17833-SS 1014 AD13507 AM19181-AS AM17495-SS 1275 AD13508 AM19182-AS AM17495-SS 1275 AD13509 AM19183-AS AM17495-SS 1275 AD13510 AM19185-AS AM19184-SS 1275 AD13511 AM19186-AS AM19184-SS 1275 AD13512 AM18610-AS AM19187-SS 1275 AD13513 AM19189-AS AM19188-SS 1275 AD13514 AM19191-AS AM19190-SS 1275 AD13515 AM19193-AS AM19192-SS 1275 AD13516 AM19193-AS AM19194-SS 1275 AD13535 AM19219-AS AM19218-SS 1059 AD13536 AM19221-AS AM19220-SS 1058 AD13537 AM19223-AS AM19222-SS 1060 AD13705 AM18410-AS AM19404-SS 1089 AD13706 AM19405-AS AM18406-SS 1089 AD13707 AM19406-AS AM18406-SS 1089 AD13708 AM19407-AS AM17881-SS 1931 AD13709 AM19408-AS AM17881-SS 1931 AD13710 AM19408-AS AM19409-SS 1931 AD13711 AM19410-AS AM17881-SS 1931 AD13712 AM19411-AS AM17881-SS 1931 AD13804 AM19536-AS AM19184-SS 1275 AD13805 AM19538-AS AM19537-SS 1275 AD13805.1 AM19538.1-AS AM19537-SS 1275 AD13806 AM19539-AS AM19194-SS 1275 AD13921 AM19656-AS AM17877-SS 1642 AD13922 AM19657-AS AM17877-SS 1642 AD13923 AM19658-AS AM16747-SS 1190 AD13924 AM19659-AS AM16747-SS 1190 AD13925 AM19661-AS AM19660-SS 1190 AD13926 AM19663-AS AM19662-SS 1190 AC003589 CA004443 CS914989 1275 AC003590 CA004444 CS914991 1275 AC003591 CA004446 CS004445 1275 AC003592 CA004447 CS914989 1275 AC003593 CA004449 CS004448 711 AC003625 CA004481 CS004480 1274 AC003626 CA004483 CS004482 1276 AC003891 CA004798 CS915323 1275 AC004186 CA005198 CS005197 1059 AC006749 CA008056 CS913717 409 AC006750 CA008057 CS913729 901 AC006751 CA008058 CS913739 1014 AC007084 CA008429 CS008428 1313 AC007085 CA008430 CS914289 1313 Table 6D. MARC1 RNAi agent duplexes showing chemically modified antisense and sense strand sequences. In some embodiments, the MARC1 RNAi agent is prepared or provided as a salt, a mixed salt, or a free acid. The RNAi agents described herein, upon delivery to cells expressing the MARC1 gene, inhibit or knock down the expression of one or more MARC1 genes in vivo and / or in vitro.

[0123] Targeting ligands or groups, linking groups, and delivery mediators In some embodiments, the MARC1 RNAi agent is conjugated to one or more nonnucleotide groups, including but not limited to targeting groups, linker groups, targeting ligands, delivery polymers, or delivery mediators. The nonnucleotide groups can enhance the targeting, delivery, or attachment of the RNAi agent. Examples of targeting groups and linker groups are provided in Table 7. The nonnucleotide groups can be covalently linked to the 3' and / or 5' ends of the sense and / or antisense strands. In some embodiments, the MARC1 RNAi agent contains a nonnucleotide group linked to the 3' and / or 5' end of the sense strand. In some embodiments, the nonnucleotide group is linked to the 5' end of the sense strand of the MARC1 RNAi agent. The nonnucleotide group can be linked to the RNAi agent directly or indirectly via a linker / connector group. In some embodiments, the nonnucleotide group is linked to the RNAi agent via an unstable, cleavable, or reversible bond or linker.

[0124] In some embodiments, the non-nucleotide group enhances the pharmacokinetic or biodistribution properties of the attached RNAi agent or conjugate to improve cell- or tissue-specific distribution and cell-specific uptake of the RNAi agent or conjugate. In some embodiments, the non-nucleotide group enhances the endocytosis of the RNAi agent.

[0125] Targeting groups or targeting moieties enhance the pharmacokinetic or biodistribution properties of the conjugates or RNAi agents to which they are attached, thereby improving the cell-specific (and in some cases organ-specific) distribution and cell-specific (or organ-specific) uptake of the conjugates or RNAi agents. Targeting groups can be monovalent, divalent, trivalent, tetravalent, or have a higher valence state for their target. Representative targeting groups, without limitation, include compounds with affinity for cell surface molecules, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments, and antibody mimics with affinity for cell surface molecules.

[0126] In some embodiments, the targeting group uses a linker, such as a PEG linker or one, two, or three debased and / or ribitol (debased ribose) residues (which in some cases act as linkers), to connect with the RNAi agent. In some embodiments, the targeting ligand comprises a cluster of galactose derivatives.

[0127] MARC1 RNAi agents described herein can be synthesized with reactive groups, such as amino groups (also referred to herein as amines), at the 5' and / or 3' ends. The reactive groups can then be used to attach the target moiety using methods typical of the art.

[0128] In some embodiments, the targeting group comprises a desialyl glycoprotein receptor ligand. As used herein, a desialyl glycoprotein receptor ligand is a ligand containing a portion having an affinity for the desialyl glycoprotein receptor. As noted herein, the desialyl glycoprotein receptor is highly expressed on hepatocytes. In some embodiments, the desialyl glycoprotein receptor ligand comprises or is composed of one or more galactose derivatives. As used herein, the term galactose derivative includes both galactose and a galactose derivative having an affinity for the desialyl glycoprotein receptor equal to or greater than that of galactose. Galactose derivatives include, but are not limited to: galactose, galactosamine, N-formylgalactosamine, N-acetylgalactosamine, N-propionylgalactosamine, N-butyrylgalactosamine, and N-isobutyrylgalactosamine (see, for example: ST. Iobst and K. Drickamer, JBC, 1996, 271, 6686). Galactose derivatives and galactose derivative clusters that can be used to target oligonucleotides and other molecules to the liver in vivo are known in the art (see, for example, Baenziger and Fiete, 1980, Cell, 22, 611-620; Connolly et al., 1982, J. Biol. Chem., 257, 939-945).

[0129] Galactose derivatives have been used to target molecules to hepatocytes in vivo via their binding to desialyl glycoprotein receptors expressed on the surface of hepatocytes. Binding of a desialyl glycoprotein receptor ligand to one or more desialyl glycoprotein receptors promotes cell-specific targeting to hepatocytes and endocytosis of the molecule into hepatocytes. Desialyl glycoprotein receptor ligands can be monomeric (e.g., having a single galactose derivative, also referred to as monovalent or monodentate) or polymeric (e.g., having multiple galactose derivatives). Galactose derivatives or clusters of galactose derivatives can be attached to the 3' or 5' end of the sense or antisense strand of an RNAi agent using methods known in the art.

[0130] The preparation of targeted ligands, such as galactose derivative clusters, is described in, for example, International Patent Application Publication No. WO 2018 / 044350 of Arrowhead Pharmaceuticals, Inc. and International Patent Application Publication No. WO 2017 / 156012 of Arrowhead Pharmaceuticals, Inc., the contents of which are incorporated herein by reference in their entirety.

[0131] As used herein, galactose derivative clusters comprise molecules having 2-4 terminal galactose derivatives. The terminal galactose derivatives are attached to the molecule via their C-1 carbon. In some embodiments, the galactose derivative cluster is a galactose derivative trimer (also referred to as a trianthal galactose derivative or trivalent galactose derivative). In some embodiments, the galactose derivative cluster comprises an N-acetyl-galactosamine moiety. In some embodiments, the galactose derivative cluster comprises three N-acetyl-galactosamine moieties. In some embodiments, the galactose derivative cluster is a galactose derivative tetramer (also referred to as a tetraanthal galactose derivative or tetravalent galactose derivative). In some embodiments, the galactose derivative cluster comprises four N-acetyl-galactosamine moieties.

[0132] As used herein, a galactose derivative trimer contains three galactose derivatives, each attached to a central branching point. As used herein, a galactose derivative tetramer contains four galactose derivatives, each attached to a central branching point. The galactose derivatives can be attached to the central branching point via the C-1 carbon of the sugar. In some embodiments, the galactose derivatives are attached to the branching point via a linker or spacer. In some embodiments, the linker or spacer is a flexible hydrophilic spacer, such as a PEG group (see, for example, U.S. Patent No. 5,885,968; Biessen et al. J. Med. Chem. 1995, Vol. 39, pp. 1538-1546). In some embodiments, the PEG spacer is a PEG3 spacer. The branching point can be any small molecule that allows attachment of three galactose derivatives and further allows attachment to an RNAi agent. An example of a branching point group is dilysine or diglutamic acid. Branching point attachment to an RNAi agent can occur via a linker or spacer. In some embodiments, the linker or spacer comprises a flexible hydrophilic spacer, such as, but not limited to, a PEG spacer. In some embodiments, the linker comprises a rigid linker, such as a cyclic group. In some embodiments, the galactose derivative comprises or is composed of N-acetyl-galactosamine. In some embodiments, the galactose derivative cluster comprises a galactose derivative tetramer, which may be, for example, an N-acetyl-galactosamine tetramer.

[0133] Embodiments of this disclosure include pharmaceutical compositions for delivering a MARC1 RNAi agent to hepatocytes in vivo. Such pharmaceutical compositions may include, for example, a MARC1 RNAi agent conjugated to a galactose derivative cluster. In some embodiments, the galactose derivative cluster comprises a galactose derivative trimer or a galactose derivative tetramer, said galactose derivative trimer being, for example, an N-acetyl-galactosamine trimer, and said galactose derivative tetramer being, for example, an N-acetyl-galactosamine tetramer.

[0134] The targeting ligand or targeting group can be attached to the 3' or 5' end of the sense or antisense strand of the MARC1 RNAi agent disclosed herein.

[0135] Targeting ligands include, but are not limited to, (NAG37) and (NAG37)s as defined in Table 7. Other targeting groups and targeting ligands, including galactose cluster targeting ligands, are known in the art.

[0136] In some embodiments, the linker group is conjugated to the RNAi agent. The linker group facilitates the covalent connection of the agent to a targeting group, delivery polymer, or delivery medium. The linker group may be conjugated to the 3' and / or 5' end of the sense or antisense strand of the RNAi agent. In some embodiments, the linker group is conjugated to the sense strand of the RNAi agent. In some embodiments, the linker group is conjugated to the 5' or 3' end of the sense strand of the RNAi agent. In some embodiments, the linker group is conjugated to the 5' end of the sense strand of the RNAi agent. Examples of linker groups may include, but are not limited to, reactive groups such as primary amines and alkynes, alkyl groups, debased nucleotides, ribitols (debased ribose), and / or PEG groups.

[0137] In some embodiments, the targeting group is internally linked to a nucleotide on the sense and / or antisense strand of the RNAi agent. In some embodiments, the targeting group is linked to the RNAi agent via a linker.

[0138] A linker or connecting group is a connection between two atoms that links a chemical group (such as an RNAi agent) or a segment of interest to another chemical group (such as a targeting group or a delivery polymer) or a segment of interest via one or more covalent bonds. Unstable links contain unstable bonds. Links may optionally include spacers that increase the distance between the two linking atoms. Spacers may further increase the flexibility and / or length of the link. Spacers include, but are not limited to, alkylalkenyl, alkynyl, aryl, aralkyl, arylenyl, and aryynyl groups; each may contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and sugars. Spacer groups are well known in the art, and the foregoing list is not intended to limit the scope of this specification.

[0139] In some embodiments, when two or more RNAi agents are included in a single composition, each RNAi agent may be linked to the same target group or two different target groups (i.e., target groups with different chemical structures). In some embodiments, the target group is linked to the MARC1 RNAi agent disclosed herein without the use of an additional adapter. In some embodiments, the target group itself is designed to have adapters or other readily available sites that facilitate conjugation. In some embodiments, when two or more MARC1 RNAi agents are included in a single molecule, each RNAi agent may utilize the same adapter or different adapters (i.e., adapters with different chemical structures).

[0140] Any MARC1 RNAi agent nucleotide sequence listed in Tables 2, 3, 4, 5, or 6D, whether modified or unmodified, may contain one or more 3' and / or 5' targeting or linking groups. Any MARC1 RNAi agent sequence listed in Tables 3, 4, or 6D or otherwise described herein containing 3' or 5' targeting or linking groups may alternatively not contain 3' or 5' targeting or linking groups, or may contain different 3' or 5' targeting or linking groups, including but not limited to those depicted in Table 7. Any MARC1 RNAi agent duplex listed in Tables 6A, 6B, 6C, and 6D, whether modified or unmodified, may further contain targeting or linking groups, including but not limited to those depicted in Table 7, and the targeting or linking group may be attached to the 3' or 5' end of the sense or antisense strand of the MARC1 RNAi agent duplex.

[0141] Examples of targeting groups and linking groups (which, when combined, can form targeting ligands) are provided in Table 7. Tables 5 and 6D provide certain embodiments of the sense strand of MARC1 RNAi agents having a targeting group or linking group attached to the 5' or 3' end.

[0142] Table 7. Structures of various modified nucleotides, targeting ligands or targeting groups, capped residues, and linker groups. In each of the structures listed in Table 7, the NAG comprises N-acetyl-galactosamine. In some embodiments, as will be understood by those skilled in the art based on the structures above and the description provided herein, the NAG to be attached, such as those depicted in Table 7 above, may comprise another galactose derivative with affinity for desialylate glycoprotein receptors present on hepatocytes. Other linker groups known in the art may be used.

[0143] In some embodiments, a delivery medium may be used to deliver RNAi agents to cells or tissues. The delivery medium is a compound that improves the delivery of RNAi agents to cells or tissues. Delivery media may include, but are not limited to, the following or consist of: polymers, such as amphiphilic polymers, membrane-active polymers, peptides, melittin, melittin-like peptides (MLPs), lipids, reversibly modified polymers or peptides, or reversibly modified membrane-active polyamines. In some embodiments, the RNAi agent may be combined with lipids, nanoparticles, polymers, liposomes, micelles, DPCs, or other delivery systems available in the art. RNAi agents can also be chemically conjugated to target groups, lipids (including but not limited to cholesterol and cholesterol-based derivatives), nanoparticles, polymers, liposomes, micelles, DPCs (see, for example, WO 2000 / 053722, WO 2008 / 0022309, WO 2011 / 104169 and WO 2012 / 083185, WO2013 / 032829, WO 2013 / 158141, each of which is incorporated herein by reference), hydrogels, cyclodextrins, biodegradable nanocapsules and bioadhesive microspheres, protein carriers, or other delivery systems known and available in the art suitable for the delivery of nucleic acids or oligonucleotides.

[0144] Pharmaceutical composition The MARC1 RNAi agents disclosed herein can be prepared as pharmaceutical compositions or formulations (also referred to herein as "medicines"). In some embodiments, the pharmaceutical compositions comprise at least one MARC1 RNAi agent. These pharmaceutical compositions are particularly useful for inhibiting the expression of target mRNAs in target cells, cell populations, tissues, or organisms.

[0145] The pharmaceutical composition may be used to treat subjects suffering from a disease, disorder, or condition that would benefit from reduced levels of target MARC1 mRNA or inhibition of target gene expression. The pharmaceutical composition may be used to treat subjects at risk of developing a disease, disorder, or condition that would benefit from reduced levels of target mRNA or inhibition of target gene expression. In one embodiment, the method includes administering a subject to be treated a MARC1 RNAi agent linked to a target ligand as described herein. In some embodiments, one or more pharmaceutically acceptable excipients (including mediators, carriers, diluents, and / or delivery polymers) are added to the pharmaceutical composition comprising the MARC1 RNAi agent to form a pharmaceutical formulation or medicament suitable for in vivo delivery to subjects, including humans.

[0146] The pharmaceutical compositions and methods disclosed herein, including MARC1 RNAi agents, reduce the level of target mRNA in cells, cell populations, tissues, organs, or subjects, including by administering a therapeutically effective amount of the MARC1 RNAi agent described herein to the subject, thereby inhibiting the expression or translation of MARC1 mRNA in the subject. In some embodiments, the subject has previously been identified as having pathogenic upregulation of the target gene in hepatocytes. In some embodiments, the subject has previously been identified or diagnosed with non-alcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD), alcoholic fatty liver disease, autoimmune hepatitis, liver fibrosis, cirrhosis, elevated blood cholesterol levels, hypertriglyceridemia, liver disease, and / or other MARC1-related diseases. In some embodiments, the subject will benefit from a reduction in MARC1 gene expression in the subject's liver.

[0147] In some embodiments, the pharmaceutical composition comprising a MARC1 RNAi agent is used to treat or manage clinical manifestations associated with nonalcoholic steatohepatitis (NASH), nonalcoholic fatty liver disease (NAFLD), alcoholic fatty liver disease, autoimmune hepatitis, liver fibrosis, cirrhosis, elevated blood cholesterol levels, hypertriglyceridemia, liver disease, and / or other MARC1-related disorders. In some embodiments, a therapeutically (including prophylactic) effective amount of one or more pharmaceutical compositions is administered to a subject requiring such treatment. In some embodiments, administration of any disclosed MARC1 RNAi agent may be used to reduce the number, severity, and / or frequency of disease symptoms in a subject.

[0148] The pharmaceutical composition comprising a MARC1 RNAi agent may be used to treat at least one symptom in subjects suffering from a disease or disorder in which reduced or suppressed MARC1 mRNA expression and / or reduced MARC1 protein levels would benefit. MARC1 levels may be measured according to established methods known in the art.

[0149] In some embodiments, a subject is given a therapeutically effective amount of one or more pharmaceutical compositions comprising a MARC1 RNAi agent to treat symptoms. In other embodiments, a subject is given a preventatively effective amount of one or more MARC1 RNAi agents to prevent or suppress at least one symptom.

[0150] The route of administration is the pathway by which the MARC1 RNAi agent comes into contact with the body. Generally, methods of administering drugs and oligonucleotides and nucleic acids for the treatment of mammals are well known in the art and can be applied to the administration of the compositions described herein. The MARC1 RNAi agents disclosed herein can be administered via any suitable route in a formulation appropriately tailored to that particular route. Therefore, the pharmaceutical compositions described herein can be administered by injection, such as intravenous, intramuscular, intradermal, subcutaneous, intra-articular, or intraperitoneal injection. In some embodiments, the pharmaceutical compositions described herein are administered via subcutaneous injection.

[0151] The pharmaceutical compositions comprising MARC1 RNAi agents described herein can be delivered to cells, cell populations, tissues, or subjects using oligonucleotide delivery technologies known in the art. Generally, any suitable method recognized in the art for delivering nucleic acid molecules (in vitro or in vivo) is applicable to the compositions described herein. For example, delivery can be via local administration (e.g., direct injection, implantation, or topical administration), systemic administration, or subcutaneous, intravenous, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal, and intrathecal), intramuscular, percutaneous, airway (aerosol), nasal, oral, rectal, or topical (including buccal and sublingual) administration. In some embodiments, the compositions are administered via subcutaneous or intravenous infusion or injection.

[0152] In some embodiments, the pharmaceutical compositions described herein comprise one or more pharmaceutically acceptable excipients. The pharmaceutical compositions described herein are formulated for administration to a subject.

[0153] As used herein, a pharmaceutical composition or drug comprises a pharmacologically effective amount of at least one of the said therapeutic compounds and one or more pharmaceutically acceptable excipients. A pharmaceutically acceptable excipient (excipient) is a substance intentionally included in a drug delivery system, other than the active pharmaceutical ingredient (API, therapeutic product, such as a MARC1 RNAi agent). The excipient does not exert or is not intended to exert a therapeutic effect at the intended dose. The excipient may function to a) facilitate the processing of the drug delivery system during manufacturing; b) protect, support, or enhance the stability, bioavailability, or patient acceptability of the API; c) facilitate product identification; and / or d) enhance the overall safety, efficacy, or any other property of delivery of the API during storage or use. Pharmaceutically acceptable excipients may or may not be inert substances.

[0154] Excipients include, but are not limited to: absorption promoters, anti-adhesion agents, defoamers, antioxidants, adhesives, buffers, carriers, coating agents, colorants, delivery promoters, delivery polymers, detergents, dextran, dextrose, diluents, disintegrants, emulsifiers, extenders, fillers, flavoring agents, flow aids, humectants, lubricants, oils, polymers, preservatives, brine, salt, solvents, sugars, surfactants, suspending agents, sustained-release matrices, sweeteners, thickeners, tensioning agents, mediators, waterproofing agents, and wetting agents.

[0155] Suitable pharmaceutical compositions for injection include sterile aqueous solutions (in the water-soluble case) or dispersions, as well as sterile powders for the ad hoc preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, antibacterial water, Cremophor® ELTM (BASF, Parsippany, NJ), or phosphate-buffered saline (PBS). Suitable carriers should be stable under manufacturing and storage conditions and should be protected against contamination by microorganisms such as bacteria and fungi. Carriers may be solvents or dispersion media containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. Appropriate flowability can be maintained, for example, by using coatings such as lecithin, by maintaining the desired particle size in the case of dispersions, and by using surfactants. In many cases, it will be preferred to include isotonic agents, such as sugars, polyols such as mannitol and sorbitol, and sodium chloride in the composition. Prolonged absorption of injectable compositions can be caused by including substances that delay absorption, such as aluminum monostearate and gelatin.

[0156] Sterile injectable solutions can be prepared by combining, as needed, the desired amount of the active compound in a suitable solvent with one or a combination of the ingredients listed above, followed by filtration and sterilization. Typically, dispersions are prepared by incorporating the active compound into a sterile medium, which contains a basic dispersion medium and other desired ingredients from those listed above. In the case of sterile powders used to prepare sterile injectable solutions, preparation methods include vacuum drying and freeze-drying to obtain a powder containing the active ingredient plus any other desired ingredients from a previously sterile filtered solution.

[0157] In some embodiments, pharmaceutical formulations of the MARC1 RNAi agent disclosed herein, suitable for subcutaneous administration, may be prepared in an aqueous sodium phosphate buffer (e.g., a MARC1 RNAi agent formulated in water with 0.5 mM sodium dihydrogen phosphate and 0.5 mM disodium hydrogen phosphate). In some embodiments, pharmaceutical formulations of the MARC1 RNAi agent disclosed herein, suitable for subcutaneous administration, may be prepared in water for injection (sterile water). MARC1 RNAi agents disclosed herein suitable for subcutaneous administration may be prepared in isotonic saline (0.9%).

[0158] Formulations suitable for intra-articular administration may be in the form of sterile aqueous formulations of the drug (which may be in microcrystalline form), such as aqueous microcrystalline suspensions. Liposome formulations or biodegradable polymer systems may also be used to deliver the drug for both intra-articular and ocular administration.

[0159] Formulations suitable for oral administration of the MARC1 RNAi agents disclosed herein can also be prepared. In some embodiments, the MARC1 RNAi agents disclosed herein are administered orally. In some embodiments, the MARC1 RNAi agents disclosed herein are formulated as capsules for oral administration.

[0160] The active compound can be prepared with a carrier that protects the compound from rapid elimination from the body, such as a controlled-release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyanhydride, polyglycolic acid, collagen, polyorthoesters, and polylactic acid can be used. Methods for preparing such formulations will be apparent to those skilled in the art. Liposome suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, such as those described in U.S. Patent No. 4,522,811.

[0161] MARC1 RNAi agents can be formulated into compositions in unit dosage form to facilitate administration and dosage uniformity. Unit dosage form refers to a physically discrete unit suitable as a unit dose for a subject to be treated; each unit contains a predetermined amount of active compound associated with a desired pharmaceutical carrier, calculated to produce the desired therapeutic effect. The specifications of the unit dosage forms disclosed herein are determined and directly depended upon by the unique characteristics of the active compound and the therapeutic effect to be achieved, as well as the inherent limitations in the art of formulating such active compound for individual treatment.

[0162] Pharmaceutical compositions may contain other additional components commonly found in pharmaceutical compositions. These additional components include, but are not limited to, antipruritic agents, astringents, local anesthetics, analgesics, antihistamines, or anti-inflammatory agents (e.g., acetaminophen, NSAIDs, diphenhydramine, etc.). Cells, tissues, or isolated organs expressing or containing RNAi agents as defined herein are also envisioned for use as “pharmaceutical compositions.” As used herein, “pharmacologically effective amount,” “therapeuticly effective amount,” or simply “effective amount,” refers to the amount of RNAi agent that produces a pharmacological, therapeutic, or preventative effect.

[0163] In some embodiments, the methods disclosed herein further include, in addition to administering the disclosed RNAi agent, the step of administering a second therapeutic agent or treatment. In some embodiments, the second therapeutic agent is another MARC1 RNAi agent (e.g., a MARC1 RNAi agent targeting a different sequence within the MARC1 target). In other embodiments, the second therapeutic agent may be a small molecule drug, an antibody, an antibody fragment, or an aptamer.

[0164] In some embodiments, the MARC1 RNAi agent(s) is optionally combined with one or more additional therapeutic agents. The MARC1 RNAi agent and the additional therapeutic agents(s) may be administered as a single composition, or they may be administered individually. In some embodiments, the one or more additional therapeutic agents are administered individually in a dosage form separate from the RNAi agent (e.g., the MARC1 RNAi agent is administered subcutaneously, while the additional therapeutic agent involved in the treatment dosing regimen is administered orally). In some embodiments, the MARC1 RNAi agent(s) is administered subcutaneously to the subject in need of it, and the one or more optional additional therapeutic agents are administered orally, together providing a treatment regimen for diseases and conditions associated with non-alcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD), alcoholic fatty liver disease, autoimmune hepatitis, liver fibrosis, cirrhosis, elevated blood cholesterol levels, hypertriglyceridemia, liver disease, and / or other MARC1-related diseases. In some embodiments, the MARC1 RNAi agent(s) is administered to the subject requiring it via subcutaneous injection, and the one or more optional additional therapeutic agents are administered separately via subcutaneous injection. In some embodiments, the MARC1 RNAi agent and one or more additional therapeutic agents are combined into a single dosage form (e.g., a "cocktail" of a single composition formulated for subcutaneous injection). The MARC1 RNAi agent (with or without one or more additional therapeutic agents) may be combined with one or more excipients to form a pharmaceutical composition.

[0165] Typically, the effective dose of a MARC1 RNAi agent will be in the range of about 0.1 to about 100 mg / kg body weight per dose, for example, about 1.0 to about 50 mg / kg body weight per dose. In some embodiments, the effective dose of the active compound will be in the range of about 0.25 to about 5 mg / kg body weight per dose. In some embodiments, the effective dose of the active ingredient will be in the range of about 0.5 to about 4 mg / kg body weight per dose. In some embodiments, the effective dose of the MARC1 RNAi agent may be a fixed dose. In some embodiments, the fixed dose is in the range of about 5 mg to about 1,000 mg of MARC1 RNAi agent. In some embodiments, the fixed dose is in the range of 10 to 400 mg of MARC1 RNAi agent. In some embodiments, the fixed dose is in the range of 50 to 400 mg of MARC1 RNAi agent. Dosing may be weekly, bi-weekly, monthly, quarterly, or at any other interval, depending on the dose of the MARC1 RNAi agent administered, the activity level of the specific MARC1 RNAi agent, and the level of inhibition desired by the specific subject. The examples in this article demonstrate appropriate levels of inhibition in certain animal species. The dosage administered will depend on variables such as the overall health status of the patient or subject, the relative biological efficacy of the delivered compound, the drug formulation, the presence and type of excipients in the formulation, and the route of administration. Furthermore, it should be understood that the initial dose may be increased above the aforementioned upper levels to rapidly achieve the desired blood or tissue levels, or the initial dose may be lower than the optimal value.

[0166] For the purpose of treating a disease or for the formation of a medicine or composition for treating a disease, the pharmaceutical compositions described herein, including MARC1 RNAi agents, may be combined with excipients or with second therapeutic agents or therapeutic combinations including, but not limited to, second or other RNAi agents, small molecule drugs, antibodies, antibody fragments, peptides and / or aptamers.

[0167] The MARC1 RNAi agent, when added to a pharmaceutically acceptable excipient or adjuvant, can be packaged as a kit, container, pouch, or dispenser. The pharmaceutical compositions described herein can be packaged in pre-filled syringes, pen syringes, auto-injectors, infusion bags / devices, or vials.

[0168] Treatment and suppression of expression methods The MARC1 RNAi agents disclosed herein can be used to treat subjects (e.g., humans or other mammals) with diseases or disorders that would benefit from the administration of the RNAi agent. In some embodiments, the RNAi agents disclosed herein can be used to treat subjects (e.g., humans) who would benefit from reduced and / or inhibited MARC1 mRNA expression and / or MARC1 protein levels, such as subjects diagnosed with or currently suffering from symptoms associated with non-alcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD), alcoholic fatty liver disease, autoimmune hepatitis, liver fibrosis, cirrhosis, elevated blood cholesterol levels, hypertriglyceridemia, liver disease, and / or other MARC1-related disorders.

[0169] In some embodiments, a therapeutically effective amount of any one or more MARC1 RNAi agents is administered to the subject. Treatment of the subject may include therapeutic and / or prophylactic treatment. A therapeutically effective amount of any one or more MARC1 RNAi agents described herein is administered to the subject. The subject may be an adult, adolescent, child, or infant. Administration of the pharmaceutical compositions described herein may be for human or animal use.

[0170] The MARC1 RNAi agents described herein can be used to treat at least one symptom in subjects suffering from MARC1-related diseases or disorders, or diseases or disorders at least partially mediated by MARC1 gene expression. In some embodiments, the MARC1 RNAi agents are used to treat or manage clinical presentations in subjects suffering from diseases or disorders that would benefit from or at least partially mediated by reduced levels of MARC1 mRNA or MARC1 protein. The subject is given a therapeutically effective amount of one or more of the MARC1 RNAi agents described herein, or a composition containing a MARC1 RNAi agent. In some embodiments, the methods disclosed herein include administering a composition containing a MARC1 RNAi agent described herein to a subject to be treated. In some embodiments, the subject is given a preventatively effective amount of any one or more of the MARC1 RNAi agents to treat the subject by preventing or suppressing at least one symptom.

[0171] In some embodiments, this disclosure provides a method for treating, in patients who require it, a disease, disorder, symptom, or pathological condition at least partially mediated by MARC1 gene expression, wherein the method comprises administering to the patient any of the MARC1 RNAi agents described herein.

[0172] In some embodiments, compared to subjects who had not received the MARC1 RNAi agent or those who had not received the MARC1 RNAi agent, the gene expression level and / or mRNA level of the MARC1 gene was reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 95%, 96%, 97%, 98%, 99%, or greater than 99%. The MARC1 mRNA level in the subjects may be reduced in the subjects' cells, cell populations, and / or tissues. In some embodiments, compared to subjects who had not received the MARC1 RNAi agent or those who had not received the MARC1 RNAi agent, the expression of the MARC1 gene in hepatocytes was inhibited by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or greater than 65%.

[0173] In some implementations, compared to subjects who had received the MARC1 RNAi agent or those who had not received the MARC1 RNAi agent, subjects who had received the MARC1 RNAi agent showed a reduction in MARC1 protein levels of at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99%. Protein levels in the subjects may be reduced in the subjects' cells, cell populations, tissues, blood, and / or other fluids.

[0174] Decreases in MARC1 mRNA and MARC1 protein levels can be assessed by any method known in the art. As used herein, a decrease or reduction in MARC1 mRNA and / or protein levels is collectively referred to herein as a decrease or reduction of MARC1 or inhibition or reduction of MARC1 gene expression. The examples shown herein illustrate known methods for evaluating MARC1 gene expression inhibition. Those skilled in the art will further understand suitable methods for evaluating MARC1 gene expression inhibition in vivo and / or in vitro.

[0175] In some implementations, this document discloses methods for treating (including prophylactic or preventative treatment) diseases, disorders, or conditions caused by nonalcoholic steatohepatitis (NASH), nonalcoholic fatty liver disease (NAFLD), alcoholic fatty liver disease, autoimmune hepatitis, liver fibrosis, cirrhosis, elevated blood cholesterol levels, hypertriglyceridemia, liver disease, and / or other MARC1-related disorders, wherein the method comprises administering to a subject in need of it a therapeutically effective amount of a MARC1 RNAi agent comprising an antisense strand at least partially complementary to a portion of the MARC1 mRNA having the sequence in Table 1. In some embodiments, this document discloses methods for treating (including prophylactic or preventative treatment) diseases or symptoms caused by nonalcoholic steatohepatitis (NASH), nonalcoholic fatty liver disease (NAFLD), alcoholic fatty liver disease, autoimmune hepatitis, liver fibrosis, cirrhosis, elevated blood cholesterol levels, hypertriglyceridemia, liver disease, and / or other MARC1-related diseases, wherein the method comprises administering a therapeutically effective amount of a MARC1 RNAi agent to a subject who requires it, said MARC1 RNAi agent comprising an antisense strand containing any sequence from Tables 2, 3, or 6D and a sense strand containing any sequence from Tables 2, 4, 5, or 6D that is at least partially complementary to the antisense strand. In some embodiments, this document discloses methods for treating (including prophylactic or preventative treatment) diseases or symptoms caused by nonalcoholic steatohepatitis (NASH), nonalcoholic fatty liver disease (NAFLD), alcoholic fatty liver disease, autoimmune hepatitis, liver fibrosis, cirrhosis, elevated blood cholesterol levels, hypertriglyceridemia, liver disease, and / or other MARC1-related diseases, wherein the method comprises administering a therapeutically effective amount of a MARC1 RNAi agent to a subject who requires it, said MARC1 RNAi agent comprising a sense strand comprising any sequence in Tables 2, 4, 5, or 6D and an antisense strand comprising any sequence in Tables 2, 3, or 6D that is at least partially complementary to the sense strand.

[0176] In some embodiments, this document discloses a method for inhibiting MARC1 gene expression in cells, wherein the method comprises administering a MARC1 RNAi agent to cells comprising an antisense strand that is at least partially complementary to a portion of a MARC1 mRNA having sequences in Table 1. In some embodiments, this document discloses a method for inhibiting MARC1 gene expression in cells, wherein the method comprises administering a MARC1 RNAi agent to cells, said MARC1 RNAi agent comprising an antisense strand comprising a sequence comprising any sequence in Tables 2, 3, or 6D and a sense strand comprising any sequence in Tables 2, 4, 5, or 6D that is at least partially complementary to the antisense strand. In some embodiments, this document discloses a method for inhibiting MARC1 gene expression in cells, wherein the method comprises administering a MARC1 RNAi agent, said MARC1 RNAi agent comprising a sense strand comprising any sequence in Tables 2, 4, 5, or 6D and an antisense strand comprising any sequence in Tables 2, 3, or 6D that is at least partially complementary to the sense strand.

[0177] The use of MARC1 RNAi agents provides methods for the therapeutic (including prophylactic) treatment of diseases / disorders associated with nonalcoholic steatohepatitis (NASH), nonalcoholic fatty liver disease (NAFLD), alcoholic fatty liver disease, autoimmune hepatitis, liver fibrosis, cirrhosis, elevated blood cholesterol levels, hypertriglyceridemia, liver disease, and / or other MARC1-related disorders, wherein the MARC1 RNAi agent mediates RNA interference to inhibit the expression of one or more genes essential for the production of the MARC1 protein. MARC1 RNAi agents can also be used to treat or prevent various diseases, disorders, or conditions, including nonalcoholic steatohepatitis (NASH), nonalcoholic fatty liver disease (NAFLD), alcoholic fatty liver disease, autoimmune hepatitis, liver fibrosis, cirrhosis, elevated blood cholesterol levels, hypertriglyceridemia, liver disease, and / or other MARC1-related disorders. Furthermore, compositions for the in vivo delivery of MARC1 RNAi agents to liver cells, and particularly hepatocytes, are described.

[0178] Cells, tissues, organs and non-human organisms Cells, tissues, organs, and non-human organisms, including at least one of the MARC1 RNAi agents described herein, are considered. These cells, tissues, organs, or non-human organisms are prepared by delivering the RNAi agent to the cell, tissue, organ, or non-human organism.

[0179] Other illustrative implementation schemes Certain additional illustrative embodiments of the disclosed invention are provided herein. These embodiments are merely illustrative and do not limit the scope of this disclosure or the appended claims.

[0180] Implementation Scheme 1. An RNAi agent for inhibiting MARC1 gene expression, comprising: Antisense strand, comprising a nucleotide sequence of at least 15 consecutive nucleotides differing by 0 or 1 nucleotide from any of the antisense strand sequences in Tables 2, 3, or 6D; and The sense strand contains a nucleotide sequence that is at least partially complementary to the antisense strand. Implementation Scheme 2. The RNAi agent according to Implementation Scheme 1, wherein the antisense strand comprises nucleotides 2-18 of any of the sequences provided in Table 2, Table 3 or Table 6D.

[0181] Implementation Scheme 3. The RNAi agent according to Implementation Scheme 1 or Implementation Scheme 2, wherein the sense strand comprises a nucleotide sequence of at least 15 consecutive nucleotides that differ from any of the sense strand sequences in Tables 2, 4, 5 or 6D by 0 or 1 nucleotide, and wherein the sense strand has a region that is at least 85% complementary to the antisense strand on at least 15 consecutive nucleotides.

[0182] Implementation Scheme 4. An RNAi agent according to any one of Implementation Schemes 1-3, wherein at least one nucleotide of the RNAi agent comprises a modified internucleotide linker.

[0183] Implementation Scheme 5. An RNAi agent according to any one of Implementation Schemes 1-4, wherein all or substantially all nucleotides are modified nucleotides.

[0184] Implementation Scheme 6. The RNAi agent according to any one of Implementation Schemes 4-5, wherein the modified nucleotide is independently selected from: 2'-O-methyl nucleotide, 2'-fluoronucleotide, 2'-deoxynucleotide, 2',3'-open-ring nucleotide mimic, locked nucleotide, 2'-F-arabinonucleotide, 2'-methoxyethyl nucleotide, debased nucleotide, ribitol, reverse nucleotide, reverse 2'-O-methyl nucleotide, reverse 2'-deoxynucleotide, 2'-amino modified nucleotide, 2'-alkyl modified nucleotide, morpholinonucleotide, vinylphosphonate-containing nucleotide, cyclopropylphosphonate-containing nucleotide, and 3'-O-methyl nucleotide.

[0185] Implementation Scheme 7. The RNAi agent according to Implementation Scheme 5, wherein all or substantially all modified nucleotides are 2'-O-methyl nucleotides, 2'-fluoro nucleotides, or combinations thereof.

[0186] Implementation Scheme 8. An RNAi agent according to any one of Implementation Schemes 1-7, wherein the antisense strand consists of or is substantially composed of any of the modified antisense strand sequences in Table 3.

[0187] Implementation Scheme 9. An RNAi agent according to any one of Implementation Schemes 1-8, wherein the sense strand consists of, is substantially composed of, or contains any modified sense strand sequence from Tables 4, 5, or 6D.

[0188] Implementation Scheme 10. The RNAi agent according to Implementation Scheme 1, wherein the antisense strand comprises a nucleotide sequence of any one of the modified sequences in Table 3 or Table 6D, and the sense strand comprises a nucleotide sequence of any one of the modified sequences in Table 4, Table 5, or Table 6D.

[0189] Implementation Scheme 11. An RNAi agent according to any one of Implementation Schemes 1-10, wherein the length of the sense strand is between 18 and 30 nucleotides and the length of the antisense strand is between 18 and 30 nucleotides.

[0190] Implementation Scheme 12. The RNAi agent according to Implementation Scheme 11, wherein the length of the sense strand and the antisense strand are each between 18 and 27 nucleotides.

[0191] Implementation Scheme 13. The RNAi agent according to Implementation Scheme 12, wherein the length of the sense strand and the antisense strand are each between 18 and 24 nucleotides.

[0192] Implementation Scheme 14. The RNAi agent according to Implementation Scheme 13, wherein the sense strand and the antisense strand are each 21 nucleotides in length.

[0193] Implementation Scheme 15. The RNAi agent according to Implementation Scheme 14, wherein the RNAi agent has two blunt ends.

[0194] Implementation Scheme 16. An RNAi agent according to any one of Implementation Schemes 1-15, wherein the sense strand comprises one or two end caps.

[0195] Implementation Scheme 17. An RNAi agent according to any one of Implementation Schemes 1-16, wherein the sense strand contains one or two reverse debasement residues.

[0196] Implementation Scheme 18. The RNAi agent according to Implementation Scheme 1, wherein the RNAi agent comprises a sense strand and an antisense strand forming a double helix having any one of the structures of double helixes in Tables 6A and 6B.

[0197] Implementation Scheme 19. The RNAi agent according to Implementation Scheme 18, wherein all or substantially all nucleotides are modified nucleotides.

[0198] Implementation Scheme 20. The RNAi agent according to Implementation Scheme 1, comprising, substantially comprising, or containing an antisense strand consisting of, a nucleotide sequence differing from, one of the following nucleotide sequences (5'→3') by 0 or 1 nucleotide: UGAAAGAACUAUUCCAUAUC (SEQ ID NO: 1608); ACAGAAUCCUGUCUUGUCGUU (SEQ ID NO: 1657); UCCUUUAAAGGUUUUCAGUAG (SEQ ID NO: 1580); or UAUUGAAGCAUUGAGACACCG (SEQ ID NO: 1659).

[0199] Implementation Scheme 21. An RNAi agent according to any one of Implementation Schemes 1-20, wherein the nucleotides of the antisense strand located at positions 2 and 14 from the 5' end are 2'-fluorinated nucleotides.

[0200] Implementation Scheme 22. The RNAi agent according to Implementation Scheme 21, wherein the nucleotide at position 2 of the antisense strand is 2'-fluorouridine and the nucleotide at position 14 of the antisense strand is 2'-fluorocytidine, and wherein the antisense strand contains 3 or 4 thiophosphate nucleotide links.

[0201] Implementation Scheme 23. An RNAi agent according to any one of Implementation Schemes 1-22, wherein the sense strand consists of, is substantially composed of, or contains one of the following nucleotide sequences (5'→ 3') differing by 0 or 1 nucleotide: GAUUAUGGAAUAGUUCUUUCA (SEQ ID NO: 1734); AACGACAAGACAGGAUUCUGU (SEQ ID NO: 1783); CUACUGAAAACCUUUAAAIGA (SEQ ID NO: 1774); or CGGUGUCUCAAUGCUUCAAUA (SEQ ID NO: 1784).

[0202] Implementation Scheme 24. An RNAi agent according to any one of Implementation Schemes 20-23, wherein all or substantially all nucleotides are modified nucleotides.

[0203] Implementation Scheme 25. The RNAi agent according to Implementation Scheme 1, comprising a modified nucleotide sequence differing from one of the following nucleotide sequences (5'→3') by 0 or 1 nucleotide, an antisense strand consisting of or substantially consisting of the modified nucleotide sequence: cPrpusGfaaaGfaacuaUfuCfcAfuaausc (SEQ ID NO: 1143); asCfagAfauccugUfcUfuGfucgusu (SEQ ID NO: 1228); isCfagAfauccugUfcUfuGfucgusu (SEQ ID NO: 1229); cPrpusCfscsUfuUfaaaggUfuUfuCfaGfuasg (SEQ ID NO: 1200); or usAfsusugaAfgcauUfgAfgAfcaccsg (SEQ ID NO: 1235), Where a represents 2'-O-methyladenosine, c represents 2'-O-methylcytidine, g represents 2'-O-methylguanosine, i represents 2'-O-methylinosine; and u represents 2'-O-methyluridine; Af represents 2'-fluoroadenosine, Cf represents 2'-fluorocytidine, Gf represents 2'-fluoroguanosine, and Uf represents 2'-fluorouridine; cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyluridine; s represents a thiophosphate linker; and all or substantially all nucleotides on the sense strand are modified nucleotides.

[0204] Implementation Scheme 26. The RNAi agent according to Implementation Scheme 1, wherein the sense strand comprises, consists of, or is substantially composed of a modified nucleotide sequence that differs from, one of the following nucleotide sequences (5'→ 3') by 0 or 1 nucleotide: gauuauggAfAfUfaguucuuuca (SEQ ID NO: 1319); aacgacaaGfAfCfaggauucugu (SEQ ID NO: 1376); cuacugaaAfAfCfcuuuaaaiga (SEQ ID NO: 1361); or cggugucuCfAfAfugcuucaaua (SEQ ID NO: 1377), Where a represents 2'-O-methyladenosine, c represents 2'-O-methylcytidine, g represents 2'-O-methylguanosine, u represents 2'-O-methyluridine, and i represents 2'-O-methylinosine; Af represents 2'-fluoroadenosine, Cf represents 2'-fluorocytidine, Gf represents 2'-fluoroguanosine, and Uf represents 2'-fluorouridine; s represents a phosphate thioester linker; and all or substantially all nucleotides on the sense strand are modified nucleotides.

[0205] Implementation Scheme 27. An RNAi agent according to any one of Implementation Schemes 20-26, wherein the sense strand further includes a reverse debasement residue at the 3' end, the 5' end, or both of the nucleotide sequence.

[0206] Implementation Scheme 28. An RNAi agent according to any one of Implementation Schemes 1-27, wherein the RNAi agent is linked to a target ligand.

[0207] Implementation Scheme 29. An RNAi agent according to any one of Implementation Schemes 1-28, wherein the targeting ligand comprises: or .

[0208] Implementation Scheme 30. An RNAi agent according to any one of Implementation Schemes 1-29, wherein the targeting ligand is linked to the sense strand.

[0209] Implementation Scheme 31. The RNAi agent according to Implementation Scheme 30, wherein the targeting ligand is linked to the 5' end of the sense strand.

[0210] Implementation Scheme 32. A composition comprising an RNAi agent according to any one of Implementation Schemes 1-31, wherein the composition further comprises a pharmaceutically acceptable excipient.

[0211] Implementation Scheme 33. The composition according to Implementation Scheme 32 further comprises a second RNAi agent capable of inhibiting MARC1 gene expression.

[0212] Implementation Scheme 34. The composition according to any one of Implementation Schemes 32-33, further comprising one or more additional therapeutic agents.

[0213] Implementation Scheme 35. The composition according to any one of Implementation Schemes 32-34, wherein the composition is formulated for administration.

[0214] Implementation Scheme 36. The composition according to Implementation Scheme 35, wherein the composition is delivered by subcutaneous injection.

[0215] Implementation Scheme 37. The composition according to any one of Implementation Schemes 32-36, wherein the pharmaceutically acceptable excipient is sodium phosphate buffer.

[0216] Implementation Scheme 38. The composition according to any one of Implementation Schemes 32-36, wherein the pharmaceutically acceptable excipient is isotonic saline or water for injection.

[0217] Implementation Scheme 39. A method for inhibiting MARC1 gene expression in hepatocytes, the method comprising introducing an effective amount of an RNAi agent according to any one of Implementation Schemes 1-31 or a composition according to any one of Implementation Schemes 32-38 into the cells of a subject.

[0218] Implementation Scheme 40. The method according to Implementation Scheme 39, wherein the subject is a human subject.

[0219] Implementation Scheme 41. The method according to any one of Implementation Schemes 39-40, wherein the MARC1 mRNA level in hepatocytes or in the subject is reduced by at least about 50%.

[0220] Implementation Scheme 42. The method according to any one of Implementation Schemes 39-41, wherein the level of MARC1 protein in hepatocytes or in the subject is reduced by at least about 50%.

[0221] Implementation Scheme 43. A method for treating MARC1-related diseases, disorders, or symptoms, said method comprising administering a therapeutically effective amount of the composition according to any one of Implementation Schemes 32-38 to a human subject who requires it.

[0222] Implementation Scheme 44. The method according to Implementation Scheme 43, wherein the disease is hypertriglyceridemia, non-alcoholic steatohepatitis (NASH), alcoholic and non-alcoholic fatty liver disease (NAFLD), fatty liver disease, cirrhosis, elevated blood cholesterol levels, liver disease, autoimmune hepatitis and / or other MARC1-related diseases.

[0223] Implementation Scheme 45. The method according to any one of Implementation Schemes 39-44, wherein serum MARC1 protein levels are reduced in the subject.

[0224] Implementation Scheme 46. The method according to any one of Implementation Schemes 39-45, wherein the RNAi agent is administered to a human subject at a dose of about 0.05 mg / kg to about 5.0 mg / kg of human subject body weight.

[0225] Implementation Scheme 47. The use of an RNAi agent according to any one of Implementation Schemes 1-31 or a composition according to any one of Implementation Schemes 32-38 for the treatment of at least part of a disease, disorder, or symptom mediated by reduced MARC1 gene expression.

[0226] Implementation Scheme 48. The use as described in Implementation Scheme 47, wherein the disease is non-alcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD), alcoholic fatty liver disease, autoimmune hepatitis, liver fibrosis, cirrhosis, elevated blood cholesterol levels, hypertriglyceridemia, liver disease and / or other MARC1-related diseases.

[0227] Implementation Scheme 49. Use of the RNAi agent according to any one of Implementation Schemes 1-31 or the composition according to any one of Implementation Schemes 32-38 for the preparation of a pharmaceutical composition for the treatment of at least part of a disease, disorder or symptom mediated by reduced MARC1 gene expression.

[0228] The above-described implementation schemes and projects are now illustrated by the following non-limiting examples. Example

[0229] Example 1. Synthesis of MARC1 RNAi agent. The MARC1 RNAi agent duplexes shown in Tables 6A and 6B above were synthesized according to the following general procedure: A. Synthesis. The sense and antisense strands of RNAi agents are synthesized using a solid-phase phosphoramidite technique employed in oligonucleotide synthesis. This standard synthesis is generally known in the art. Depending on scale, MerMade96E® (Bioautomation), MerMade12® (Bioautomation), or OP Pilot 100 (GE Healthcare) are used. Synthesis is performed on a solid support made of controlled-aperture glass (CPG, 500 Å or 600 Å, from Prime Synthesis, Aston, PA, USA). The monomer located at the 3' end of the respective strand is attached to the solid support as the starting point for synthesis. All RNA and 2'-modified RNA phosphoramidite are purchased from Thermo Fisher Scientific (Milwaukee, WI, USA) or Hongene Biotech (Shanghai, PRC). The 2'-O-methylphosphoramidite comprises the following: (5'-O-dimethoxytriphenylmethyl-N 6-(benzoyl)-2'-O-methyl-adenosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide, 5'-O-dimethoxy-triphenylmethyl-N 4 -(acetyl)-2'-O-methyl-cytidine-3'-O-(2-cyanoethyl-N,N-diisopropyl-amino)phosphamide, (5'-O-dimethoxytriphenylmethyl-N 2 -(isobutyryl)-2'-O-methyl-guanosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide and 5'-O-dimethoxytriphenylmethyl-2'-O-methyl-uridine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide. 2'-Deoxy-2'-fluorophosphamide has the same protecting group as 2'-O-methylphosphamide. 5'-(4,4'-dimethoxytriphenylmethyl)-2',3'-open-ring-uridine and 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphamide were also available from Thermo Fisher Scientific or Hongene Biotech. 5'-Dimethoxytriphenylmethyl-2'-O-methyl-inosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide was purchased from Glen Research (Virginia) or Hongene Biotech. Cyclopropylphosphonate phosphoramide was synthesized according to International Patent Application Publication No. WO 2017 / 214112 (see also Altenhofer et al., Chem. Communications (Royal Soc. Chem.), 57(55):6808-6811 (July 2021)). Reverse debasing (3'-O-dimethoxytriphenylmethyl-2'-deoxyribose-5'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide) was purchased from ChemGenes (Wilmington, MA, USA) or SAFC (St Louis, MO, USA). 5'-O-dimethoxytriphenylmethyl-N 2 N 6 -(phenoxyacetic acid ester)-2'-O-methyl-diaminopurine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide was obtained from ChemGenes or Hongene Biotech.

[0230] The phosphorus amide containing the targeting ligand was dissolved in anhydrous dichloromethane or anhydrous acetonitrile (50 mM), while all remaining phosphorus amide was dissolved in anhydrous acetonitrile (50 mM), or anhydrous dimethylformamide and a molecular sieve (3 Å) were added. 5-Benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile), 5-ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile), or 4,5-dicyanimidazolium (DCI) were used as activating solutions. Coupling times were 12 min (RNA), 15 min (targeting ligand), 90 sec (2'OMe), and 60 sec (2'F). To introduce the thiophosphate linker, a 100 mM solution of 3-phenyl-1,2,4-dithiazolin-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was used. Each of the MARC1 RNAi agent duplexes synthesized and tested in the following examples utilized N-acetyl-galactosamine as “NAG” in the target ligand chemical structures shown in Table 7. The (NAG37) and (NAG37)s target ligand phosphoramidide compounds were synthesized according to International Patent Application Publication No. WO 2018 / 044350 of Arrowhead Pharmaceuticals, Inc.

[0231] B. Cleavage and deprotection of support-bound oligomers. After solid-phase synthesis, the dried solid support was treated with a 1:1 volume solution of 40 wt.% methylamine and 28% ammonium hydroxide (Aldrich) in water at 30°C for 1.5 hours. The solution was then evaporated and the solid residue was reconstituted in water.

[0232] C. Purification. The crude oligomers were purified by anion-exchange HPLC using a TSKgel SuperQ-5PW 13 μm column and a Shimadzu LC-8 system. Buffer A consisted of 20 mM Tris, 5 mM EDTA, pH 9.0, and 20% acetonitrile, while buffer B was identical to buffer A with the addition of 1.5 M sodium chloride. UV traces were recorded at 260 nm. Appropriate fractions were collected and then run on size-resistance HPLC using a GE Healthcare XK 26 / 40 column fitted with a Sephadex G25 fine, with a run buffer of either filtered DI water or 100 mM ammonium bicarbonate, pH 6.7, and 20% acetonitrile.

[0233] D. Annealing. To form an RNAi agent, complementary strands were mixed by combining equimolar RNA solutions (sense and antisense) in 1x phosphate-buffered saline (Corning, Cellgro). A portion of the RNAi agent was lyophilized and stored at -15 to -25°C. The duplex concentration was determined by measuring the absorbance of the solution in 1x phosphate-buffered saline on a UV-Vis spectrophotometer. The absorbance at 260 nm was then multiplied by a conversion factor and a dilution factor to determine the duplex concentration. The conversion factor used was 0.050 mg / (mL∙cm) or calculated from an experimentally determined extinction factor.

[0234] Example 2. hMARC1 SEAP mouse model. To evaluate the MARC1 RNAi agent, a MARC1-SEAP mouse model was used. C57BL / 6albino mice were transiently transfected in vivo via hydrodynamic tail vein (HTV) injection of the plasmid. Mice were injected via HTV with plasmid pMIR1015 containing the 33-2500 region of the human MARC1 cDNA sequence (NCBI reference sequence: NM_022746.4 (Seq ID No. 1)) inserted into the 3' UTR of the SEAP (secretory human placental alkaline phosphatase) reporter gene. A MARC1-SEAP mouse model was created by injecting 50 μg of plasmid containing hMARC1 cDNA into Ringer's fluid at 10% of the animal's body weight via HTV. Following transfection with MARC1-SEAP, mice were subsequently administered a MARC1 RNAi agent. Inhibition of MARC1 expression by the MARC1 RNAi agent resulted in a concomitant inhibition of SEAP expression. SEAP expression levels were measured using the Phospha-Light™ SEAP reporter assay system (ThermoFisher Cat #T1016). Serum SEAP expression levels were measured prior to treatment, and mice were grouped according to mean SEAP levels.

[0235] analyze SEAP levels can be measured at different times before and after administration of MARC1 RNAi.

[0236] i) Serum collection Mice were anesthetized with 2-3% isoflurane, and blood samples were collected from the submandibular region into serum separation tubes (Sarstedt AG&Co., Nümbrecht, Germany). The blood was allowed to coagulate at ambient temperature for 20 min. The tubes were centrifuged at 8000 ×g for 3 min to separate the serum, which was then stored at 4°C.

[0237] ii) Serum SEAP levelsSerum was collected and measured using the Phospha-Light™ SEAP Reporter Assay System (ThermoFisher) according to the manufacturer's instructions. Serum SEAP levels for each animal were normalized to those of saline-injected control mice to account for the non-treatment-related decrease in MARC1 sequence expression in this model. First, the SEAP level for each animal at a time point was divided by that animal's pre-treatment expression level (“pre-treatment”) to determine the “normalized to pre-treatment” expression ratio. Then, expression at a specific time point was normalized to the control group by dividing the individual animal's “normalized to pre-treatment” ratio by the mean “normalized to pre-treatment” ratio of all mice in the saline control group. Alternatively, in some embodiments described herein, serum SEAP levels for each animal were evaluated by normalizing only to pre-treatment levels.

[0238] Example 3. In vivo administration of MARC1 RNAi agent to hMARC1-SEAP mice. The hMARC1-SEAP model described in Example 2 above was used. On day 1, four (n=4) female C57bl / 6albino mice were administered saline or a MARC1 RNAi agent prepared in saline (at 2 mg / kg) via subcutaneous (SQ) injection. The administration regimen is shown in Table 8 below.

[0239] Table 8. Dosing in mice of Example 3 Group Dosage (RNAi agent) Target location of MARC1 (Seq ID No. 1) route of administration 1 Isotonic saline N / A SQ injection on day 1 2 2 mg / kg AD11764 325 SQ injection on day 1 3 2 mg / kg AD11765 536 SQ injection on day 1 4 2 mg / kg AD11766 609 SQ injection on day 1 5 2 mg / kg AD11767 611 SQ injection on day 1 6 2 mg / kg AD11768 636 SQ injection on day 1 7 2 mg / kg AD11769 640 SQ injection on day 1 8 2 mg / kg AD11770 644 SQ injection on day 1 9 2 mg / kg AD11771 710 SQ injection on day 1 10 2 mg / kg AD11772 841 SQ injection on day 1 11 2 mg / kg AD11773 932 SQ injection on day 1 12 2 mg / kg AD11774 940 SQ injection on day 1 13 2 mg / kg AD11775 945 SQ injection on day 1 14 2 mg / kg AD11776 954 SQ injection on day 1 15 2 mg / kg AD11777 1057 SQ injection on day 1 16 2 mg / kg AD11778 1089 SQ injection on day 1 17 2 mg / kg AD11779 1098 SQ injection on day 1 18 2 mg / kg AD11780 1102 SQ injection on day 1 19 2 mg / kg AD11781 1111 SQ injection on day 1 20 2 mg / kg AD11782 1190 SQ injection on day 1 21 2 mg / kg AD11783 1193 SQ injection on day 1 22 2 mg / kg AD11784 1282 SQ injection on day 1 23 2 mg / kg AD11785 1310 SQ injection on day 1 24 2 mg / kg AD11786 1313 SQ injection on day 1 25 2 mg / kg AD11787 1605 SQ injection on day 1 26 2 mg / kg AD11788 1635 SQ injection on day 1 27 2 mg / kg AD11789 1646 SQ injection on day 1 28 2 mg / kg AD11790 1648 SQ injection on day 1 29 2 mg / kg AD11791 1852 SQ injection on day 1 30 2 mg / kg AD11792 1897 SQ injection on day 1 31 2 mg / kg AD11793 1898 SQ injection on day 1 32 2 mg / kg AD11794 1955 SQ injection on day 1 33 2 mg / kg AD11795 1990 SQ injection on day 1 Serum samples were collected on days -3, 1, 8, 15, 22, and 29. SEAP expression levels were determined according to the procedure described in Example 2 above. Data from the experiments are shown in Table 9 below, with mean SEAP reflecting the normalized mean of SEAP.

[0240] Table 9. Mean SEAP normalized to pre-treatment and saline control in hMARC1-SEAP mice in Example 3. On day 8, groups 5, 7, 8, 12-16, 18, 22-25, 30, and 31 showed a decrease in SEAP. On day 15, groups 5, 7, 8, and 10-33 showed a decrease in SEAP. On day 22, groups 5, 7, 8, 10, 12, 13, 15-18, 20-26, 31, and 32 showed a decrease in SEAP.

[0241] Example 4. In vivo administration of MARC1 RNAi agent to hMARC1-SEAP mice. The hMARC1-SEAP model described in Example 2 above was used. On day 1, four (n=4) female C57bl / 6albino mice were administered saline or a MARC1 RNAi agent prepared in saline (at 2 mg / kg, 4 mg / kg, or 6 mg / kg) via subcutaneous (SQ) injection at a volume of 200 µL per 20 g (10 mL / kg) body weight. The administration regimen is shown in Table 10 below.

[0242] Table 10. Dosing in mice of Example 4 Group Dosage (RNAi agent) Target location of MARC1 (Seq ID No. 1) route of administration 1 Isotonic saline N / A SQ injection on day 1 2 6 mg / kg AD11778 1089 SQ injection on day 1 3 4 mg / kg AD11778 1089 SQ injection on day 1 4 2 mg / kg AD11778 1089 SQ injection on day 1 5 6 mg / kg AD11785 1310 SQ injection on day 1 6 4 mg / kg AD11785 1310 SQ injection on day 1 7 2 mg / kg AD11785 1310 SQ injection on day 1 8 6 mg / kg AD11786 1313 SQ injection on day 1 9 4 mg / kg AD11786 1313 SQ injection on day 1 10 2 mg / kg AD11786 1313 SQ injection on day 1 11 4 mg / kg AD11782 1190 SQ injection on day 1 Serum samples were collected on days -5, 1, 8, 15, 22, and 29. SEAP expression levels were determined according to the procedure described in Example 2 above. Data from the experiments are shown in Table 11 below, with mean SEAP reflecting the normalized mean of SEAP.

[0243] Table 11. Mean SEAP normalized to untreated and saline control in hMARC1-SEAP mice in Example 4. Groups 2-11 showed a decrease in SEAP at all time points.

[0244] Example 5. In vivo administration of MARC1 RNAi agent to hMARC1-SEAP mice. The hMARC1-SEAP model described in Example 2 above was used. On day 1, four (n=4) female C57bl / 6albino mice were administered saline or a MARC1 RNAi agent prepared in saline (at 2 mg / kg) via subcutaneous (SQ) injection at a volume of 200 µL per 20 g (10 mL / kg) body weight. The administration regimen is shown in Table 12 below.

[0245] Table 12. Dosing in mice of Example 5 Group Dosage (RNAi agent) Target location of MARC1 (Seq ID No. 1) route of administration 1 Isotonic saline N / A SQ injection on day 1 2 2 mg / kg AD12363 305 SQ injection on day 1 3 2 mg / kg AD12364 761 SQ injection on day 1 4 2 mg / kg AD12365 956 SQ injection on day 1 5 2 mg / kg AD12366 1109 SQ injection on day 1 6 2 mg / kg AD12367 1275 SQ injection on day 1 7 2 mg / kg AD12368 1633 SQ injection on day 1 8 2 mg / kg AD12369 1817 SQ injection on day 1 9 2 mg / kg AD12370 1900 SQ injection on day 1 10 2 mg / kg AD12371 1954 SQ injection on day 1 11 2 mg / kg AD12372 1633 SQ injection on day 1 12 2 mg / kg AD11786 1313 SQ injection on day 1 Serum samples were collected on days -9, 1, 8, 15, and 22. SEAP expression levels were determined according to the procedure described in Example 2 above. Data from the experiments are shown in Table 13 below, with mean SEAP reflecting the normalized mean of SEAP.

[0246] Table 13. Mean SEAP normalized to untreated and saline control in MARC1-SEAP mice in Example 5. Groups 2-12 showed a decrease in SEAP at all time points.

[0247] Example 6. In vivo administration of MARC1 RNAi agent to hMARC1-SEAP mice. The hMARC1-SEAP model described in Example 2 above was used. On day 1, four (n=4) female C57bl / 6albino mice were administered saline or a MARC1 RNAi agent prepared in saline (at 2 mg / kg) via subcutaneous (SQ) injection at a volume of 200 µL per 20 g (10 mL / kg) body weight. The administration regimen is shown in Table 14 below.

[0248] Table 14. Dosing in mice of Example 6 Group Dosage (RNAi agent) Target location of MARC1 (Seq ID No. 1) route of administration 1 Isotonic saline N / A SQ injection on day 1 2 2 mg / kg AD11786 1313 SQ injection on day 1 3 2 mg / kg AD12291 1313 SQ injection on day 1 4 2 mg / kg AD12292 1313 SQ injection on day 1 5 2 mg / kg AD12972 1313 SQ injection on day 1 6 2 mg / kg AD12973 1313 SQ injection on day 1 7 2 mg / kg AD12974 1313 SQ injection on day 1 8 2 mg / kg AD12975 1313 SQ injection on day 1 9 2 mg / kg AD12976 1313 SQ injection on day 1 10 2 mg / kg AD12591 901 SQ injection on day 1 Serum samples were collected on days -14, -7, 1, 8, 15, 22, and 29. SEAP expression levels were determined according to the procedure described in Example 2 above. Data from the experiments are shown in Table 15 below, with mean SEAP reflecting the normalized mean of SEAP.

[0249] Table 15. Mean SEAP normalized to untreated and saline control in MARC1-SEAP mice in Example 6. Groups 2-10 showed a decrease in SEAP at all time points.

[0250] Example 7. In vivo administration of MARC1 RNAi agent to hMARC1-SEAP mice. The hMARC1-SEAP model described in Example 2 above was used. On day 1, four (n=4) female C57bl / 6albino mice were administered saline or a MARC1 RNAi agent prepared in saline (at 2 mg / kg) via subcutaneous (SQ) injection at a volume of 200 µL per 20 g (10 mL / kg) body weight. The administration regimen is shown in Table 16 below.

[0251] Table 16. Dosing in mice of Example 7 Group Dosage (RNAi agent) Target location of MARC1 (Seq ID No. 1) route of administration 1 Isotonic saline N / A SQ injection on day 1 2 2 mg / kg AD11786 1313 SQ injection on day 1 3 2 mg / kg AD12367 1275 SQ injection on day 1 4 2 mg / kg AD13113 1275 SQ injection on day 1 5 2 mg / kg AD13114 1275 SQ injection on day 1 6 2 mg / kg AD13115 1275 SQ injection on day 1 7 2 mg / kg AD13116 1275 SQ injection on day 1 8 2 mg / kg AD13117 1275 SQ injection on day 1 9 2 mg / kg AD12371 1954 SQ injection on day 1 10 2 mg / kg AD13118 1954 SQ injection on day 1 11 2 mg / kg AD13119 1954 SQ injection on day 1 12 2 mg / kg AD12596 1014 SQ injection on day 1 Serum samples were collected on days -14, -7, 1, 8, 15, 22, and 29. SEAP expression levels were determined according to the procedure described in Example 2 above. Data from the experiments are shown in Table 17 below, with mean SEAP reflecting the normalized mean of SEAP.

[0252] Table 17. Mean SEAP normalized to untreated and saline control in MARC1-SEAP mice in Example 7. On day 8, groups 2, 4, 5, 7, and 8 showed a decrease in SEAP. On day 15, groups 2, 5, 7, and 8 showed a decrease in SEAP. On day 22, groups 2, 4, 5, 7, and 8 showed a decrease in SEAP.

[0253] Example 8. In vivo administration of MARC1 RNAi agent to hMARC1-SEAP mice. The hMARC1-SEAP model described in Example 2 above was used. On day 1, four (n=4) female C57bl / 6albino mice were administered saline or a MARC1 RNAi agent prepared in saline (at 2 mg / kg) via subcutaneous (SQ) injection at a volume of 200 µL per 20 g (10 mL / kg) body weight. The administration regimen is shown in Table 18 below.

[0254] Table 18. Dosing in mice of Example 8 Group Dosage (RNAi agent) Target location of MARC1 (Seq ID No. 1) route of administration 1 Isotonic saline N / A SQ injection on day 1 2 2 mg / kg AD11786 1313 SQ injection on day 1 3 2 mg / kg AD12976 1313 SQ injection on day 1 4 2 mg / kg AD13322 419 SQ injection on day 1 5 2 mg / kg AD13323 601 SQ injection on day 1 6 2 mg / kg AD13324 1124 SQ injection on day 1 7 2 mg / kg AD13325 1131 SQ injection on day 1 8 2 mg / kg AD13326 1157 SQ injection on day 1 9 2 mg / kg AD13327 1246 SQ injection on day 1 10 2 mg / kg AD13328 1332 SQ injection on day 1 11 2 mg / kg AD13329 1432 SQ injection on day 1 12 2 mg / kg AD13330 1842 SQ injection on day 1 Serum samples were collected on days -14, -7, 1, 8, 15, 22, and 29. SEAP expression levels were determined according to the procedure described in Example 2 above. Data from the experiments are shown in Table 19 below, with mean SEAP reflecting the normalized mean of SEAP.

[0255] Table 19. Mean SEAP normalized to untreated and saline control in MARC1-SEAP mice in Example 8. Groups 2-12 showed a decrease in SEAP at all time points.

[0256] Example 9. In vivo administration of MARC1 RNAi agent to hMARC1-SEAP mice. The hMARC1-SEAP model described in Example 2 above was used. On day 1, four (n=4) female C57bl / 6albino mice were administered saline or a MARC1 RNAi agent prepared in saline (at 2 mg / kg) via subcutaneous (SQ) injection at a volume of 200 µL per 20 g (10 mL / kg) body weight. The administration regimen is shown in Table 20 below.

[0257] Table 20. Dosing in mice of Example 9 Group Dosage (RNAi agent) Target location of MARC1 (Seq ID No. 1) route of administration 1 Isotonic saline N / A SQ injection on day 1 2 2 mg / kg AD12976 1313 SQ injection on day 1 3 2 mg / kg AD13535 1059 SQ injection on day 1 4 2 mg / kg AD13536 1058 SQ injection on day 1 5 2 mg / kg AD13537 1060 SQ injection on day 1 6 2 mg / kg AD12982 1089 SQ injection on day 1 7 2 mg / kg AD13117 1275 SQ injection on day 1 8 2 mg / kg AD12960 1817 SQ injection on day 1 9 2 mg / kg AD12287 1190 SQ injection on day 1 10 2 mg / kg AD12289 1310 SQ injection on day 1 Serum samples were collected on days -7, 1, 8, 15, and 22. SEAP expression levels were determined according to the procedure described in Example 2 above. The experimental data are shown in Table 21 below, with mean SEAP reflecting the normalized mean of SEAP.

[0258] Table 21. Mean SEAP normalized to untreated and saline control in MARC1-SEAP mice in Example 9. Groups 2-10 showed a decrease in SEAP at all time points.

[0259] Example 10. In vivo administration of MARC1 RNAi agent to hMARC1-SEAP mice. The hMARC1-SEAP model described in Example 2 above was used. On day 1, four (n=4) female C57bl / 6albino mice were administered saline or a MARC1 RNAi agent prepared in saline (at 2 mg / kg) via subcutaneous (SQ) injection at a volume of 200 µL per 20 g (10 mL / kg) body weight. The administration regimen is shown in Table 22 below.

[0260] Table 22. Dosing in mice of Example 10 Group Dosage (RNAi agent) Target location of MARC1 (Seq ID No. 1) route of administration 1 Isotonic saline N / A SQ injection on day 1 2 2 mg / kg AD11778 1089 SQ injection on day 1 3 2 mg / kg AD12982 1089 SQ injection on day 1 4 2 mg / kg AD13705 1089 SQ injection on day 1 5 2 mg / kg AD13706 1089 SQ injection on day 1 6 2 mg / kg AD13707 1089 SQ injection on day 1 7 2 mg / kg AD12634 1931 SQ injection on day 1 8 2 mg / kg AD13708 1931 SQ injection on day 1 9 2 mg / kg AD13709 1931 SQ injection on day 1 10 2 mg / kg AD13710 1931 SQ injection on day 1 11 2 mg / kg AD13711 1931 SQ injection on day 1 12 2 mg / kg AD13712 1931 SQ injection on day 1 Serum samples were collected on days -7, 1, 8, 15, and 22. SEAP expression levels were determined according to the procedure described in Example 2 above. Data from the experiments are shown in Table 23 below, with mean SEAP reflecting the normalized mean of SEAP.

[0261] Table 23. Mean SEAP normalized to untreated and saline control in MARC1-SEAP mice of Example 10. Groups 2-12 showed a decrease in SEAP at all time points.

[0262] Example 11. In vivo administration of MARC1 RNAi agent to hMARC1-SEAP mice. The hMARC1-SEAP model described in Example 2 above was used. On day 1, four (n=4) female C57bl / 6albino mice were administered saline or RNAi prepared in saline (at 2 mg / kg) via subcutaneous (SQ) injection at a volume of 200 µL per 20 g (10 mL / kg) body weight. The administration regimen is shown in Table 24 below.

[0263] Table 24. Dosing in mice of Example 11 Group Dosage (RNAi agent) Target location of MARC1 (Seq ID No. 1) route of administration 1 Isotonic saline N / A SQ injection on day 1 2 2 mg / kg AD11786 1313 SQ injection on day 1 3 2 mg / kg AD12976 1313 SQ injection on day 1 4 2 mg / kg AD12367 1275 SQ injection on day 1 5 2 mg / kg AD13117 1275 SQ injection on day 1 6 2 mg / kg AD13508 1275 SQ injection on day 1 7 2 mg / kg AD13511 1275 SQ injection on day 1 8 2 mg / kg AD13510 1275 SQ injection on day 1 9 2 mg / kg AD13514 1275 SQ injection on day 1 10 2 mg / kg AD13804 1275 SQ injection on day 1 11 2 mg / kg AD13805 1275 SQ injection on day 1 12 2 mg / kg AD13806 1275 SQ injection on day 1 Serum samples were collected on days -7, 1, 8, 15, and 22. SEAP expression levels were determined according to the procedure described in Example 2 above. Data from the experiments are shown in Table 25 below, with mean SEAP reflecting the normalized mean of SEAP.

[0264] Table 25. Mean SEAP normalized to pre-treatment and saline control in MARC1-SEAP mice of Example 11. Groups 2-12 showed a decrease in SEAP at all time points.

[0265] Example 12. In vivo administration of MARC1 RNAi agent to hMARC1-SEAP mice. The hMARC1-SEAP model described in Example 2 above was used. On day 1, four (n=4) female C57bl / 6albino mice were administered saline or RNAi prepared in saline (at 2 mg / kg) via subcutaneous (SQ) injection at a volume of 200 µL per 20 g (10 mL / kg) body weight. The administration regimen is shown in Table 26 below.

[0266] Table 26. Dosing in mice of Example 12 Group Dosage (RNAi agent) Target location of MARC1 (Seq ID No. 1) route of administration 1 Isotonic saline N / A SQ injection on day 1 2 2 mg / kg AD12976 1313 SQ injection on day 1 3 2 mg / kg AD12960 1817 SQ injection on day 1 4 2 mg / kg AD13447 1817 SQ injection on day 1 5 2 mg / kg AD13117 1275 SQ injection on day 1 6 2 mg / kg AD12287 1190 SQ injection on day 1 7 2 mg / kg AD13923 1190 SQ injection on day 1 8 2 mg / kg AD13924 1190 SQ injection on day 1 9 2 mg / kg AD13925 1190 SQ injection on day 1 10 2 mg / kg AD13926 1190 SQ injection on day 1 Serum samples were collected on days -7, 1, 8, 15, and 22. SEAP expression levels were determined according to the procedure described in Example 2 above. The experimental data are shown in Table 27 below, with mean SEAP reflecting the normalized mean of SEAP.

[0267] Table 27. Mean SEAP normalized to pre-treatment and saline control in MARC1-SEAP mice of Example 12. Groups 2-10 showed a decrease in SEAP at all time points.

[0268] Example 13. In vivo administration of MARC1 RNAi agent to hMARC1-SEAP mice. The hMARC1-SEAP model described in Example 2 above was used. On day 1, four (n=4) female C57bl / 6albino mice were administered saline or an RNAi agent prepared in saline (at 2 mg / kg) via subcutaneous (SQ) injection at a volume of 250 µL per 25 g body weight. The administration regimen is shown in Table 28 below.

[0269] Table 28. Dosing in mice of Example 13 Group Dosage (RNAi agent) Target location of MARC1 (Seq ID No. 1) route of administration 1 Isotonic saline N / A SQ injection on day 1 2 2 mg / kg AD11786 1313 SQ injection on day 1 3 2 mg / kg AD12976 1313 SQ injection on day 1 4 2 mg / kg AD12369 1817 SQ injection on day 1 5 2 mg / kg AD13447 1817 SQ injection on day 1 6 2 mg / kg AD12367 1275 SQ injection on day 1 7 2 mg / kg AD13805 1275 SQ injection on day 1 8 2 mg / kg AD11782 1190 SQ injection on day 1 9 2 mg / kg AD13925 1190 SQ injection on day 1 Serum samples were collected on days -7, 1, 8, 15, and 22. SEAP expression levels were determined according to the procedure described in Example 2 above. Data from the experiments are shown in Table 29 below, with mean SEAP reflecting the normalized mean of SEAP.

[0270] Table 29. Mean SEAP normalized to untreated and saline control in MARC1-SEAP mice in Example 13. On days 8 and 15, groups 2–9 showed a decrease in SEAP. On day 22, groups 2–4 and 6–9 showed a decrease in SEAP.

[0271] Example 14. MARC1-GLuc AAV mouse model. To evaluate certain MARC1 RNAi agents, a MARC1-GLuc (Gaussian Luciferase) AAV (adeno-associated virus) mouse model was used. Male C57BL / 6 mice aged 6–8 weeks were transduced with MARC1-GLuc AAV serotype 8 at least 14 days prior to administration of the MARC1 RNAi agent or control. The MARC1-GLuc AAV genome contains the 33–2500 region of the human MARC1 cDNA sequence (GenBank NM_022746.4 (SEQ ID NO:1)) inserted into the 3' UTR of the GLuc reporter gene sequence. MARC1-GLuc AAV mouse models were created by intravenous injection of the corresponding virus at a total volume of 250 µL / 25 g animal body weight at 5E12–1E13 GC / kg in PBS via the tail vein. Inhibition of MARC1 expression by the MARC1 RNAi agent resulted in a concomitant inhibition of GLuc expression, which was measured. Serum GLuc expression was measured using the Pierce™ Gaussian luciferase glow assay kit (ThermoFisher Scientific, Catalog #16161) before treatment (between day -7 and day 1 before administration), and mice were grouped according to mean GLuc levels.

[0272] Mice were anesthetized with 2-3% isoflurane, and blood samples were collected from the submandibular region into serum separation tubes (Sarstedt AG & Co., Nümbrecht, Germany). The blood was allowed to clot at ambient temperature for 20 min. The tubes were centrifuged at 8000 ×g for 3 min to separate the serum, which was then stored at 4°C. Serum was collected and measured using the Pierce™ Gaussian Luciferase Glow Assay Kit according to the manufacturer's instructions. Serum GLuc levels for each animal were normalized to those of control mice injected with the vector control to explain non-treatment-related biases in MARC1 expression in this model. To do this, firstly, the GLuc level of each animal at a time point was divided by that animal's pre-treatment expression level (day 1) to determine the "normalized to pre-treatment" expression ratio. Then, the expression at a specific time point was normalized to the control group by dividing the "normalized to pre-treatment" ratio of a single animal by the average "normalized to pre-treatment" ratio of all mice in the normal vector control group. Alternatively, serum GLuc levels in each animal were assessed by normalizing only to pre-treatment levels.

[0273] Example 15. In vivo testing of MARC1 RNAi agent in MARC1-GLuc AAV mice. The MARC1-GLUC AAV mouse model described in Example 14 above was used, employing MARC1-GLuc AAV containing the 33-2500 region of the human MARC1 cDNA sequence. On day 1, four (n=4) male C57bl / 6 mice were administered saline or an RNAi agent prepared in saline (at 2 mg / kg) via subcutaneous (SQ) injection at a volume of 250 µL per 25 g body weight. The injection was performed between the skin and muscle (i.e., subcutaneous injection). The administration regimen was as per Table 30 below.

[0274] Table 30. Dosing in mice of Example 15 Group Dosage (RNAi agent) Target location (Seq ID No. 1) Dosing regimen 1 brine N / A Day 1, single SQ injection 2 2 mg / kg AD12363 305 Day 1, single SQ injection 3 2 mg / kg AD12364 761 Day 1, single SQ injection 4 2 mg / kg AD12365 956 Day 1, single SQ injection 5 2 mg / kg AD12366 1109 Day 1, single SQ injection 6 2 mg / kg AD12367 1275 Day 1, single SQ injection 7 2 mg / kg AD12368 1633 Day 1, single SQ injection 8 2 mg / kg AD12369 1817 Day 1, single SQ injection 9 2 mg / kg AD12370 1900 Day 1, single SQ injection 10 2 mg / kg AD12371 1954 Day 1, single SQ injection 11 2 mg / kg AD11786 1313 Day 1, single SQ injection Each of the MARC1 RNAi agents comprises a modified nucleotide conjugated at the 5' end of the sense strand to a targeting ligand (tridentate ligand) comprising three N-acetyl-galactosamine groups, having the modified sequence described in the double-stranded structure section herein. (For specific modifications and structural information associated with MARC1 RNAi agents, see Tables 3, 4, 5A, 5B, 5C, and 6, including the (NAG37)s ligand). MARC1 RNAi agent AD12363 (Group 2) includes a nucleotide sequence designed to inhibit MARC1 gene expression at position 305 of the MARC1 gene; MARC1 RNAi agent AD12364 (Group 3) includes a nucleotide sequence designed to inhibit MARC1 gene expression at position 761 of the MARC1 gene; MARC1 RNAi agent AD12365 (Group 4) includes a nucleotide sequence designed to inhibit MARC1 gene expression at position 956 of the MARC1 gene; MARC1 RNAi agent AD12366 (Group 5) includes a nucleotide sequence designed to inhibit MARC1 gene expression at position 1109 of the MARC1 gene; MARC1 RNAi agent AD12367 (Group 6) includes a nucleotide sequence designed to inhibit MARC1 gene expression at position 1275 of the MARC1 gene; MARC1 RNAi agent AD12368... Group 7 includes a nucleotide sequence designed to inhibit MARC1 gene expression at position 1633 of the MARC1 gene; Group 8 includes a nucleotide sequence designed to inhibit MARC1 gene expression at position 1817 of the MARC1 gene; Group 9 includes a nucleotide sequence designed to inhibit MARC1 gene expression at position 1900 of the MARC1 gene; Group 10 includes a nucleotide sequence designed to inhibit MARC1 gene expression at position 1954 of the MARC1 gene; Group 11 includes a nucleotide sequence designed to inhibit MARC1 gene expression at position 1313 of the MARC1 gene. (For reference to the MARC1 gene, see, for example, SEQ ID NO:1 and Table 2).

[0275] Serum samples were collected on days 1, 8, 15, and 22. GLuc expression levels were determined according to the procedure described in Example 14 above. The experimental data are shown in Table 31 below, with mean GLuc reflecting the normalized mean of GLuc.

[0276] Table 31. Mean GLuc in MARC1-GLuc-AAV mice of Example 15, normalized to pre-treatment and saline control. On day 8, groups 2-11 showed a decrease in GLuc. On day 15, groups 4, 6, 9, and 11 showed a decrease in GLuc. On day 22, group 2 showed a decrease in GLuc.

[0277] Example 16. In vivo administration of MARC1 RNAi agent in rats. MARC1 inhibition of the MARC1 RNAi agent was tested in Sprague Dawley rats. On day 1, four (n=4) male Sprague Dawley rats were administered the RNAi agent via subcutaneous (SQ) injection at a volume of 1000 µL per 25 g (4 mg / kg) body weight. The dosing regimen was as shown in Table 32 below.

[0278] Table 32. Dosing in mice of Example 16 Group Dosage (RNAi agent) Target location of MARC1 (Seq ID No. 1) route of administration 1 brine N / A SQ injection on day 1 2 3 mg / kg AD12583 405 SQ injection on day 1 3 3 mg / kg AD12584 406 SQ injection on day 1 4 3 mg / kg AD12585 409 SQ injection on day 1 5 3 mg / kg AD12586 411 SQ injection on day 1 6 3 mg / kg AD12587 564 SQ injection on day 1 7 3 mg / kg AD12588 565 SQ injection on day 1 8 3 mg / kg AD12589 566 SQ injection on day 1 9 3 mg / kg AD12590 567 SQ injection on day 1 10 3 mg / kg AD12591 901 SQ injection on day 1 11 3 mg / kg AD12592 1008 SQ injection on day 1 12 3 mg / kg AD12593 1009 SQ injection on day 1 13 3 mg / kg AD12594 1012 SQ injection on day 1 14 3 mg / kg AD12595 1013 SQ injection on day 1 15 3 mg / kg AD12596 1014 SQ injection on day 1 The MARC1 RNAi agents in groups 2-15 target gene locations that are cross-reactive with human MARC1.

[0279] On day 8 post-administration, animals were sacrificed and liver tissue was collected. MARC1 expression in rats was determined using qPCR, with rat β-actin serving as a control. Mean MARC1 expression in liver tissue for each animal was normalized relative to pre-administration levels and control group 1 (saline). Data from the experiments are shown in Table 33 below.

[0280] Table 33. Mean relative expression of MARC1 in rat liver on day 8 of Example 16. On day 8, groups 3, 4, 8-10, 14 and 15 showed a decrease in rMARC1.

[0281] Example 17. In vivo administration of MARC1 RNAi agent in rats. MARC1 inhibition of the MARC1 RNAi agent was tested in Sprague Dawley rats. On day 1, four (n=4) male Sprague Dawley rats were administered the RNAi agent via subcutaneous (SQ) injection at a volume of 1000 µL per 25 g (4 mg / kg) body weight. The dosing regimen is shown in Table 34 below.

[0282] Table 34. Dosing in mice of Example 17 Group Dosage (RNAi agent) Target location of MARC1 (Seq ID No. 1) route of administration 1 brine N / A SQ injection on day 1 2 3 mg / kg AD12596 1014 SQ injection on day 1 3 3 mg / kg AD13452 1014 SQ injection on day 1 4 3 mg / kg AD13453 1014 SQ injection on day 1 5 3 mg / kg AD13454 1014 SQ injection on day 1 6 3 mg / kg AD13455 1014 SQ injection on day 1 7 3 mg / kg AD13456 1014 SQ injection on day 1 8 3 mg / kg AD13457 1014 SQ injection on day 1 9 3 mg / kg AD13458 1014 SQ injection on day 1 10 3 mg / kg AD13459 1014 SQ injection on day 1 The MARC1 RNAi agents in groups 2-10 target gene locations that are cross-reactive with human MARC1.

[0283] On day 8 post-administration, animals were sacrificed and liver tissue was collected. MARC1 expression in rats was determined using qPCR, with rat β-actin serving as a control. Mean MARC1 expression in liver tissue for each animal was normalized relative to pre-administration levels and control group 1 (saline). Data from the experiments are shown in Table 35 below.

[0284] Table 35. Mean relative expression of MARC1 in rat liver on day 8 of Example 17. On day 8, groups 2-10 showed a decrease in rMARC1.

[0285] Example 18. In vivo administration of MARC1 RNAi agent to cynomolgus monkeys. MARC1 inhibition of the MARC1 RNAi agent was tested in cynomolgus monkeys. Liver biopsies were collected from all animals on day -7 and used as internal reference samples for normalization purposes. On day 1, four groups of female (non-juvenile) cynomolgus monkeys (n=3 per group) were administered the RNAi agent, prepared in saline (at 3 mg / kg), via subcutaneous (SQ) injection into the mid-scapular region using a syringe and needle at a volume of 0.3 mL / kg body weight. Additional liver biopsies were collected on days 15 and 43. All animals were sedated and fasted for at least 12 but no more than 18 hours prior to liver biopsy collection. The dosing regimen was as per Table 36 below.

[0286] Table 36. Dosing in mice of Example 18 Group Dosage (RNAi agent) Target location of MARC1 (Seq ID No. 1) route of administration 1 3 mg / kg AD11786 1313 SQ injection on day 1 2 3 mg / kg AD11778 1089 SQ injection on day 1 3 3 mg / kg AD12363 305 SQ injection on day 1 4 3 mg / kg AD12369 1817 SQ injection on day 1 Prior to each SQ injection, the test animals were sedated. Sedation was achieved using ketamine HCl (10 mg / kg) administered intramuscularly (IM) (none injected into the quadriceps femoris muscle). Individual doses of the MARC1RNAi agent were calculated based on body weight recorded on each dosing day.

[0287] For each animal, liver biopsy samples (approximately 200 mg (160–240 mg; ±10%)) were collected for exploratory gene knockdown analysis.

[0288] Serum samples were collected on days -7, 1, 15, 29, and 43 prior to liver biopsy sample collection or dose administration (where applicable), and from any animal found to be in a dying state or euthanized at unplanned intervals.

[0289] cyno MARC1 expression was determined using qPCR, with cyno ARL1 as a control. The mean MARC1 expression in liver tissue for each animal was normalized relative to the day-7 sample level for each individual animal. The mean relative expression for each group was then calculated from the individual normalized values. Data from the experiments are shown in Table 37 below.

[0290] Table 37. Normalized to untreated mean MARC1 of cynomolgus monkeys in Example 18. By day 15 and day 43 after administration, groups 1–4 showed a reduction in MARC1.

[0291] MARC1 protein levels were quantified by planned LC-MS / MS assays. For this purpose, cynomolgus monkey liver samples were homogenized using RIPA lysis and extraction buffer (Thermo Scientific). Proteins were extracted using a magnetic bead protocol and digested with trypsin for 20 hours in the presence of internal standards. Peptide quantification was performed using LC-MS / MS, and the area under the curve (AUC) for two MARC1-specific peptides (sequences listed below), the corresponding internal standards, and the SLC25A3-specific peptide was quantified. SLC25A3 is a phosphate carrier protein selected as the normalized protein due to its juxtaposition with MARC1 protein in the mitochondrial membrane. The SLC25A3-normalized MARC1 protein concentrations in the livers of cynomolgus monkeys are shown in Table 38 below.

[0292] Table 38. MARC1 protein levels in the liver of cynomolgus monkeys in Example 18, relative to pre-drug administration and SLC25A3 expression. Group 4 (3 mg / kg AD12369) showed a time-dependent >50% knockdown of MARC1 protein.

[0293] Example 19. In vivo administration of MARC1 RNAi agent to cynomolgus monkeys. MARC1 inhibition of the MARC1 RNAi agent was tested in cynomolgus monkeys. On days 1 and 29, four groups of male (non-juvenile) cynomolgus monkeys (n=3 per group) were administered the RNAi agent, prepared in saline (at 3 mg / kg), via subcutaneous (SQ) injection at a volume of 0.3 mL / kg body weight. The dosing regimen was as shown in Table 39 below.

[0294] Table 39. Dosage in mice of Example 19 Group Dosage (RNAi agent) route of administration Dose Volume Number of animals (n =) 1 3.0 mg / kg AD12976 SQ injections on days 1 and 29 0.3 ml / kg n = 3 2 3.0 mg / kg AD13805 SQ injections on days 1 and 29 0.3 ml / kg n = 3 3 3.0 mg / kg AD13445 SQ injections on days 1 and 29 0.3 ml / kg n = 3 4 3.0 mg / kg AD13925 SQ injections on days 1 and 29 0.3 ml / kg n = 3 The test animals were weighed and administered the drug subcutaneously (SQ) via syringe and needle to the mid-scapular region on days 1 and 29.

[0295] Liver biopsies were collected on days -7 (before administration), 15, 29, and 43. Liver biopsies were collected with a sedation procedure. Animals were fasted overnight (at least 12 hours but less than 18 hours) prior to each liver biopsy. For each animal, a liver biopsy sample (~40 mg, 30–60 mg, ±10%) was collected for gene knockdown analysis. For group 2 animals only, an additional liver biopsy (~40 mg, 30–60 mg; ±10%) was collected on day 15. If applicable, liver biopsies were also collected from any animals found to be in a dying state or euthanized unplanned internally.

[0296] Blood should be collected on days -7 (before administration), 1, 15, 29, and 43, prior to liver biopsy sample collection or RNAi dose administration (where applicable). If applicable, blood should also be collected from any animal found to be in a dying state or unplanned internal euthanasia. Animals should be fasted overnight (at least 12 hours but less than 24 hours) for planned collections. The fasting duration should be consistent between collections (+ / - 1 hour). Animals should not be fasted for unplanned collections. The femoral vein is the primary collection site; the saphenous vein is an alternative site.

[0297] Sedation was achieved using ketamine HCl (10 mg / kg) administered intramuscularly (IM) (none was injected into the quadriceps femoris muscle).

[0298] cMARC1 expression was determined using qPCR, with cyno ARL1 serving as an endogenous control. The mean MARC1 expression in the liver tissue of each animal was normalized relative to the day-7 sample level of each individual test animal. The mean relative expression for each group was then calculated from the individual normalized values. Data from the experiments are shown in Table 40 below.

[0299] Table 40. Normalized to untreated mean MARC1 of cynomolgus monkeys in Example 19. By day 15 and day 43 after administration, groups 1–4 showed a reduction in MARC1.

[0300] MARC1 protein levels were quantified by planned LC-MS / MS assays. For this purpose, cynomolgus monkey liver samples were homogenized using RIPA lysis and extraction buffer (Thermo Scientific). Proteins were extracted using a magnetic bead protocol and digested with trypsin for 20 hours in the presence of internal standards. Peptide quantification was performed using LC-MS / MS, and the area under the curve (AUC) of response for two MARC1-specific peptides (sequences listed below), the corresponding internal standards, and the SLC25A3-specific peptide was quantified. SLC25A3 is a phosphate carrier protein selected as the normalized protein due to its juxtaposition with MARC1 protein in the mitochondrial membrane. The SLC25A3-normalized MARC1 protein concentrations in the livers of cynomolgus monkeys are shown in Tables 41 and 42 below. Tables 41 and 42 show the MARC1 protein levels quantified by their corresponding peptide sequences as determined by LC-MS / MS.

[0301] Table 41. MARC1 protein levels in cynomolgus monkey livers of Example 19 relative to pre-drug administration and SLC25A3 expression (quantified using peptide sequence: DLLLPIK). The MARC1 RNAi agent showed MARC1 protein inhibition for at least 43 days after administration. Groups 1, 2, and 4 showed MARC1 reductions at all time points, while group 3 showed negligible reductions at all time points. More specifically, after a dose of 2 x 3.0 mg / kg, AD13805 achieved approximately 71% inhibition of MARC1 (0.281) on day 43.

[0302] Table 42. MARC1 protein levels in cynomolgus livers of Example 19 relative to pre-drug administration and SLC25A3 expression (quantified using peptide sequence: SPLFGQYFVLENPGTIK). The MARC1 RNAi agent showed MARC1 protein inhibition for at least 43 days after administration. Groups 1, 2, and 4 showed MARC1 reductions at all time points, while group 3 showed a less significant reduction at all time points (the reduction on day 15 was negligible). More specifically, after a dose of 2 x 3.0 mg / kg, AD13805 achieved approximately 75% inhibition of MARC1 (0.245) on day 43.

[0303] Other implementation plans It should be understood that although the invention has been described in conjunction with its specific embodiments, the foregoing description is intended to illustrate, and not limit, the scope of the invention as defined by the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

1. An RNAi agent for inhibiting MARC1 gene expression, comprising: Antisense strand, comprising a nucleotide sequence of at least 15 consecutive nucleotides differing by 0 or 1 nucleotide from any of the antisense strand sequences in Tables 2, 3, or 6D; and The sense strand contains a nucleotide sequence that is at least partially complementary to the antisense strand.

2. The RNAi agent according to claim 1, wherein the antisense strand comprises nucleotides 2-18 of any of the sequences provided in Table 2, Table 3 or Table 6D.

3. The RNAi agent according to claim 1 or claim 2, wherein the sense strand comprises a nucleotide sequence of at least 15 consecutive nucleotides differing by 0 or 1 nucleotide from any of the sense strand sequences in Tables 2, 4, 5 or 6D, and wherein the sense strand has a region that is at least 85% complementary to the antisense strand on at least 15 consecutive nucleotides.

4. The RNAi agent according to any one of claims 1-3, wherein at least one nucleotide of the RNAi agent comprises a modified internucleotide linker.

5. The RNAi agent according to any one of claims 1-4, wherein all or substantially all nucleotides are modified nucleotides.

6. The RNAi agent according to any one of claims 4-5, wherein the modified nucleotide is independently selected from: 2'-O-methyl nucleotide, 2'-fluoronucleotide, 2'-deoxynucleotide, 2',3'-open-ring nucleotide mimic, locked nucleotide, 2'-F-arabinonucleotide, 2'-methoxyethyl nucleotide, debased nucleotide, ribitol, reverse nucleotide, reverse 2'-O-methyl nucleotide, reverse 2'-deoxynucleotide, 2'-amino modified nucleotide, 2'-alkyl modified nucleotide, morpholinonucleotide, vinylphosphonate-containing nucleotide, cyclopropylphosphonate-containing nucleotide, and 3'-O-methyl nucleotide.

7. The RNAi agent according to claim 5, wherein all or substantially all modified nucleotides are 2'-O-methylnucleotides, 2'-fluoronucleotides, or combinations thereof.

8. The RNAi agent according to any one of claims 1-7, wherein the antisense strand consists of or is substantially composed of any of the nucleotide sequences of the modified antisense strand sequences in Table 3 or Table 6D.

9. The RNAi agent according to any one of claims 1-8, wherein the sense strand consists of, is substantially composed of, or contains any modified sense strand sequence from Table 4, Table 5, or Table 6D.

10. The RNAi agent according to claim 1, wherein the antisense strand comprises a nucleotide sequence of any one of the modified sequences in Table 3, and the sense strand comprises a nucleotide sequence of any one of the modified sequences in Table 4, Table 5, or Table 6D.

11. The RNAi agent according to any one of claims 1-10, wherein the length of the sense strand is between 18 and 30 nucleotides, and the length of the antisense strand is between 18 and 30 nucleotides.

12. The RNAi agent according to claim 11, wherein the length of the sense strand and the antisense strand is each between 18 and 27 nucleotides.

13. The RNAi agent according to claim 12, wherein the length of the sense strand and the antisense strand is each between 18 and 24 nucleotides.

14. The RNAi agent according to claim 13, wherein the sense strand and the antisense strand are each 21 nucleotides in length.

15. The RNAi agent according to claim 14, wherein the RNAi agent has two blunt ends.

16. The RNAi agent according to any one of claims 1-15, wherein the sense strand comprises one or two end caps.

17. The RNAi agent according to any one of claims 1-16, wherein the sense strand comprises one or two reverse debasement residues.

18. The RNAi agent of claim 1, wherein the RNAi agent comprises a sense strand and an antisense strand forming a duplex having any one of the duplexes in Tables 6A and 6B.

19. The RNAi agent according to claim 18, wherein all or substantially all nucleotides are modified nucleotides.

20. The RNAi agent of claim 1, comprising, substantially comprising, or containing an antisense strand consisting of, substantially comprising, or including one of the following nucleotide sequences (5'→ 3'): UGAAAGAACUAUUCCAUAUC (SEQ ID NO: 1608); ACAGAAUCCUGUCUUGUCGUU (SEQ ID NO: 1657); UCCUUUAAAGGUUUUCAGUAG (SEQ ID NO: 1580); or UAUUGAAGCAUUGAGACACCG (SEQ ID NO: 1659).

21. The RNAi agent according to any one of claims 1-20, wherein the nucleotides of the antisense strand located at positions 2 and 14 from the 5' end are 2'-fluorinated nucleotides.

22. The RNAi agent according to claim 21, wherein the nucleotide at position 2 of the antisense strand is 2'-fluorouridine and the nucleotide at position 14 of the antisense strand is 2'-fluorocytidine, and wherein the antisense strand comprises 3 or 4 thiophosphate nucleotide links.

23. The RNAi agent according to any one of claims 1-22, wherein the sense strand consists of, is substantially composed of, or contains one of the following nucleotide sequences (5'→ 3') differing by 0 or 1 nucleotide: GAUUAUGGAAUAGUUCUUUCA (SEQ ID NO: 1734); AACGACAAGACAGGAUUCUGU (SEQ ID NO: 1783); CUACUGAAAACCUUUAAAIGA (SEQ ID NO: 1774); or CGGUGUCUCAAUGCUUCAAUA (SEQ ID NO: 1784).

24. The RNAi agent according to any one of claims 20-23, wherein all or substantially all nucleotides are modified nucleotides.

25. The RNAi agent according to claim 1, comprising a modified nucleotide sequence differing from one of the following nucleotide sequences (5'→ 3') by 0 or 1 nucleotide, an antisense strand consisting of or substantially consisting of the following: cPrpusGfaaaGfaacuaUfuCfcAfuaausc (SEQ ID NO: 1143); asCfagAfauccugUfcUfuGfucgusu (SEQ ID NO: 1228); isCfagAfauccugUfcUfuGfucgusu (SEQ ID NO: 1229) cPrpusCfscsUfuUfaaaggUfuUfuCfaGfuasg (SEQ ID NO: 1200); or usAfsusugaAfgcauUfgAfgAfcaccsg (SEQ ID NO: 1235), Where a represents 2'-O-methyladenosine, c represents 2'-O-methylcytidine, g represents 2'-O-methylguanosine, i represents 2'-O-methylinosine; and u represents 2'-O-methyluridine; Af represents 2'-fluoroadenosine, Cf represents 2'-fluorocytidine, Gf represents 2'-fluoroguanosine, and Uf represents 2'-fluorouridine; cPrpu represents 5'-cyclopropylphosphonic acid-2'-O-methyluridine; s represents a thiophosphate linker; and all or substantially all nucleotides on the sense strand are modified nucleotides.

26. The RNAi agent of claim 1, wherein the sense strand comprises, consists of, or is substantially composed of a modified nucleotide sequence differing from, one of the following nucleotide sequences (5'→ 3') by 0 or 1 nucleotide: see uuauggAfAfUfaguucuuuca (SEQ ID NO: 1319); aacgacaaGfAfCfaggauucugu (SEQ ID NO: 1376); cuacugaaAfAfCfcuuuaaaiga (SEQ ID NO: 1361); or cggugucuCfAfAfugcuucaaua (SEQ ID NO: 1377), Where a represents 2'-O-methyladenosine, c represents 2'-O-methylcytidine, g represents 2'-O-methylguanosine, u represents 2'-O-methyluridine, and i represents 2'-O-methylinosine; Af represents 2'-fluoroadenosine, Cf represents 2'-fluorocytidine, Gf represents 2'-fluoroguanosine, and Uf represents 2'-fluorouridine; s represents a phosphate thioester linker; and all or substantially all nucleotides on the antisense strand are modified nucleotides.

27. The RNAi agent according to any one of claims 20-26, wherein the sense strand further comprises a reverse debasement residue at the 3' end, the 5' end, or both of the nucleotide sequence.

28. The RNAi agent according to any one of claims 1-27, wherein the RNAi agent is linked to a targeting ligand.

29. The RNAi agent according to any one of claims 1-28, wherein the sense strand comprises: ,or 。 30. The RNAi agent according to any one of claims 1-29, wherein the targeting ligand is linked to the sense strand.

31. The RNAi agent of claim 30, wherein the targeting ligand is attached to the 5' end of the sense strand.

32. A composition comprising an RNAi agent according to any one of claims 1-31, wherein the composition further comprises a pharmaceutically acceptable excipient.

33. The composition according to claim 32, further comprising a second RNAi agent capable of inhibiting MARC1 gene expression.

34. The composition according to any one of claims 32-33, further comprising one or more additional therapeutic agents.

35. The composition according to any one of claims 32-34, wherein the composition is formulated for administration.

36. The composition of claim 35, wherein the composition is delivered by subcutaneous injection.

37. The composition according to any one of claims 32-36, wherein the pharmaceutically acceptable excipient is sodium phosphate buffer.

38. The composition according to any one of claims 32-36, wherein the pharmaceutically acceptable excipient is isotonic saline or water for injection.

39. A method for inhibiting the expression of the MARC1 gene in hepatocytes, the method comprising introducing an effective amount of the RNAi agent according to any one of claims 1-31 or the composition according to any one of claims 32-38 into the cells of a subject.

40. The method of claim 39, wherein the subject is a human subject.

41. The method according to any one of claims 39-40, wherein the MARC1 mRNA level in the hepatocytes or in the subject is reduced by at least about 50%.

42. The method according to any one of claims 39-41, wherein the MARC1 protein level in the hepatocytes or in the subject is reduced by at least about 50%.

43. A method for treating MARC1-related diseases, disorders, or symptoms, the method comprising administering a therapeutically effective amount of the composition according to any one of claims 32-38 to a human subject in need of it.

44. The method of claim 43, wherein the disease is non-alcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD), alcoholic fatty liver disease, autoimmune hepatitis, liver fibrosis, cirrhosis, elevated blood cholesterol levels, hypertriglyceridemia, liver disease and / or other MARC1-related diseases.

45. The method according to any one of claims 39-44, wherein the serum MARC1 protein level in the subject is reduced.

46. ​​The method according to any one of claims 39-45, wherein the RNAi agent is administered to a human subject at a dose of about 0.05 mg / kg to about 5.0 mg / kg of human subject body weight.

47. Use of the RNAi agent according to any one of claims 1-31 or the composition according to any one of claims 32-38 for the treatment of diseases, disorders or symptoms mediated at least in part by reduced MARC1 gene expression.

48. The use according to claim 47, wherein the disease is non-alcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD), alcoholic fatty liver disease, autoimmune hepatitis, liver fibrosis, cirrhosis, elevated blood cholesterol levels, hypertriglyceridemia, liver disease and / or other MARC1-related diseases.

49. Use of the RNAi agent according to any one of claims 1-31 or the composition according to any one of claims 32-38 for the preparation of a pharmaceutical composition for treating at least partially mediated diseases, disorders or symptoms caused by reduced MARC1 gene expression.

50. The use according to any one of claims 47-49, wherein the RNAi agent is administered to a human subject at a dose of about 0.05 mg / kg to about 5.0 mg / kg of human subject body weight.

Images