Orthogonal cleavage ligation sequencing (OCLS)

Abstract

The disclosure relates to methods and systems related to spatial encoding / decoding of features. The provided orthogonal cleavage ligation sequencing (OCLS) system encodes two or more orthogonal recognition sites for a restriction enzyme, such as an IIS-type enzyme, to decode a visual barcode. The decoding employs specific orthogonal ligation of differentially tagged probes, which enables visual discrimination of barcodes at each feature. The process can be cyclically repeated and carried out in parallel.

Description

[0001] Cross-references to related applications

[0002] This application claims priority and interest in the earlier application filed on March 28, 2023, U.S. Provisional Application No. 63 / 492,777, which is incorporated herein by reference in its entirety.

[0003] By referencing and incorporating into the sequence list

[0004] A computer-readable text file of size 28,237 bytes, titled “O046-0082PCT.xml”, created on or around March 26, 2024, contains the sequence list of this application and is hereby incorporated herein by reference in its entirety. Technical Field

[0005] This disclosure generally relates to molecular barcodes, such as visual barcodes, and related methods and systems. More specifically, it relates to marking compositions, methods, and workflows that overcome the limitations of previously described visual barcode encoding. Background Technology

[0006] Determining the identity and / or location of target molecules (such as proteins or nucleic acids) within a sample can be crucial for clinical applications, diagnostics, and biomedical research. In situ hybridization (ISH), immunohistochemistry, laser capture microdissection, and similar techniques enable visualization of the location of target molecules within samples, such as biological samples.

[0007] The identity of target molecules can also be determined using methods that label target molecules and track them through amplification and / or sequencing processes (such as random barcode encoding). However, ongoing efforts are underway to develop new tools for improving spatial tracking and applying them to single-cell and space biology. Therefore, methods and systems are needed to reliably correlate the identity of target molecules with their location within samples (such as essentially two-dimensional (2D) biological samples).

[0008] Next-generation sequencing (NGS) technology can be used to determine the sequence of barcode-encoded beads coated with nucleic acids. However, conventional NGS sequencing requires expensive reagents to accurately determine the DNA sequence, including reversibly terminated and / or labeled nucleotides; elevated temperatures (typically 65°C) are required during decoding; multiple different reagents are introduced during each decoding cycle, and these reagents do not function properly when mixed (e.g., the cleavage solution cannot be mixed with the incorporation solution), requiring complex flow control; and NGS cycle times are significantly longer than 5 minutes each time. To read the large surface area of ​​1 µm beads by NGS, for example, the 1.75 cm x 1.75 cm surface of a stack of 1 µm beads, the length of the NGS localization barcode should exceed 24 bp to achieve at least 200T of diversity of different beads (potential localization barcode combinations) in the library, thereby reducing the probability of barcode redundancy within a large surface area, where approximately 10 billion (10B) individual 1 µm beads would exist. This makes it necessary to use far more than six decoding loops.

[0009] There is still an urgent need in the field to develop alternative methods for visually barcoding targets, including visually barcoding targets in biomolecular analysis. Summary of the Invention

[0010] This document discloses methods and systems for visual barcode encoding involving orthogonal cut-ligation sequencing (OCLS), as well as various components (including double-stranded DNA oligonucleotides and hairpin loop structure single-stranded oligonucleotides) for such methods and systems. Representative barcodes used in embodiments of OCLS as described herein are made from dsDNA. The visually decoded barcodes used in the OCLS workflow are constructed through multiple rounds of splitting and merging (similar to the barcodes described in WO2022 / 187719), but the segments constituting the OCLS barcode are not labeled. However, similar to the OCS method in WO2022 / 187719, each segment of the OCLS library is bound to a bead (or another solid vector) or linked to a previous segment to construct a strand, and these segments can be co-encoded with NGS-captured oligonucleotide (CO) barcodes.

[0011] This disclosure further provides methods for encoding and decoding (sequencing) visual barcodes.

[0012] A method involving orthogonal cut ligation sequencing (OCLS) of visual barcodes can be implemented to overcome problems associated with identifier chain decoding by other sequencing methods, such as orthogonal cut sequencing (OCS). This OCLS method is disclosed herein, including in Figures 1-6. Although the OCS identifier chain can be composed of polymers other than nucleic acids used for alternating decoding (such as peptide linkers using orthogonal proteases or chemical linkers using orthogonal chemical cleavage agents), the barcodes used for the OCLS described herein must contain double-stranded or partially double-stranded DNA (dsDNA). Briefly, the visually decoded barcodes used in the OCLS workflow are also constructed through multiple rounds of splitting and merging, but the segments constituting the OCLS barcodes are not labeled (because they have OCS identifiers). Each segment of the OCLS library is linked to the previous segment to build the chain, and these segments can be co-encoded together with NGS capture barcodes.

[0013] Similar to the splitting and merging procedure outlined in WO 2022 / 187719, an OCLS bead library can be constructed using 100 or more different wells in each round through several rounds of splitting and merging. For decoding, this method involves using at least one, but preferably two or more, orthogonal REs in a single reaction mixture, such as IIS-type enzymes (examples of which are discussed and illustrated herein). This step is followed by specific orthogonal ligation of differentially labeled probes, which enables visual differentiation of the barcode at each feature. This process is repeated in multiple cycles as described herein (including in the accompanying figures).

[0014] This document provides embodiments of visual barcodes comprising: at least two or more double-stranded DNA (dsDNA) oligonucleotide segments (cassettes) functionally linearly linked together, and each dsDNA oligonucleotide segment including within its sequence: a recognition site (RS) for a specific restriction endonuclease (RE), a designed cleavage site (CS), or both RS and CS; and an untethered end located at one end of the visual barcode. Optionally, the visual barcode is tethered to a solid substrate by a flexible adapter attached to or near an end of the dsDNA of the visual barcode, which is not the untethered end. The provided visual barcode embodiments do not include visually detectable markers. This is because visually detectable markers are provided by probes used in conjunction with the barcode, as described herein.

[0015] In various visual barcode embodiments, the RE is an IIS-type restriction endonuclease, and the CS does not overlap with the corresponding RS. Optionally, in a given visual barcode embodiment, at least one dsDNA segment includes a designed CS, and the visual barcode includes an RS specific to an IIS-type RE, the RS being appropriately positioned such that a homologous IIS-type RE can cleave the designed CS based on its positioning relative to the RS.

[0016] An array of visual barcodes is also provided, wherein the array comprises multiple visual barcodes, each of which includes a different set of dsDNA segments having different recognition sites (RS), designed cleavage sites (CS), or both, for specific restriction endonucleases (REs). In an example of the array of visual barcodes, at least two visual barcodes from the different visual barcodes are tethered to the same solid substrate.

[0017] Another embodiment is an orthogonal cut ligation sequencing (OCLS) barcode comprising two or more dsDNA segments (cassettes), each dsDNA segment containing a recognition site (RS) for a specific restriction endonuclease (RE) and one or more overlapping regions configured to allow ligation with flanking dsDNA segments to form a strand of the segment, the strand of which constitutes the OCLS barcode.

[0018] Another embodiment is a visually detectable orthogonal linker probe comprising: a complete or partial double-stranded DNA oligonucleotide having a 3' or 5' overhang of at least two nucleotides, the sequence of which includes: a recognition site (RS) for a specific restriction endonuclease (RE), a designed cleavage site (CS), or both RS and CS; and a visually detectable tag covalently linked to the complete or partial dsDNA oligonucleotide (the visually detectable tag may optionally be linked to the oligonucleotide via a flexible adapter). In an example of the visually detectable orthogonal linker probe embodiment, the complete or partial double-stranded DNA oligonucleotide comprises: a linear double-stranded DNA oligonucleotide having a 5' overhang; a linear double-stranded DNA oligonucleotide having a 3' overhang; a single-stranded DNA oligonucleotide with a hairpin stem-loop configuration having a 5' overhang; or a single-stranded DNA oligonucleotide with a hairpin stem-loop configuration having a 3' overhang.

[0019] In another example of the provided visually detectable orthogonal connection probe, the visually detectable label includes one or more of the following: fluorescent label, bioluminescent label, chemiluminescent label, chromophore, quantum dot, Raman label, biotin moiety, or radioactive isotope.

[0020] Optionally, the RE in the visually detectable orthogonal linker probe is an IIS-type restriction endonuclease, and the RS is specific to the IIS-type RE. As a further example, the visually detectable orthogonal linker probe may include an RS specific to IIS-type REs, which is appropriately positioned so that homologous IIS-type REs can cleave the designed CS based on their positioning relative to the RS.

[0021] Another embodiment is a set of visually detectable orthogonal linkers as provided in any of the probe embodiments, wherein the set comprises a plurality of visually detectable orthogonal linkers, each of the plurality of visually detectable orthogonal linkers including either a different recognition site (RS) or a different RS and a different cleavage site (CS) for a specific restriction endonuclease (RE). Optionally, at least two of the different detectable orthogonal linkers in such a set include visually distinguishable detectable markers.

[0022] A set of visually detectable orthogonally connected probes is also envisioned, comprising multiple distinct probes, each configured such that a cut performed on the probe with the RE produces a protrusion whose sequence differs from the sequences of at least 5, 7, 10, 12, 15, or more than 15 other probes in the set. These unique sets of probes (within the set) can be used to “read out” results based on the detection of distinct visual signals, which depend on the specific sequence complementarity between the probe and the visual barcode to which it is bound via its corresponding protrusion.

[0023] Another embodiment is an orthogonal cleavage ligation sequencing (OCLS) oligonucleotide pair comprising: a visual barcode comprising: at least two or more double-stranded DNA (dsDNA) oligonucleotide segments (cassettes) functionally linearly linked to each other, and each dsDNA oligonucleotide segment including within its sequence: a recognition site (RS) for a specific restriction endonuclease (RE), a designed cleavage site (CS), or both RS and CS; and an untethered end located at one end of the visual barcode; and a visually detectable orthogonal ligation probe comprising: a complete or partial double-stranded DNA oligonucleotide, the complete or partial The double-stranded DNA oligonucleotide has a 3' or 5' protrusion of at least two nucleotides, the sequence of which includes: a recognition site (RS) for a specific restriction endonuclease (RE), or both RS and cleavage site (CS); and a visually detectable tag covalently linked to the complete or partial dsDNA oligonucleotide; wherein cleavage of the RS or CS in the visual barcode produces a single-stranded "sticky end" protrusion having a sequence completely complementary to the sticky end (protrusion) produced by cleavage of the RS in the visually detectable orthogonal linker probe.

[0024] Multiple sets of OCLS oligonucleotide pairs are also provided, wherein each pair of visual barcodes and visually detectable orthogonal linking probes has different fully complementary sequence overlaps, and each visually detectable orthogonal linking probe includes different visually distinguishable detectable markers.

[0025] Another embodiment is a method for encoding a visual barcode, the method comprising: contacting a double-stranded DNA (dsDNA) oligonucleotide tethered at a first end to a solid carrier with a first dsDNA segment, the dsDNA oligonucleotide having a single-stranded overhang at a second untethered end, the first dsDNA segment having a first overhang and a second overhang compatible with binding to the single-stranded overhang of the tethered dsDNA oligonucleotide, and including within the sequence of the first dsDNA segment: a recognition site (RS) for a specific restriction endonuclease (RE), a designed cleavage site (CS), or both RS and CS; the contact occurring under conditions sufficient to allow specific hybridization of the single-stranded overhang of the first dsDNA segment with the single-stranded overhang of the tethered dsDNA oligonucleotide; and ligating the first dsDNA segment to the tethered dsDNA oligonucleotide to form a first captured barcode segment, the first captured barcode segment including... The second protrusion of the first dsDNA segment; contacting the first captured barcode segment with the second dsDNA segment, the second dsDNA segment having a first protrusion and a second protrusion compatible with binding to the single-stranded protrusion of the oligonucleotide of the first captured barcode segment, and including within the sequence of the second dsDNA segment: an RS for a specific RE different from the RS / RE in the first dsDNA segment, a CS designed different from the designed CS in the first dsDNA segment, or both; and linking the second dsDNA segment to the first captured barcode segment to form a second captured barcode segment, the second captured barcode segment including the second protrusion of the second dsDNA segment, the first captured barcode segment and the second captured barcode segment constituting the visual barcode.

[0026] In an example of the method for encoding a visual barcode embodiment, the method further includes repeating the contact and connection steps one or more additional times, each time connecting an additional dsDNA segment to the captured barcode segment to form the visual barcode. Optionally, in any method of encoding a visual barcode embodiment, at least one dsDNA segment includes a designed CS, and the visual barcode includes an RS specific to IIS-type REs, the RS being appropriately positioned so that homologous REs can cleave the designed CS based on their positioning relative to the RS.

[0027] Examples of methods for encoding visual barcodes are also envisioned, where the visual barcodes are constructed using unlabeled DNA segments through multiple rounds of splitting and merging. For example, one or more rounds of splitting and merging include: attaching a barcode box to a bead at a time; splitting the resulting bead into individual compartments, optionally into floor holes; attaching different first compartment-specific barcode boxes to the bead in each individual compartment to obtain a set of beads containing two different pairs of barcode boxes; washing the bead containing the two barcode boxes; merging the bead containing the two barcode boxes; splitting the merged bead containing the two barcode boxes into individual compartments, optionally into floor holes; and repeating the attaching, washing, merging, and splitting steps to increase the diversity of the set of barcodes.

[0028] In any method of encoding a visual barcode embodiment, optionally, the visual barcode comprises a continuous strand of dsDNA segments (cassettes), or the visual barcode comprises at least two separate cassettes directly and individually connected to the solid carrier.

[0029] In any method of encoding visual barcode embodiments, optionally, the segment (box) is co-encoded together with the next-generation sequencing (NGS) captured barcode.

[0030] Visual barcodes prepared by any of the methods provided are also covered in this disclosure.

[0031] Another embodiment is a method for decoding a visual barcode, the method comprising: in a certain environment, causing an orthogonal cut ligation sequencing (OCLS) barcode comprising at least one restriction site (RS) of at least one double-stranded DNA (dsDNA) to be coupled with a restriction endonuclease (RE) that recognizes the RS at a point sufficient to cause the RE to cleave the dsDNA. Under OCLS barcode conditions, RS / RE cleavage produces single-stranded protrusions, thereby generating a partial single-stranded (ss) DNA-partial dsDNA OCLS barcode; if the sequence of the protrusion of at least one orthogonal linker probe, including a dsDNA oligonucleotide with a protrusion at a first end and a visually detectable marker, is the reverse complementary sequence of the protrusion sequence of the partial ss DNA-partial dsDNA OCLS barcode, then the partial ss DNA-partial dsDNA OCLS barcode is contacted with the orthogonal linker probe under conditions sufficient to allow the protrusion of the orthogonal linker probe to bind to the protrusion on the partial ss DNA-partial dsDNA OCLS barcode via base pair-mediated hydrogen bonding; if base pair-mediated binding occurs, the orthogonal linker probe is ligated to the partial single-stranded (ss) DNA-partial dsDNA OCLS barcode to generate a captured probe; and the presence, absence, and / or amount of the captured probe is detected by imaging the visually detectable marker.

[0032] Optionally, in this method embodiment, the method may further include repeating the contact / cleavage, contact / base pair-mediated binding, ligation, and detection steps one or more times, wherein each additional cycle involves cleavage of the dsDNA OCLS barcode at different cleavage sites (CS), base pair-mediated binding of different orthogonal ligation probes, and / or detection of the presence, absence, and / or quantity of probes captured by different tags.

[0033] In another example of the method for decoding visual barcode embodiments, one or more of the following are true: the dsDNA OCLS barcode is attached to a bead or other solid surface; multiple different dsDNA OCLS barcodes are attached to a single address on a single bead or another solid surface; the dsDNA OCLS barcode includes more than one non-overlapping RS; at least one RS of the dsDNA OCLS barcode is identified by an IIS-type RE and is cut at a predetermined location outside the RS; at least one RS of the dsDNA OCLS barcode is identified by an RE that cuts within the RS; or the visually detectable marker includes at least one of fluorescent markers, bioluminescent markers, chemiluminescent markers, chromophores, quantum dots, Raman markers, or radioactive isotopes.

[0034] In an example of a method for decoding a visual barcode, the orthogonal ligation probe comprises a single-stranded DNA oligonucleotide having a stem-loop hairpin structure, wherein the protrusion is located at the end of the hairpin's stem. Optionally, for example, after ligation, the method may further include contacting the environment including the captured probe with a 5'-exonuclease.

[0035] Examples of methods for decoding visual barcodes are also provided, the methods comprising one or more of the following: sequentially contacting the at least one dsDNA OCLS barcode with two or more REs that each recognizes a different non-overlapping RS within the dsDNA OCLS under conditions sufficient to cause each RE to cleave the dsDNA OCLS barcode, each RS / RE cleavage producing a single-stranded overhang, thereby producing a partially single-stranded (ss) DNA-partially dsDNA OCLS barcode; the ligation comprising a chemical ligation; or the ligation comprising an enzyme-mediated ligation.

[0036] Examples of methods for decoding visual barcodes are also provided, the methods comprising contacting two or more dsDNA OCLS barcodes, each comprising at least one RS, with a RE recognizing the RS under conditions sufficient to cause the RE to cleave the dsDNA OCLS barcode, the RS / RE cleavage producing single-stranded overhangs, thereby producing a partially single-stranded (ss) DNA-partially dsDNA OCLS barcode, wherein the RS / RE is different for each dsDNA OCLS barcode. For example, such methods may include contacting the two or more dsDNA OCLS barcodes with two or more orthogonal REs. Optionally, the contact with the two or more orthogonal REs is simultaneous or sequential.

[0037] In examples of methods for decoding visual barcodes, the following scenario is envisioned: after contact with one or more orthogonal REs, probes labeled with differences are connected using specific orthogonal reactions. For example, and further, the specific orthogonal connection of the probes labeled with differences enables visual differentiation of the barcode at each feature in the visual barcode array.

[0038] A method is also provided in which linking the orthogonal linking probe to the OCLS barcode of the partial ssDNA-partial dsDNA adds a new RS to the resulting captured probe.

[0039] It also provides a method for decoding visual barcodes using orthogonal cut ligation sequencing (OCLS), which is generally as described in this paper.

[0040] Another embodiment is an improved system for molecular barcode encoding to identify individual features, the system comprising a cycle of repeating labeling, orthogonal cutting, ligation, and imaging, wherein the orthogonal cutting comprises cutting the double-stranded DNA barcode with an IIS-type restriction endonuclease. In an example of this system embodiment, two or more labels and orthogonal probe ligation identification cycles occur consecutively or simultaneously.

[0041] Kits are also provided for performing one or more of the described methods, comprising kits including one or more visual barcodes described herein (optionally attached to beads or other solid carriers), one or more visually detectable orthogonal connection probes described herein, and other components optionally available for performing methods of encoding or decoding OCLS barcodes. Attached Figure Description

[0042] Figure 1A A method for creating (encoding) OCLS barcodes is illustrated, wherein each dsDNA segment used to construct the barcode contains a recognition site (RS) for a specific and distinct restriction endonuclease (RE) and one or more overlapping regions for linking to flanking dsDNA segments to form a chain. Three rounds of barcode encoding by linking different segments to form a barcode chain are shown. The illustrated embodiment utilizes a first dsDNA segment linked to beads or other solid carriers via a flexible adapter. The illustrated method is described in more detail herein.

[0043] Figure 1B A method for creating OCLS barcodes is illustrated, wherein each dsDNA segment used to construct the barcode contains a cassette and one or more overlapping regions for attaching to flanking dsDNA segments to form a chain. The cassette includes an RS (Receptor Scale), which is designed to be at a specific distance (number of bases) from the cleavage site (CS) when the RS is recognized by an IIS-type RE (the designed cassette places the RS at an appropriate distance from the CS for homologous IIS-type REs). Three rounds of barcode encoding by linking different segments to form a barcode chain are illustrated. When creating an OCLS barcode assembly containing cassettes with engineered CS designs, the RS is optionally included within the barcode chain. The illustrated embodiment reflects the first dsDNA segment being attached to beads or other solid carriers via flexible adapters. The illustrated method is described in more detail herein.

[0044] Figure 2Two different OCLS barcode types are illustrated. The barcode type shown on the left contains an RS for a RE, which cuts the OCLS barcode at a designed (engineered to exist) and corresponding RS. The barcode type shown on the right contains an RS for an IIS-type RE, which cuts at a specially designed CS, a predetermined distance from its RS (based on the RE used). The methods for encoding and decoding these OCLS barcodes are described in more detail below.

[0045] Figures 3A-3B An orthogonal connection probe that can be used in an OCLS decoding workflow is shown. Figure 3A The dsDNA probe shown on the left is formed by hybridization of the two complementary strands of ssDNA or by folding a single ssDNA strand to form a hairpin with a double-stranded stem, and is labeled. The label is shown as being attached to the probe via a flexible adapter. Probe embodiments include labeled dsDNA or are presented as shown in the image. Figure 3A and Figure 3B The image shows the hairpin structure of ssDNA beneath the dsDNA probe. Figure 3B The alternative embodiments shown provide probes containing encoded RS. The methods illustrated are described in more detail herein.

[0046] Figure 4A The diagram shows beads (or other solid carriers) with unlabeled barcodes attached to them, each barcode having a different RS (RS1, RS2, RS3); the barcodes were orthogonally cut with one or more restriction enzymes (REs), and the resulting products were imaged. Figure 4B The diagram shows the step-by-step identification of a barcode that has been orthogonally cut using an orthogonal connection probe with a first marker (identifier (ID) cycle 1). Figure 4C The second loop (ID loop 2) of an orthogonally connected probe using a second marker is shown. Figure 4D The diagram illustrates the third loop (ID loop 3) of an orthogonally connected probe that uses a third marker to progressively identify an orthogonally cut barcode. Figure 4E The option of using orthogonally connected probes with more than one tag in a single ID cycle to identify orthogonally cut barcodes is shown.

[0047] Figures 5A-5E An example of orthogonal cut ligation sequencing (OCLS) is shown, which reflects two different barcodes ( Figure 1B and Figure 2The right side depicts a type of barcode, each of the two different barcodes containing different RSs designed to be recognized by different IIS type REs and designed cleavage sites (CSs) spaced apart from the RSs by a precise number of bases, depending on the enzyme used. Figure 5A In this process, two different IIS-type REs are added to a single compatible reaction mixture to produce cleavage products 1 and 2 (also referred to as orthogonally cleaved products 1 and 2), which are removed in a subsequent washing step. Images are extracted after enzyme cleavage to establish a baseline signal prior to decoding via orthogonal connections with labeled probes. Figure 5B Two OCLS barcodes are shown (top: stem1 oligonucleotide, bottom: stem2 oligonucleotide), with arrows pointing to both the RS and the designed CS for each barcode oligonucleotide. For the first barcode oligonucleotide (top) containing RS1, the RS is located 10 bp upstream of the encoded CS. After recognition at the RS element, a cleavage by this enzyme (BsmFI) occurs at the designed CS element, located exactly 10 bp downstream of the RS, exposing the 5' overhang of the four-base design. Similarly, for the second barcode oligonucleotide (bottom) containing RS2, the RS is located 14 bp upstream of the encoded CS. After recognition at the RS element, a cleavage by this enzyme (BpuEI) occurs at the designed CS element, located exactly 14 bp downstream of the RS, exposing the 3' overhang of the two-base design. Figure 5C It shows Figure 3B The type of orthogonally labeled probe shown is ligated, whereby the probe contains additional RS encoded within its dsDNA region. Here, the encoded RS is specific for the same enzyme that cleaves the barcode in the previous cycle (but this is not required by the system). Figure 5CThe probes shown also each contain a unique (within the reaction) detectable marker, which corresponds to a specific protruding base on the probe designed to be identified (hybridized with) on the diced OCLS barcode (i.e., the marker indicates the specific protruding base). Therefore, the protrusions on the probe and the protrusions on the barcode match in terms of correct base complementarity, and based on this association, barcode-encoded features can be identified during imaging, as described elsewhere. After the first series of probes is attached, a washing step is performed, followed by an imaging step to determine which marker or combination of markers is present on each bead. As shown here (an example of a bead from a theoretical library of barcode-encoded beads), a single marker has been attached to the exposed sticky end of the first OCLS barcode (stem1) via a compatible adhesive end encoded within probe 1. Following the first imaging step, the second series of probes is attached in the same manner as the first series of probes, followed by an imaging step to determine which sticky ends are exposed after the second OCLS barcode (stem2) digestion. Figure 5D As shown, both the first series of connection probes (top) and the second series of connection probes (bottom) are... Figure 3B The type of orthogonally labeled probes shown contains additional RS encoded within their dsDNA regions. Because... Figure 5D The design shown in the diagram generates new CSs 10 bp or 14 bp away from OCLS barcode 1 (top) and OCLS barcode 2 (bottom), respectively. Here, in both cases, the encoded RS contained within the labeled ligation probe is specific to the same enzyme that cleaves the barcode in the previous cycle (however, this is illustrative and not essential). Figure 5E As shown, in subsequent cycles of enzymatic digestion with these two IIS type REs, the next designed sticky end (a 5' protruding extension of 4 bases in length) will be exposed on OCLS barcode 1, and the next designed sticky end (a 3' protruding extension of 2 bases in length) will be exposed on OCLS barcode 2. After a washing step to remove cleavage products 1 and 2, these two barcodes will then undergo orthogonal ligation in subsequent rounds, followed by an imaging step, and then ligation with a series of labeled probes specific to the sticky ends exposed by digestion with the second IIS type enzyme (BpuEI), the orthogonal ligation beginning with a series of labeled probes specific to the sticky ends exposed by digestion with the first IIS type enzyme (BsmFI). Figure 5E The probes shown in the image (probe 3 and probe 4) are... Figure 3BThe probes shown are of the type of orthogonally labeled probes, whereby these probes contain additional RS encoded within their dsDNA regions. The decoding cycle can continue until all the design decoding sites of the OCLS barcode are exposed and specifically detected, as described herein.

[0048] In short, Figure 5A and 5B Unmarked barcodes orthogonally cut using one or more IIS type REs: Step 1. Figure 5C and 5D Step 2: Barcodes identified by orthogonal linkages, orthogonally cut using one or more IIS-type REs. This allows stem oligonucleotides to be downregulated toward the beads in a "ratchet-like" manner over multiple cycles, each cycle including the following steps for decoding: cutting, linkage, and imaging. Figure 5E Cutting, (ligation, imaging) x 2: all subsequent cycles. Although illustrated with only two stem / RS pairs, this system can be operated (e.g., simultaneously) with several different stem / RS pairs. The two pairs shown have different protrusions after cutting (one protrusion leaves a 5' "sticky end" for specific ligation, and the other protrusion leaves a 3' "sticky end" for ligation). These protrusions also have different lengths. Therefore, with this combination, the method guarantees that there will be no incorrect ligation events (that is, there can be no cross-linking between the two stems and the ligating oligonucleotides). This figure illustrates an embodiment of the OCLS method involving multiplexing of (two) different "orthogonal" stem / RS pairs.

[0049] Figure 6 Examples of OCLS methods and workflows are shown, along with graphs illustrating the results obtained from the OCLS methods and workflows described in Example 1. Figure 3B The type of AF-488-labeled ssDNA hairpin probe shown (at the bottom) is an example. Labeled ssDNA hairpin probes contain encoded RS and are used for cutting... Figure 1B ( Figure 2 The type depicted on the right (within the diagram) involves orthogonally linking OCLS barcodes containing multiple encoded CSs. For Figure 6The experiment shown in the figure involved an imaging step performed in the 488 nm (emission) channel to determine the signal intensity of the beads after the initial OCLS barcode cleaving with IIS-type RE, i.e., BsmFI. After probe attachment and subsequent washing steps, the beads were imaged in the 488 nm channel to determine the signal obtained from the tag and thus to identify the exposed protrusions on the cleaved OCLS barcode. The same RS-encoded IIS-type RE (BsmFI) used in the initial cleaving reaction was also incorporated into the attached probe; therefore, this enzyme was added to the beads after subsequent washing to remove components from the previous reaction for a second digestion of the OCLS barcode. Following the second digestion and washing steps, an imaging step was performed in the 488 nm channel to determine the signal obtained from the beads. The signals obtained in all three imaging steps in the 488 nm channel are plotted on [the graph / image]. Figure 6 In the chart, the y-axis represents the relative fluorescence units (RFU).

[0050] References to sequence lists

[0051] The nucleic acid and / or amino acid sequences described herein are shown using standard letter abbreviations as defined in 37 CFR § 1.822. Only one strand of each nucleic acid sequence is shown, but complementary strands are understood to be included in the examples where appropriate. Representative oligonucleotides that can be used with the OCLS workflow are shown below. Symbol explanation: 5AmMC6 = 5' flexible 6-carbon linker carrying a reactive primary amine; 5Phos = 5' phosphorylation, which is added so that the oligonucleotide can be a substrate for T4 DNA ligase; iAmMC6T = thymine modified with an internal 6-carbon amine.

[0052] SEQ ID NO: 1 is TIIS stem1 (BsmFI)

[0053] / 5AmMC6 / TTTTTTATTATATTACGCTAATAGCATTATATCATGTTAACGCAATGTCCCATATCGCTA

[0054] SEQ ID NO: 2 is a complementary sequence of TIIS stem1.

[0055] TAGCGATATGGGACATTGCGTTAACATGATATAATGCTATTAGCGTAATATAAT

[0056] SEQ ID NO: 3 is TIIS s1hp1 (BsmFI)

[0057] / 5Phos / CATGCGTCCCGCGTCGGATACGTTT / iAmMC6T / TTTCGTATCCGACGCGGGACG

[0058] SEQ ID NO: 4 is TIIS s1hp2 (BsmFI)

[0059] / 5Phos / ATGCCGTCCCGCGTCGGATACGTTT / iAmMC6T / TTTCGTATCCGACGCGGGACG

[0060] SEQ ID NO: 5 is TIIS s1hp3 (BsmFI)

[0061] / 5Phos / GCGTCGTCCCGCGTCGGATACGTTT / iAmMC6T / TTTCGTATCCGACGCGGGACG

[0062] SEQ ID NO: 6 is TIIS s1p1 (BsmFI)

[0063] / 5AmMC6 / TTTCGTATCCGACGCGGGACG

[0064] SEQ ID NO: 7 is the complementary sequence of TIIS s1p1.

[0065] / 5Phos / CATGCGTCCCGCGTCGGATACGAAA

[0066] SEQ ID NO: 8 is TIIS s1p2 (BsmFI)

[0067] / 5AmMC6 / TTTCGTATCCGACGCGGGACG

[0068] SEQ ID NO: 9 is the complementary sequence of TIIS s1p2.

[0069] / 5Phos / ATGCCGTCCCGCGTCGGATACGAAA

[0070] SEQ ID NO: 10 is TIIS s1p3 (BsmFI)

[0071] / 5AmMC6 / TTTCGTATCCGACGCGGGACG

[0072] SEQ ID NO: 11 is the complementary sequence c of TIIS s1p3.

[0073] / 5Phos / GCGTCGTCCCGCGTCGGATACGAAA

[0074] SEQ ID NO: 12 is TIIS stem2 (BpuEI)

[0075] / 5AmMC6 / TTTTTTATTATATTAACTAATATGTATATAGTGTTAACAGTCAATCTCAAGATATCGCTA

[0076] SEQ ID NO: 13 is the complementary sequence of TIIS stem2.

[0077] TAGCGATATCTTGAGATTGACTGTTAACACTATATACATATTAGTTAATATAAT

[0078] SEQ ID NO: 14 is TIIS s2p1 (BpuEI)

[0079] / 5AmMC6 / TTTCGTACCGACGCGCTTGAGGTACGACCT

[0080] SEQ ID NO: 15 is the complementary sequence of TIIS s2p1.

[0081] / 5Phos / GTCGTACCTCAAGCGCGTCGGATACGAAA

[0082] SEQ ID NO: 16 is TIIS s2p2 (BpuEI)

[0083] / 5AmMC6 / TTTCGTACCGACGCGCTTGAGGTACGACCA

[0084] SEQ ID NO: 17 is the complementary sequence of TIIS s2p2.

[0085] / 5Phos / GTCGTACCTCAAGCGCGTCGGATACGAAA

[0086] SEQ ID NO: 18 is TIIS s2p3 (BpuEI)

[0087] / 5AmMC6 / TTTCGTACCGACGCGCTTGAGGTACGACGT

[0088] SEQ ID NO: 19 is the TIIS s2p3 complementary sequence.

[0089] / 5Phos / GTCGTACCTCAAGCGCGTCGGATACGAAA Detailed Implementation

[0090] Work is currently underway to provide visual barcoding systems that exhibit numerous improvements over conventional NGS. These improvements include reduced time, lower material and reagent costs, temperatureless cycling (i.e., isothermal reactions), and lower overall operating temperatures, as well as the design of the system to allow all decoding cycles to occur in the same buffer (which enables the addition of only each "next cutting reagent" without removing previous reagents). These efforts have resulted in significant improvements over NGS, including advancements in orthogonal cut sequencing (OCS) as described in WO 2022 / 187719. After decoding the OCS identifier chains on the beads to determine the bead positions on the surface, the NGS-captured oligonucleotides (COs) containing information (color codes) about which identifier chains are located on the beads remain intact (e.g., the COs survive in the decoding workflow described in WO 2022 / 187719) for subsequent nucleic acid capture. Previously disclosed methods for generating, encoding, and decoding visual barcodes rely on identifiers and orthogonal cut sequencing (OCS), as described in WO 2022 / 187719. In previously disclosed methods, beads containing combined or in-chain identifiers for use by OCS are encoded in a combined manner with visually detectable fluorophores / tags before the introduction of the cleaving agent. OCS involves introducing a single cleaving agent at a time, followed by an imaging step to decode the sequence of the identifier chain. In the OCS workflow, the order of detectable tags within the identifier chain is determined by the signal loss after each cycle (because some tags are removed from the identifier chain during each cycle of orthogonal cleavage); and orthogonal cleavage is present, but a linking step is not required. The identifier chain (as used in OCS) can be composed of polymers other than nucleic acids for alternating decoding (such as peptide linkers using orthogonal proteases or chemical linkers using orthogonal chemical linker cleaving agents).

[0091] This document discloses a method for orthogonal cut ligation sequencing (OCLS) of visual barcodes, which can be implemented to overcome various limitations associated with identifier chain decoding by other sequencing methods, such as orthogonal cut ligation sequencing (OCS; see WO2022 / 187719). In some embodiments, the barcode used for OCLS as described herein is dsDNA. The double-stranded nature may arise from two paired single-stranded DNA molecules, or from single-stranded DNA that folds back to form a hairpin (in which case the hairpin stem is double-stranded). In short, the visually decoded barcodes used in the OCLS workflow are constructed through multiple rounds of splitting and merging (similar to that described in WO2022 / 187719; see also Rosenberg et al., Science 360(6385): 176-182, 2018; Kuchina et al., Science 371(6531): doi:10.1126 / science.aba5257, 2020; USPN 11,692,214; US Patent Publication US20220403452A1), but the segments constituting the OCLS barcode are not labeled (because they have the identifier of WO2022 / 187719). Individual segments in the OCLS library are each linked to the previous segment to build chains; these segments can be co-encoded together with the NGS-captured barcode.

[0092] Similar to the splitting and merging procedure outlined in WO 2022 / 187719, bead libraries can be constructed using 100 or more different wells in each round through several rounds of splitting and merging. For decoding, this method involves using at least one, but optionally two or more, orthogonal REs, such as IIS-type enzymes (e.g., the enzymes used in the figures and illustrations described herein), in a single reaction mixture. This step is followed by specific orthogonal ligation of differentially labeled probes, which enables visual differentiation of the barcode at each feature based on its encoded sticky ends (protruding bases). This process is repeated in multiple cycles as described in the figures and illustrations.

[0093] Different barcodes compatible with orthogonal cut ligation sequencing (OCLS) workflows can be created by adding dsDNA segments containing encoded restriction endonuclease (RE) recognition sites (RS) and / or cleavage sites (CS) in different combinations to bead or other solid-particle features. Figure 1A , 1B The dsDNA OCLS barcode stem oligonucleotide shown in the figure is used to construct such barcodes. Here, the dsDNA stem region is connected at one of its 5' ends by a flexible (e.g., polyethylene glycol (PEG)) structure.12 The linker connects to the bead; in this illustration, the stem dsDNA oligonucleotide is common to all beads contained in the library. At the opposite ends, the dsDNA stem oligonucleotide contains a 5' protrusion or "sticky end" (a region consisting of single-stranded DNA bases) designed to connect to the next barcode segment. Optionally, different stems of the OCLS barcode (distinguished by sequence contents and / or "sticky ends") or different cleavable segments can be linked at different locations on the bead to increase coding diversity. In this way, splitting and merging methods can be used to construct many different individual segments or multiple strands consisting of different contents or types in various combinations.

[0094] Although enzyme ligation is used as an example here, the use of chemical ligation to capture probes on OCLS barcodes is also considered.

[0095] Figure 1A A method for creating OCLS barcodes is illustrated, wherein each dsDNA segment contains a recognition site (RS) for a specific restriction endonuclease (RE) and one or more overlapping regions for linking to flanking dsDNA segments to form a chain. The accompanying figure illustrates three rounds of barcode encoding by linking different segments to form a barcode chain. In creating a combination of OCLS barcodes containing RSs for recognition and cleavage by a specific RE (the enzyme performs the cleavage at the recognition site), each round of combined encoding must include many different RSs. For example, two OCLS barcodes are decoded by probes linked to differentially labeled segments, thus… Figure 1A The diversity of barcodes shown is limited by the number of different options for probe connections (containing probes for connecting to compatible sticky ends of the diced barcode), and therefore the information encoding in each round is directly proportional to the number of different RSs used. During decoding of OCLS barcodes via orthogonal connections, each decoding probe (contained within the probe pool) contains overlapping regions or "sticky ends" compatible with connecting to one or more diced barcode oligonucleotides. A uniquely distinguishable marker (or combination of uniquely distinguishable markers) connected to the probe is used to determine which sticky end is available / exposed on each bead. For each diced barcode segment in this type of OCLS barcode (added during each round of encoding), each unique RS will correspond to only a single marker or combination of markers during decoding: during decoding, an orthogonal RS is determined by only one distinguishable marker (or combination of distinguishable markers).

[0096] Figure 1BA method for creating OCLS barcodes is illustrated, wherein each dsDNA segment contains a cleavage site (CS) that can be designed to be present in the sequence, and one or more overlapping regions for linking to flanking dsDNA segments to form a chain. The accompanying figures illustrate three rounds of barcode encoding by linking different segments to form a barcode chain. When creating OCLS barcode combinations containing designed CS, including RS within the barcode chain itself is optional but not necessary. This is because CS can be designed to be cleaved by IIS-type REs, and these enzymes have recognition sites (RS) located away from the site where the enzyme cleaves the dsDNA. These enzymes will cleave any site a certain number of bases from their RS (specific to each enzyme), and will leave a certain number of 5' or 3' overhanging bases, depending on the specific enzyme / RS used. Therefore, orthogonality of barcode / probe pairs can be designed for this type of OCLS barcode, which significantly increases the number of different linking probes that can be used for each RS. When using IIS-type REs, RSs can be included in the outermost segment, allowing the enzyme to recognize the included RSs and perform dsDNA cleavage at the designed cleavage site (selected based on the IIS-type RE and RSs used). Alternatively, IIS-type enzyme-specific RSs can be included on the incoming labeled orthogonal linkage probe (encoded within the probe) to allow subsequent cleavage reactions with the same or different IIS-type REs. This enables the encoding of only the designed CSs (along with the flanking sequences necessary for barcode construction) within this OCLS dsDNA barcode type.

[0097] exist Figure 2 The image illustrates two different OCLS barcode types. These barcode types can be linked to the bead at different sites around the bead, resulting in different combinations, or segments of these barcodes can be joined using splitting and merging methods to form, for example... Figure 1A , 1BThe barcode chain shown is illustrated. After barcode construction, barcode-encoded beads can be immobilized on a surface (e.g., in a flow cell) for decoding. The barcode type shown on the left contains recognition sites (RS) for restriction enzymes (REs), which cleave the OCLS barcode at the designed and corresponding RS. After cleavage, during a washing step, any dsDNA (or ssDNA hairpins) downstream of the RS (from the bead-linking site) are removed, exposing the sticky ends for compatibility with specifically labeled probes during decoding. For the OCLS barcode type shown on the left, multiple different RSs (and therefore multiple different orthogonal REs) are required to expose multiple different sticky ends for downstream decoding via orthogonal linkage with differentially labeled probes. The barcode type shown on the right contains RSs for IIS-type REs, which cleave at a specifically designed site away from their RS. After cleavage by IIS-type RE, any dsDNA (or ssDNA hairpins) located downstream of the encoded cleavage site are removed during the washing step, which potentially exposes a series of differentially designed sticky ends that can be recognized by one of a series of designed ligation probes.

[0098] Figure 3A An orthogonal connection probe that can be used in an OCLS decoding workflow is illustrated. As outlined above, decoding a single OCLS barcode involves identification by a probe of a design from a series of probes, whereby each probe in the series contains one or more distinguishable markers, and whereby each probe's distinguishable marker (or a combination of associated distinguishable markers) corresponds to one of the sticky ends (containing a base complementary to the sticky end) of a differentially designed sticky end exposed on the cut OCLS barcode. Figure 3A The dsDNA probes shown are formed by hybridization of two complementary strands of ssDNA and labeled with an NHS-modified fluorophore reagent to covalently link to the dsDNA at one end (carrying a 5'-amino modification) via a flexible 6-carbon linker. At the opposite ends of the duplex, these probes contain specific regions of protruding bases to create designed 5' or 3' protrusions. The protruding bases of the probes correspond to known labels or combinations of known labels (attached to the probe), allowing the use of detectable labels during decoding (after the ligation and imaging steps) to determine the protruding bases exposed on different OCLS barcodes. The probes may contain labeled dsDNA or may contain [a specific type of DNA] as shown in the image. Figure 3A and Figure 3B The image shows the hairpin structure of ssDNA beneath the dsDNA probe. Alternatively, as... Figure 3BAs shown, the probe may contain an encoded RS. The RS encoded within the orthogonal linking probe used to decode the OCLS barcode may correspond to an RS recognized by an IIS-type RE. This RS may have already been used in a previous decoding cycle or may be used in a future decoding cycle. In this way, the same IIS-type RE site (RS) can be used in each decoding cycle, thus achieving a ratchet effect as the OCLS barcode is decoded. Alternatively, different IIS-type RSs can be encoded in the probe used for each decoding cycle to reduce aberrant cleavage across cycles (in which case any OCLS barcodes that remained uncut in the previous cycle will not be recognized in subsequent cycles). Similarly, a labeled product (after ligation) is generated using a labeled hairpin probe during decoding, the labeled product not having an open 5'-phosphorylated end. In this case, all oligonucleotides that did not accept the hairpin linking probe can be removed by using a 5'-exonuclease (such as λ exonuclease), which recognizes only the 5'-phosphorylated ends of the oligonucleotides for digestion. By altering the IIS-type RS encoded within the probe during each decoding cycle, and by including a 5'-exonuclease cleanup step after ligation, any genotyping during OCLS decoding (the observed signal corresponding to an incorrect cycle) can be reduced.

[0099] Figure 4A Describing containing Figure 1A (and Figure 2 The image (left) shows a bead with three distinct segments of an OCLS barcode type, connected at three different locations on the bead. Before decoding, the bead can be immobilized on a surface, such as in a flow cell. Each segment contains a unique RS (RS1-RS3), which is recognized and cleaved by one of three different specific and orthogonal REs. These three enzymes can be used sequentially or included in a single reaction mixture containing a universal compatibility buffer supplied by the manufacturer (e.g., New England Biolabs (NEB) 1X CutSmart buffer). After digestion with all three enzymes, these three distinct cleavage events expose protruding bases (orthogonal protrusions) of different compositions, thereby allowing for decoding via... Figure 3A and 3B The orthogonal connection of the detection probes for the different types of stems shown in the figure can detect each type of stem. Figure 4B The diagram illustrates the connection of a first-marked probe to a diced OCLS barcode segment containing compatibility protrusions for connection with the first probe. The marking on the first probe determines which protruding bases on the OCLS barcode are exposed through digestion and are then identified by the probe for compatibility connection. Figure 4BOnce the connection is complete, the image extracted from the bead will show a single mark or combination of marks corresponding to the detectable marks contained on probe 1. Figure 4C The diagram illustrates the connection of a second-marked probe to a diced OCLS barcode segment containing compatibility protrusions for attachment to the second probe. Similar to the first probe, the markings on the second probe determine which protruding bases will be exposed on the OCLS barcode after enzymatic digestion. Figure 4C Once the second probe is attached, the image extracted from the bead will show a single mark or combination of marks corresponding to the detectable marks contained on both probe 1 and probe 2. Figure 4D The diagram illustrates the connection of a third-marked probe to a diced OCLS barcode segment containing compatibility protrusions for attachment to the third probe. Similar to the first and second probes, the markings on the third probe determine which protruding bases will be exposed on the OCLS barcode after enzymatic digestion. Figure 4D In this process, once the third probe is ligated, the image extracted from the bead will show a single marker or combination of markers corresponding to the detectable markers contained on probes 1, 2, and 3. In this example, a single cleavage event in a single reaction mixture may contain multiple enzymes, but the decoding cycle (followed by imaging) is repeated as needed to decode the number of stems [exposed protrusions on the stem] expected to be detected on the bead.

[0100] Alternatively, one or more REs can be used in a single reaction mixture as described above, but this step may be followed by the use of probes (or a series of probes) containing multiple different markers in a pool, the probes being designed to create a combination of markers for decoding OCLS barcodes. Figure 4E It shows the use of Figure 1A (and Figure 2 The image (left) shows three distinct segments of an OCLS barcode type, connected at three different locations on a bead. These three OCLS barcodes can then be digested (cut) by one or more REs to create a combination of sticky ends for decoding by corresponding probes during one or more OCLS cycles.

[0101] Figures 5A-5EAn example of orthogonal cut-ligation sequencing (OCLS) is shown. The stem1 oligonucleotide (paired with RS1) contains the formed dsDNA BsmFI recognition site (RS1) after hybridization; this IIS-type enzyme cleaves 10 bp downstream of its recognition site, leaving a four-base 5' overhang. The stem2 oligonucleotide (paired with RS2) contains the formed dsDNA BpuEI recognition site (RS2) after hybridization; this IIS-type enzyme cleaves 14 bp downstream of its recognition site, leaving a two-base 3' overhang. Figure 5A and 5B Unlabeled barcodes orthogonally cut with one or more IIS-type REs: Step 1). Each time these two enzymes cut DNA, they precisely cut a distance downstream of their recognition site (respectively), but the cleavage site is not sequence-specific. This allows for the coordinated design of orthogonal cleavage sites (protrusions or "sticky ends") with labeled orthogonal probes containing compatible protrusions, such that each label-distinguishing probe recognizes a specifically designed cleavage site. A library of dsDNA barcodes can be generated by encoding dsDNA barcodes (stems) containing defined 5'-protrusions or 3'-protrusions (e.g., from 5' to 3') with different sequences using a split-and-merge ligation strategy. Labeled ligation probes are covalently ligated to the cleaved oligonucleotides via orthogonal ligation, and this newly formed ligation product contains a detectable label that is imaged to identify the specific protrusion sequence. The ligation probe also contains a dsDNA region encoding an IIS-type recognition site to enable subsequent cleavage at different locations on the stem oligonucleotide after ligation. Figure 5C and 5D ; Barcodes identified by orthogonal linkage using one or more IIS-type RE orthogonal cuts: Step 2). This allows stem oligonucleotides to be downregulated toward the beads in a "ratchet-like" manner over multiple cycles, where each cycle contains the following steps for decoding: cutting, linkage, and imaging ( Figure 5EOCLS Preferred: Cut, (Ligation, Imaging) x 2: all subsequent cycles. In cases where more than one stem type is used in the same OCLS decoding workflow, cutting is performed by more than one enzyme within a single reaction mixture, and cycles of ligation and imaging are performed for each included stem type. Labeled hybridized dsDNA ligation probes are used for both BsmFI-specific stems and BpuEI-specific stems (stem1 and stem2, respectively), and labeled DNA hairpin ligation probes are also designed for BsmFI stems. Although illustrated with only two stem / RS pairs, this system can be operated (e.g., simultaneously) with several different stem / RS pairs. The two pairs shown have different protrusions after cutting (one protrusion leaves a 5' "sticky end" for specific ligation, and the other protrusion leaves a 3' "sticky end" for ligation). These protrusions also have different lengths. Therefore, with this combination, incorrect ligation events are implicitly eliminated (i.e., there may be no crossover between the two stems and the ligating oligonucleotide). Therefore, this figure illustrates a method involving multiplexing of (two) different "orthogonal" stem / RS pairs.

[0102] Figure 6 A preferred embodiment of the OCLS method and workflow, along with results obtained from Example 1, is shown. Here, the use of... Figure 3B The type of AF-488-labeled ssDNA hairpin probe shown (at the bottom) is an example. Labeled ssDNA hairpin probes contain encoded RS and are used for cutting... Figure 1B ( Figure 2 The type depicted on the right (within the diagram) involves orthogonally linking OCLS barcodes containing multiple encoded CSs. For Figure 6 The experiments outlined herein involved an imaging step performed in the 488 nm (emission) channel to determine the signal intensity of the beads following the initial OCLS barcode cleavage using IIS-type RE, specifically BsmFI. Following probe attachment and subsequent washing steps, the beads were imaged in the 488 nm channel to determine the signal obtained from the tag and thus identify any exposed protrusions on the cleaved OCLS barcode. The same RS-encoded IIS-type RE (BsmFI) used in the initial cleavage reaction was also incorporated into the attached probe; therefore, this enzyme was added to the beads after subsequent washing to remove components from the previous reaction for a second digestion of the OCLS barcode. Following the second digestion and washing steps, an imaging step was performed in the 488 nm channel to determine the signal obtained from the beads. The signals obtained in all three imaging steps in the 488 nm channel were plotted on [the graph / image]. Figure 6In the graphs, the y-axis represents relative fluorescence units (RFU). These experiments clearly demonstrate the successful demonstration of probe ligation and subsequent probe cleavage. The average intensity value (< 1,000 RFU) of the beads after the first cleavage with BsmFI (TIISRE cleavage 1) was almost identical to that after the second cleavage with BsmFI (TIISRE cleavage 2), but the average intensity value of the beads after ligation with AF-488-labeled ssDNA hairpin probes was approximately 33,000 RFU. Ligation reactions containing incorrectly labeled ssDNA hairpin probes (hairpin probe 3, containing incorrect protrusions for OCLS barcoding) did not produce ligation products (also determined by gel analysis). This experiment demonstrates the possibility that many different beads encoding different combinations of OCLS barcodes containing different CS can be decoded in a highly parallel manner using the OCLS workflow outlined herein. This method involves ratcheting down the OCLS barcode by adding an orthogonal linker probe containing an encoded RS for use with IIS-type REs. In a preferred embodiment, an RS corresponding to an IIS-type enzyme is used as described above, and the individual probe used in each decoding cycle contains a marker for identifying, for example, IIS-type REs. Figure 6The image shows labeled ssDNA hairpin oligonucleotides representing the specific protrusions of exposed protrusions on cleaved OCLS barcodes. Preferably, different IIS-type RSs are included in each subsequent probe used in each subsequent cycle to reduce aberrant cleavage (not shown here) in individual cycles. As mentioned elsewhere, this approach reduces the tendency for intact OCLS barcodes that might survive (remain uncut) during digestion after the previous cleavage cycle due to enzyme cleavage used in the previous cycle. Additionally, using labeled ssDNA hairpin oligonucleotides as ligation probes allows for a cleanup step after the ligation step, which can be performed before or after the imaging step (as previously described using 5'-exonucleases, such as λ-exonucleases, which recognize and remove 5'-phosphorylated ends used to digest and remove the strands, thus preventing these barcodes from interacting with any subsequent enzymes or probes used in future cycles). The cleanup step removes any residual dsDNA after a not 100% efficient ligation step, as the ligation product (containing labeled ssDNA hairpin oligonucleotides) can be engineered to not contain open 5'-phosphorylated ends. In summary, the preferred embodiment of the described combination of a ligation probe consisting of labeled ssDNA hairpins containing different RS in each cycle to reduce aberrant cleavage in subsequent cycles, and a cleanup step performed after the ligation step to remove 5'-phosphorylated DNA, should enable the workflow to achieve multiple accurate OCLS barcode decoding cycles.

[0103] The method presented in this paper is designed for multiplexing a large number of differentially barcode-encoded beads in a single experiment. In this use, it is important to determine which bead / location on the solid carrier is which among many beads / locations; thus, each bead / location in the library must have a unique code (each unique bead / location may have many copies, but each individually addressable location in the library must have a unique code). This paper describes methods, components, and systems that can be used to determine which bead / location has which barcode using visual markers attached to specific sticky ends exposed on the barcode after digestion with a restriction enzyme. Therefore, what is read in the described method is the specific sticky end of the barcode, for each different exposed sticky end, using a unique marker (or a combination of unique markers). This depends on:

[0104] (1) Cuttable barcode.

[0105] a) Because barcodes are read using probes that must find their homologous matches, the simplest method of reading is to use dsDNA barcodes with enzyme-digested probes to which specific labels can be designed. These specifically labeled probes find their matches through base pairing and subsequent ligation. This is done because reading can be performed cyclically; with multiple cycles, increasingly diverse barcodes can be read. Other methods exist for reading where only a single cycle is required:

[0106] i) This can also be accomplished using specific orthogonal recognition by antibodies that find their homologous analytes, whereby the antibodies are labeled and thus able to generate combinations of labels (color codes) by binding the analytes in different combinations.

[0107] ii) This can be achieved using differentially labeled DNA or RNA binding proteins, preferably proteins that will recognize specific DNA or RNA elements among many different elements.

[0108] b) Orthogonality is employed to enable multiplexing of many barcodes. This means that more than one different sticky end (single-chain protrusion) can be included in the system to have at least one difference. In the described diagram, three sticky ends are shown because, to generate many differences, it is possible to:

[0109] i) Many different restriction sites (and corresponding restriction enzymes) are used to encode many different sticky ends (as shown in the figure).

[0110] ii) Alternatively, a restriction enzyme (RE) that cuts engineered / designed sites can be used, illustrated herein as an IIS-type enzyme that cuts dsDNA at a site distant from its recognition site (RS). In this case, the cleavage site (CS) can be designed to contain any sequence (because the IIS RE cuts at a predetermined distance from its RS, rather than at the predetermined sequence), as long as it is located in the appropriate position (relative to the RS), which is not possible with conventional restriction enzymes. By designing the sequence of each CS, a single IIS-type RE can produce many different sticky ends (protrusion sequences) depending on the configuration of the RS relative to the designed / engineered / encoded CS.

[0111] (2) A probe that can be attached to a cut barcode mark.

[0112] a) For normal restriction enzymes (enzymes that cut at their recognition sites), this is straightforward. In the case of dsDNA molecules being cut with XhoI, they will have protrusions, which will be attached to probes having the same protrusion. XhoI protrusions are well-known and consistent in all cases, and this is how people have been cloning for decades. The problem is that normal REs will only cut dsDNA at their corresponding RSs, so only one probe is needed for each enzyme used (in order to distinguish the specific protrusion on the OCLS barcode).

[0113] b) Use a limited number of probes in each decoding cycle. For example, if there are 10 different possibilities for barcode protrusions in a given cycle, then add 10 probe possibilities—all 10 will match (that is, all 10 will have protrusions that can bind and connect to the specific protrusions exposed on the barcode), but only at the correct barcode (only if the correct base complementarity is achieved between the protrusion on the barcode and the protrusion on the probe). As with next-generation DNA sequencing, the system is designed to determine which beads or features have which barcode.

[0114] c) For IIS-type ligation probes, the ligation sites are designed into the barcode sequence, and these correspond to custom-designed protrusions exposed after digestion with an IIS-type restriction enzyme. This is truly scalable multiplexing because it eliminates the need to search for 10 differentially labeled restriction enzymes to create 10 different protrusions for detection by 10 different ligation probes. Here, a single enzyme can create all 10 different ligable ends that can be recognized by 10 differentially labeled probes.

[0115] i) Multiplexing of numerous (e.g., 10) different probes can also be achieved using only four different fluorophore colors. With only four different fluorophores, these fluorophores need to be mixed in combinations to create 10 different distinguishable probes that can be read out in a single image. This can be done as follows: by mixing two differentially labeled probes in different combinations for each individual probe type, 10 different combinations can be distinguished using four distinguishable labels (labels 1-4): 1+1, 1+2, 1+3, 1+4, 2+2, 2+3, 2+4, 3+3, 3+4, 4+4. With five different labels, 15 combinations can be distinguished. However, since it is not possible to distinguish, for example, between 1+2 and 2+1, they appear identical to the observer.

[0116] (1) Figure 1A-1BMultiplexing is illustrated, which can reach the number of different restriction enzymes (REs) used throughout all cycles of the experiment. Recognition sites (RS) can be in different combinations, but this embodiment can only be scaled to a limited level—there is no scalability beyond using a known number of RS / RE pairs, and the combinations can only be increased by directly increasing the number of RS / RE pairs used, or by using additional multiplexing on distinguishable visual markers such as fluorophores.

[0117] (2) Figure 2 On the other hand, it demonstrates the use of IIS-type barcodes and enzymes to expand the scale of different possible encoded sticky ends for connection, in which potentially billions of different beads can be encoded in combinations, for example... Figure 1B As shown, decoding can be performed across method cycles because one enzyme can actually be used to encode many different protrusions (because the "cut" site can be engineered into a different sequence each time, and because the IIS-type RE recognizes its RS sequence and cuts only a predetermined distance, to the extent that the sequence is located at the distal position). If needed, the same enzyme can be used repeatedly to encode billions of different combinations. This is also achieved by reintroducing another IIS-type enzyme recognition site into the labeled probe, so that when attached to a barcode, it creates another IIS-type recognition site at the correct distance from the corresponding encoded "next cut site" on the barcode.

[0118] (3) Imaging steps for determining probe attachment. Given the markers used and the sample analyzed, the imaging steps can be performed in any suitable manner; and

[0119] (4) A method and system for decoding barcodes when attached to a bead or other locatable solid surface.

[0120] a) The described method is designed to be scalable for encoding when executed in a loop. The loop involves: cutting a barcode; attaching a marked probe to the cut barcode; and imaging the barcode to which the marked probe is attached.

[0121] b) When there are multiple (n) different unique protrusions on a single bead / position, the ligation and imaging steps are repeated n times according to the maximum number of different unique protrusions in the library on a single bead.

[0122] An embodiment of the provided method for visual molecular barcode encoding is shown in Figures 4A-4EIn 5A-5E. These methods involve orthogonal cutting and ligation, and are therefore referred to herein as Orthogonal Cut-Ligation Sequencing (OCLS). The OCLS method uses detectable tags attached to the incoming ligation probe, and these tags are used to determine the specific protrusion sequence on the bead after cleavage by the restriction enzyme. Figure 1A , 1B One method for achieving this is illustrated, which involves using multiple different orthogonal restriction enzyme sites (shown herein as RS1-RS3). In short, a series of OCLS tags present on the bead are cleaved using orthogonal restriction enzymes (shown herein as RE1-RS3) that specifically recognize one site on each tag. This allows the exposure of specific “sticky ends” (protrusions) to be used for the ligation of specifically labeled probes. Figure 4B The decoding loop (ID loop) involves cutting, followed by joining and imaging. Figures 4A-4E Three of these decoding cycles are illustrated. The cutting step occurs once per cycle, and imaging (the imaging cycle) follows the introduction of ligation probes and ligase after cutting. This imaging cycle will occur depending on the number of different enzymes used during cutting. When performed in various combinations, many beads can be visually encoded and decoded in this way. Smaller bead libraries, such as [example libraries], can also be decoded using a single ligation and imaging step after cutting. Figure 4E As shown.

[0123] Figures 5A-5E An embodiment of OCLS is shown. The stem1 oligonucleotide contains the formed dsDNA BsmFI recognition site (RS1) after hybridization; this IIS-type enzyme cleaves 10 bp downstream of its recognition site, leaving a four-base 5' overhang. The stem2 oligonucleotide contains the formed dsDNA BpuEI recognition site (RS2) after hybridization; this IIS-type enzyme cleaves 14 bp downstream of its recognition site, leaving a two-base 3' overhang. Figure 5A and 5BUnlabeled barcodes are orthogonally cut using one or more IIS-type REs (step one). Each time these two enzymes cut DNA, they precisely cut a distance downstream of their recognition site (respectively), but the cleavage site is not sequence-specific. This allows for the coordinated design of orthogonal cleavage sites (protrusions or "sticky ends") with labeled orthogonal probes containing compatible protrusions, such that each label-distinguishing probe recognizes a specifically designed cleavage site on the OCLS barcode. dsDNA barcodes (OCLS barcode stems) containing defined 5'-protrusions or 3'-protrusions (e.g., from 5' to 3') with different sequences can be encoded using a split-and-merge ligation strategy to generate a library of dsDNA barcodes for OCLS. Labeled OCLS ligation probes are covalently ligated to the cleaved OCLS barcode oligonucleotides via orthogonal ligation, and this newly formed ligation product contains a detectable marker that is imaged to identify the specific protrusion sequence. The ligable probe also contains a dsDNA region encoding another IIS-type recognition site to enable subsequent cleavage at different locations on the stem oligonucleotide after ligation. Figure 5C and 5D ; Barcodes identified by orthogonal linkage using one or more IIS-type RE orthogonal cuts: Step 2). This allows stem oligonucleotides to be downregulated toward the beads in a "ratchet-like" manner over multiple cycles, where each cycle contains the following steps for decoding: cutting, linkage, and imaging ( Figure 5E ; OCLS preferred: cut, (connect, image) X (number of stems used) — shown as having two stems: all subsequent cycles). Although it is shown as having two types of stems (and thus, in Figures 5A-5E In this context, X = 2), but it should be understood that only one type of stem can be used, or multiple different stems can be employed to increase the multiplicity of the method. Figures 5A-5E The diagram shows two different stems, so for each cycle, it is expected that both will be seen. Therefore, here, it is X2. In cases where more than one stem type is used in the same OCLS decoding workflow, the cutting is performed by more than one enzyme within a single reaction mixture, and cycles of ligation and imaging are implemented for each stem type included. Labeled hybridized dsDNA ligation probes were used for both BsmFI-specific stems and BpuEI-specific stems (stem1 and stem2, respectively), and labeled DNA hairpin ligation probes were also designed for BsmFI stems.

[0124] In a preferred embodiment, the orthogonal connection probe includes, for example: Figure 6 The image shows an ssDNA hairpin oligonucleotide containing a detectable tag. The detectable tag can be attached to the oligonucleotide via an internal amino group modification within the loop region of the hairpin oligonucleotide, as shown here. Figure 6 This illustrates a decoding loop using a hairpin probe for OCLS. Figure 6 In the diagram, data obtained by imaging the beads after the first cleavage event, after attaching the correct OCLS hairpin probe labeled with Alexa Fluor 488 to the cleaved OCLS stem barcode, and after the second cleavage event are plotted side by side. Here, and as disclosed throughout this application, the incoming OCLS probe not only distinguishes the correct protruding ligation site but also encodes another restriction site. In this example, the enzyme recognition site (RS) is recognized by an IIS-type restriction enzyme (RE). Thus, as shown here, the second digestion removes the detectable marker from the OCLS stem barcode and exposes the subsequently encoded sticky end. This prepares the OCLS stem oligonucleotide for subsequent rounds of decoding via orthogonal ligation. The use of hairpin oligonucleotides has many advantages. Firstly, these advantages include: 1) the hybridized strand of an ssDNA hairpin oligonucleotide is less prone to dehybridization than a pair of hybridized antiparallel oligonucleotides paired as a dsDNA dipeptide species; 2) the hairpin structure ensures that all ligation products do not contain an open 5' end. This is important when decoding large libraries of beads using the OCLS method described herein, as incomplete digestion by restriction enzymes and incomplete ligation by ligases will introduce errors during subsequent cycles. To remove unligated stem structures after the ligation step, 5'-exonucleases that recognize oligonucleotides for removing the phosphorylated 5' ends of DNA by digestion, such as λ exonuclease, are used. Between the final imaging steps of each cycle, λ exonuclease can be introduced, which will "clean up" any remaining unligated stems (stems that did not accept the hairpin probe). In this case, the ligated species will not contain open 5' ends and will be protected from the 5' exonuclease activity of λ exonuclease. This operational "cleaning" step can also be achieved by using dsDNA probes labeled at their 5' ends (blocking any 5' exonuclease activity) or without 5' phosphate groups or otherwise blocked at their 5' ends.

[0125] In other embodiments, the same enzyme can be used to decode all stems via OCLS in the reaction environment. For example, encoded ligation sites on the stems or probes can be exposed by digestion with RNase H as a cleavage agent, which would allow for the design to encode sticky ends (protruding bases). In this case, the labeled probes for orthogonal ligation will contain the target sticky ends for decoding the bases exposed on the stems after digestion with RNase H. This approach can replace single cycles of OCLS, such as the cyclic use described herein.

[0126] As used herein, "orthogonal" refers to a component in a multi-component system that is chemically reactive with a specific reagent under specific reaction conditions, while at least one other component in the multi-component system has limited or no reactivity with the reagent, even if all components in the multi-component system exist in the same environment.

[0127] As used herein, "orthogonal reactivity" refers to the chemical reactivity of components in a multi-component system with a specific reagent under specific reaction conditions, while at least one or more components in the system are not reactive, even if all components in the system exist in the same environment. Similarly, "orthogonal reactive material" refers to a material that exhibits orthogonal reactivity.

[0128] The phrase "detectable marker" refers to a substance that, when associated with another substance, can indicate the presence of said other substance. A detectable marker can be a substance connected to or incorporated into the substance to be detected. In some embodiments, a detectable marker is adapted to allow detection and also quantification, for example, a detectable marker that emits detectable and measurable signals. Detectable markers include bioluminescent markers, biotin / avidin markers, chemiluminescent markers, chromophores, coenzymes, dyes, electroactive groups, electrochemiluminescent markers, enzymatic markers, fluorescent markers, latex particles, magnetic particles, quantum dots, Raman markers, metals, metal chelates, phosphorescent dyes, protein markers, radioactive isotopes, elements or portions thereof, and stable free radicals. Visually detectable markers are those whose detection involves detecting wavelengths / photons of electromagnetic energy (such as light), for example, by imaging. In some embodiments, fluorescent markers are preferred.

[0129] "Fluorescence" refers to the emission of visible light by a substance that absorbs light of different wavelengths. In some embodiments, fluorescence provides a non-destructive way to track and / or analyze biomolecules based on fluorescence emission at specific wavelengths. Proteins (including antibodies), peptides, nucleic acids, oligonucleotides (including single-stranded and double-stranded oligonucleotides), etc., can be "labeled" with any of the various external fluorescent molecules known as fluorophores. Isothiocyanate derivatives of luciferin, such as carboxyluciferin, are examples of fluorophores that can be conjugated to proteins (such as antibodies in immunohistochemistry) or nucleic acids. In some embodiments, luciferin can be conjugated to nucleoside triphosphates and can be incorporated into nucleic acid probes (such as "fluorescently conjugated primers") for in situ hybridization.

[0130] Direct and indirect linkages (e.g., direct and indirect linkages between detectable tags and oligonucleotides or other substances) can include covalent bonds or non-covalent interactions. Covalent bonds involve the sharing of electrons in a chemical bond. Non-covalent interactions include dispersed electromagnetic interactions such as hydrogen bonds (as occurring between paired nucleic acid chains), ionic bonds, van der Waals interactions, and hydrophobic bonds.

[0131] The term "connector" refers to one or more of a nucleotide, nucleotide analogue, amino acid, peptide, polypeptide, polymer, or non-nucleotide chemical motif used to link two molecules together. Connectors can be used to link nucleic acids (such as barcodes) to carriers, detection reagents to nucleic acids (such as probes), etc. In some embodiments, connectors link two molecules via enzymatic or chemical reactions (e.g., click chemistry).

[0132] As used in this article, “next-generation sequencing” (NGS) refers to high-throughput sequencing methods that allow the parallel sequencing of millions to billions of molecules. Examples of next-generation sequencing methods include sequencing by synthesis, ligation sequencing, hybridization sequencing, polymerase cloning sequencing (polony sequencing), ion semiconductor sequencing, and pyrosequencing. By ligating primers to a solid substrate and a complementary sequence to a nucleic acid molecule, the nucleic acid molecule can hybridize with the solid substrate via primers. Multiple copies can then be amplified in discrete regions on the solid substrate using polymerase (these clusters are sometimes called polymerase colonies or polony). Therefore, nucleotides at a specific location can be sequenced multiple times (e.g., hundreds or thousands) during the sequencing process – this depth of coverage is called “deep sequencing.” Examples of high-throughput nucleic acid sequencing technologies include platforms provided by Illumina, Beijing Graphene Institute (BGI), Qiagen, Thermo-Fisher, and Roche, including formats such as parallel bead arrays, sequencing by synthesis, ligation sequencing, capillary electrophoresis, electronic microarrays, “biochips,” microarrays, parallel microarrays, and single-molecule arrays (see, for example, Service, Science 311:1544-1546, 2006).

[0133] As used herein, “single-molecule sequencing” or “third-generation sequencing” refers to next-generation sequencing methods in which reads from a single-molecule sequencing instrument are generated by sequencing a single molecule, typically a DNA molecule. Unlike next-generation sequencing methods that rely on amplification to sequence many DNA molecules in parallel in a staged manner, single-molecule sequencing queries a single molecule (e.g., a DNA molecule) and does not require amplification or synchronization. Single-molecule sequencing includes methods that require pausing the sequencing reaction after each base incorporation ('wash and scan' cycle) and methods that do not require pausing between read steps. Examples of single-molecule sequencing methods include single-molecule real-time sequencing (Pacific Biosciences), nanopore-based sequencing (Oxford Nanopore), double-stranded interrupted nanopore sequencing, and direct imaging of DNA using advanced microscopy.

[0134] For example, an NGS capture barcode is an oligonucleotide containing a capture region, which is an extension of a nucleotide complementary to an oligonucleotide that is determined biologically, chemically, or biochemically, or present in a biological sample. Typically, the capture oligonucleotide includes a 3' capture region (from 3' to 5') and a UMI, and then there is a region corresponding to the visual barcode information (such that it is operatively coupled on the same bead), and then it has a 5' PCR stem. Other elements within the capture oligonucleotide are described in co-owned international application PCT / US24 / 17772 entitled "Compositions and Methods for Molecular Barcode Encoding".

[0135] As used herein, the terms “solid carrier,” “solid surface,” “solid substrate,” or “sequencing substrate” refer to any solid material, including porous and non-porous materials, to which peptides can be associated directly or indirectly by any means known in the art, including covalent and non-covalent interactions or any combination thereof. Solid carriers can be two-dimensional (e.g., planar surfaces) or three-dimensional (e.g., gel matrices or beads). Solid carriers can be any carrier surface, including beads, microbeads, arrays, glass surfaces, silicon surfaces, plastic surfaces, filter membranes, membranes, PTFE membranes, nitrocellulose membranes, nitrocellulose-based polymer surfaces, nylon, silicon wafers, flow-through chips, flow cells, biochips including signal transduction electronic devices, channels, microtiter wells, ELISA plates, interferometric turntables, nitrocellulose membranes, nitrocellulose-based polymer surfaces, polymer matrices, nanoparticles, or microspheres. Materials for solid carriers include acrylamide, agarose, cellulose, dextran, nitrocellulose, glass, gold, quartz, polystyrene, polyvinyl acetate, polypropylene, polyester, polymethacrylate, polyacrylate, polyethylene, polyethylene oxide, polysilicate, polycarbonate, polyvinyl alcohol (PVA), Teflon, fluorocarbons, nylon, silicone rubber, polyanhydride, polyglycolic acid, polyvinyl chloride, polylactic acid, polyorthoester, functionalized silanes, polypropyl fumarate, collagen, glycosaminoglycans, polyamino acids, dextran, or any combination thereof. Solid carriers further include films, membranes, bottles, discs, fibers, woven fibers, molded polymers such as tubes, particles, beads, microspheres, microparticles, or any combination thereof.

[0136] For example, when the solid surface is a bead, the beads may include ceramic beads, polystyrene beads, polymer beads, polyacrylate beads, methylstyrene beads, agarose beads, cellulose beads, dextran beads, acrylamide beads, solid beads, porous beads, unidirectional beads, glass beads, controlled porosity beads, silica-based beads, or any combination thereof. The beads may be spherical or irregularly shaped. The beads or carrier may be porous. The size of the beads may range from nanometers (e.g., 100 nm) to millimeters (e.g., 1 mm). In some embodiments, the size of the beads ranges from 0.2 micrometers to 200 micrometers or from 0.5 micrometers to 5 micrometers. In some embodiments, the diameter of the beads can be about 1 µm, 1.5 µm, 2 µm, 2.5 µm, 2.8 µm, 3 µm, 3.5 µm, 4 µm, 4.5 µm, 5 µm, 5.5 µm, 6 µm, 6.5 µm, 7 µm, 7.5 µm, 8 µm, 8.5 µm, 9 µm, 9.5 µm, 10 µm, 10.5 µm, 15 µm, or 20 µm. In some embodiments, the "bead" solid carrier can refer to a single bead or multiple beads. In some embodiments, the solid surface is nanoparticles. In some embodiments, the size of the nanoparticles is in the range of about 1 nm to about 500 nm in diameter, for example, in the range of diameters between 1 nm and 20 nm, between 1 nm and 50 nm, between 1 nm and 100 nm, between 10 nm and 50 nm, between 10 nm and 100 nm, between 10 nm and 200 nm, between 50 nm and 100 nm, between 50 nm and 150 nm, between 50 nm and 200 nm, between 100 nm and 200 nm, or between 200 nm and 500 nm. In some embodiments, the diameter of the nanoparticles can be 10 nm, 50 nm, 100 nm, 150 nm, 200 nm, 300 nm, or 500 nm. In some embodiments, the diameter of the nanoparticles is less than about 200 nm.

[0137] The terms "nucleic acid molecule" or "polynucleotide" refer to single-stranded or double-stranded polynucleotides and polynucleotide analogs containing deoxyribonucleotides or ribonucleotides linked by 3'-5' phosphodiester bonds. Nucleic acid molecules include DNA, RNA, and cDNA. Polynucleotide analogs may have a backbone other than the standard phosphodiester bonds found in natural polynucleotides, and optionally one or more modified sugar moieties other than ribose or deoxyribose. Polynucleotide analogs contain bases capable of hydrogen bonding with standard polynucleotide bases via Watson-Crick base pairing, wherein the analog backbone presents the bases in a manner that allows such hydrogen bonding between bases in the oligonucleotide analog molecule and the standard polynucleotide in a sequence-specific manner. Examples of polynucleotide analogs include xenobiotic nucleic acids (XNA), bridged nucleic acids (BNA), glycol nucleic acids (GNA), peptide nucleic acids (PNA), γPNA, morpholinopolynucleotides, locked nucleic acids (LNA), threononucleotides (TNA), 2'-O-methyl polynucleotides, 2'-O-alkylribosyl-substituted polynucleotides, thiophosphate polynucleotides, and boron phosphate polynucleotides. Polynucleotide analogs may have purine or pyrimidine analogs, including, for example, 7-denitropurine analogs, 8-halopurine analogs, 5-halopyrimidine analogs, or universal base analogs that can pair with any base, including hypoxanthine, nitroazole, isocarbostyril analogs, azole carboxamides, and aromatic triazole analogs, or base analogs with additional functionality, such as a biotin moiety for affinity binding. In some embodiments, the nucleic acid molecule or oligonucleotide is a modified oligonucleotide. In some embodiments, the nucleic acid molecule or oligonucleotide is DNA with pseudo-complementary bases, DNA with protected bases, RNA, BNA, XNA, LNA, PNA, γPNA, or morpholino DNA, or combinations thereof. In some embodiments, the nucleic acid molecule or oligonucleotide is backbone-modified, sugar-modified, or nucleobase-modified. In some embodiments, the nucleic acid molecule or oligonucleotide has a nucleobase protecting group (e.g., Alloc), an electrophilic protecting group (e.g., cyclothioethane), an acetyl protecting group, a nitrobenzyl protecting group, a sulfonate protecting group, or a conventionally unstable protecting group.

[0138] The captured probe, as used herein in the terminology, is an orthogonal linkage probe covalently linked to an OCLS barcode via a ligation event. While enzyme ligation is used herein as an example, the use of chemical ligation to capture probes on OCLS barcodes is also contemplated. For example, there are various chemical reactions known in the art that can be used for chemical ligation of DNA. Each of the two molecules linked together by chemical ligation must carry one of the reaction components used for said chemical ligation, and the reaction must occur only at a very high degree of proximity (such that when the sequence of the protrusion of the orthogonal linkage probe is the reverse complementary sequence of the sequence of the protrusion of the OCLS barcode, the reaction occurs only when the protrusion of the orthogonal linkage probe binds to the protrusion on the sticky end of the OCLS barcode via specific base-pair-mediated hydrogen bonding). This can be optimized by adjusting the reaction conditions so that chemical ligation occurs only when two different DNA molecules (such as the probe and barcode described herein) are very close to each other, and this very close proximity occurs when there is correct base complementarity between the two compatible ends (the matched probe and barcode protrusions here).

[0139] In this embodiment, the binding of a partial single-stranded probe to a partial single-stranded OCLS barcode occurs when the two protrusions have matching base complementarity, wherein at least a portion of the single-stranded element is a sticky end protrusion produced by restriction enzyme digestion. For two nucleic acid molecules to link together, homologous single-stranded sequences must be their anticomplementary sequences. Correct base complementarity here effectively means that one is the anticomplementary sequence of the other. When a protrusion on the probe comes into contact with a correctly matching protrusion on the cleaved barcode, these two must be their anticomplementary sequences for ligation to occur—thereby “fortifying” the association between the “correct” probe and the OCLS barcode. This is because the initial interaction will likely be a very “touch-down” transient interaction between correctly matching sequences; chemical ligation using the action of a ligase seals the probe to its homologous barcode.

[0140] The embodiments provide a method for orthogonal cut-ligation sequencing (OCLS) of visual barcodes. This method is disclosed herein, including in the accompanying drawings. Although the identifier chain (such as the chain used in OCS as described in WO2022 / 187719) can be composed of polymers other than nucleic acids (such as peptide linkers using orthogonal proteases or chemical linkers using orthogonal chemical cutters), the barcodes used for OCLS as described are composed of dsDNA. The visually decoded barcodes used in the OCLS workflow are also constructed through multiple rounds of splitting and merging, but the segments constituting the OCLS barcodes are not labeled (because they have identifiers). Each segment of the OCLS library is linked to the previous segment to construct the chain, and these segments can be co-encoded together with the NGS capture barcodes as outlined above. In a manner similar to the splitting and merging procedure outlined in WO 2022 / 187719, bead libraries can be constructed in each round using 100 or more different wells through several rounds of splitting and merging.

[0141] For decoding, the OCLS method involves the use of at least one, but optionally two or more, orthogonal restriction enzymes (REs), such as IIS-type enzymes (e.g., ...). Figures 4A-4E and Figures 5A-5E (And the enzymes used in the corresponding illustrations provided herein). This step is followed by specific orthogonal ligation of the differentially labeled probes, which enables visual differentiation of the barcode at each feature. This process is repeated in multiple cycles as outlined in the accompanying figures and illustrations.

[0142] By comparison with orthogonal cut sequencing (OCS; as described in WO 2022 / 187719), the OCLS embodiments described herein: use visual barcodes that do not contain any visual markers before the introduction of the cutting agent; involve the introduction of more than one cutting agent at a time; involve the introduction of detectable markers during each cycle, and are determined by the gain of the signal; and include both orthogonal cutting and orthogonal connection steps.

[0143] The main benefit provided in the embodiments of the method described herein is the use of IIS-type enzymes (which recognize asymmetric DNA sequences and cut outside their recognition sequence). When conventional restriction enzymes are used instead, they will cut at their recognition sites, always leaving the same protrusion (i.e., the same RE will always leave the same protrusion). This means that multiplexing using conventional REs requires using different REs for each “orthogonal” sticky end. For example, 10 different REs would be needed at each cycle to decode 10 different sequences via orthogonal ligation. By using IIS-type enzymes instead, the enzyme recognition site is known by the number of bases from the RE cleavage site, which allows for the design of oligonucleotides so that a single (IIS-type) enzyme can create many different “orthogonal” cleavage / ligation sites. The tags associated with each ligation step are predetermined (which tags correspond to which ligation sites are known in advance), which allows for the determination of codes or “a designed series of ligation sites” because these codes or designed series of ligation sites are coordinated with the ligation and the resulting color. Type IIS Restriction Enzymes (REs) are known in the art, including more than 50 described online at nneb.com / tools-and-resources / selection-charts / type-iis-restriction-enzymes. This online resource provides identification sequences and other characteristics for each listed type IIS RE, including: AcuI, AlwI, BaeI, BbsI, BbsI-HF, BbvI, BccI, BceAI, BcgI, BciVI, BcoDI, BfuAI, BmrI, BpmI, BpuEI, BsaI-HF®v2, BsaXI, BseRI, BsgI, BsmAI, BsmBI-v2, B... smFI, BsmI, BspCNI, BspMI, BspQI, BsrDI, BsrI, BtgZI, BtsCI, BtsI-v2, BtsIMutI, CspCI, EarI, EciI , Esp3I, FauI, FokI, HgaI, HphI, HpyAV, MboII, MlyI, MmeI, MnlI, NmeAIII, PaqCI, PleI, SapI and SfaNI.

[0144] The visually decoded barcodes used in the OCLS workflow are similar to those in the OCS barcode, constructed through multiple rounds of splitting and merging (see the description in WO 2022 / 187719). However, the segments constituting the OCLS barcode are not labeled (because they have an OCS identifier). Each segment of the OCLS library is combined with or linked to the previous segment to form a chain, and these segments may optionally be co-encoded with the NGS capture barcode as described above for OCS (WO 2022 / 187719).

[0145] For decoding, embodiments of the OCLS method use two or more orthogonal REs, such as IIS-type enzymes (e.g., the enzymes described herein), in a single reaction mixture (e.g., simultaneously). This step is followed by specific orthogonal linking of the differentially labeled probes, which enables visual differentiation of the barcode at each feature. This process is repeated in multiple cycles as illustrated in the figures and illustrations.

[0146] When only one enzyme is used to decode the OCLS barcode in each cycle, each cycle will only involve: cutting, ligation, and imaging. However, when using two different stems (such as those recognized by two different IIS type enzymes)... Figures 5A-5E As shown, each cycle involves: cutting with two enzymes, ligation to a first stem type (as shown, ligation probes identifying all markers of the first protrusion type are introduced), performing an imaging step to determine the markers associated with the first protrusion type, followed by a second ligation step (ligation probes identifying all markers of the second protrusion type are introduced), which allows for visual identification of the second protrusion type during the second imaging step. Because the ligation probes (now the product) contain another IIS-type enzyme site, the previously ligated markers are removed in the next cutting cycle before new markers are added in the next ligation cycle.

[0147] In this way, the barcode is downclocked in a ratchet manner by alternating between cutting, ligation, and imaging. The ligation and imaging steps are repeated (within each cycle) corresponding to the number of different stem types used. This is because a ligation probe introduced after each cutting event (when more than one enzyme is used during the cutting step) is linked to the imaging step to achieve deconvolution. This results in the following method of sequentially arranged downstream steps: cutting, ligation, imaging, ligation, imaging.

[0148] During operation, the system performs the connection and imaging X times, i.e., the number of different stems used, and this is because the connection probes contain redundant markers between two (or many) stem types. Images are acquired between each connection event to determine the phenotypic sequence. Markings on the connection probes reveal what the phenotypic sequence is.

[0149] How to use

[0150] The visual barcode encoding techniques described herein have a wide range of applications, including visual identification, such as the visual recognition of beads or molecules tagged with the described barcodes. For example, different antibodies tagged in this way can be used in workflows similar to visual cyclic IF. Similarly, these molecular barcodes can be used on beads carrying drugs or other libraries in high-throughput biochemistry and cell-based screening for rapid visual identification of drugs, thereby associating them with visual reporter activation events and / or omics-based readouts. Other embodiments include their use in generating spatially encoded arrays when linked to beads and used to encode NGS-captured oligonucleotides (see similar systems described in co-owned International Application No. PCT / US24 / 17772 entitled "Compositions and Methods for Encoding Molecular Barcodes," which is incorporated herein by reference in all its teachings). These uses are not intended to be limiting examples, and those skilled in the art will understand that the provided OCLS barcodes, the beads or other solid carriers loaded with such barcodes, and the orthogonal connection probes for marking such barcodes can be used for many other purposes and applications.

[0151] reagent kits and products

[0152] This document also provides kits and articles comprising components for OCLS analysis using the methods and / or components described herein. In some embodiments, the kit further contains additional reagents for processing and analyzing biological samples and / or molecules such as nucleic acids, polynucleotides, proteins, polypeptides, or peptides. Kits and articles may include any one or more of the reagents and components used in the provided methods. In some embodiments, the kit includes one or more of the following: beads or other support surfaces, OCLS barcodes (optionally attached to beads or other support surfaces), individual orthogonal linkage probes, or sets of such probes (optionally designed to pair with homologous OCLS barcodes, processing or reaction compounds or solutions for OCLS barcode encoding or decoding methods, and may be packaged together with these substances).

[0153] In some embodiments, the kit further includes one or more buffers or reaction fluids that are available or necessary for any reaction to occur. Buffers such as wash buffers, reaction buffers, binding buffers, elution buffers, etc., are known to those skilled in the art or of ordinary skill. In some embodiments, the kit further includes buffers and one or more additional components for use with other reagents described herein. Reagents, buffers, and other components may be provided in vials (e.g., sealed vials), containers, ampoules, bottles, wide-mouth bottles, flexible packaging (e.g., sealed Mylar or plastic bags), etc. Any component of the kit may be sterilized and / or sealed.

[0154] In addition to the components mentioned above, the subject kit may further include instructions for using the kit components to practice the subject method, such as instructions for sample preparation, visual barcode encoding, visual barcode decoding, signal detection, and acquisition and / or analysis of data obtained by said method. The kit described herein may also include other materials, such as those that may be considered desirable from a commercial and user perspective, including other buffers, diluents, filter membranes, syringes, and / or packaging inserts with instructions for performing at least one of the methods described herein.

[0155] Any of the kit components mentioned above, as well as any molecules, molecular complexes or conjugates, reagents (e.g., chemical or biological reagents), pharmaceuticals, structures (e.g., carriers, surfaces, particles or beads), reaction intermediates, reaction products, binding complexes, or any other articles disclosed and / or used in the exemplary kits and methods, may be provided individually or in any suitable combination to form the kit.

[0156] Also considered are devices for applying chemicals or compositions or washing solutions to immobilized visual barcodes (including during decoding reactions) and for analyzing and collecting data obtained from such processes using provided methods (such as washing solutions, buffer solutions, reaction solutions, etc.), including flow-throwing fluid devices and microfluidic devices.

[0157] Devices for detecting and measuring the spectral properties of orthogonally connected probes for capturing markers are also considered, such as devices for detecting visually detectable markers.

[0158] Another embodiment is analysis software and analysis / detection / quantification / sequencing methods using OCLS barcodes and / or orthogonal linkage probes provided herein, or an amino acid deconvolution database prepared for use with said methods.

[0159] The exemplary embodiments and examples described below are included to illustrate specific embodiments of this disclosure. Based on this disclosure, those skilled in the art will recognize that many changes can be made to the specific embodiments disclosed herein without departing from the spirit and scope of this disclosure and still obtaining similar or analogous results.

[0160] Exemplary embodiment.

[0161] 1. A visual barcode comprising: at least two or more double-stranded DNA (dsDNA) oligonucleotide segments (cassettes), the at least two or more dsDNA oligonucleotide segments being functionally linearly linked to each other, and each dsDNA oligonucleotide segment including within the sequence of the dsDNA segment: a recognition site (RS) for a specific restriction endonuclease (RE), a designed cleavage site (CS), or both RS and CS; and an untethered end located at one end of the visual barcode.

[0162] 2. A visual barcode according to Example 1 or any other barcode embodiment, which is tethered to a solid substrate by a flexible connector connected to or near the end of the dsDNA of the visual barcode, the end being not the untethered end.

[0163] 3. The visual barcode according to Example 1 or any other barcode embodiment does not include visually detectable markings.

[0164] 4. A visual barcode according to Example 1 or any other barcode embodiment, wherein the RE is an IIS type restriction endonuclease and the CS does not overlap with the corresponding RS.

[0165] 5. A visual barcode according to Example 1 or any other barcode embodiment, wherein at least one of the dsDNA segments comprises a designed CS, and the visual barcode comprises an RS specific to IIS-type REs, the RS being appropriately positioned such that homologous IIS-type REs can cleave the designed CS based on their positioning relative to the RS.

[0166] 6. The visual barcode according to any one of embodiments 1 to 5, such as Figure 1A or Figure 1B As shown or generally as described in this article.

[0167] 7. A collection of visual barcodes of any one of embodiments 1 to 6 or any other barcode embodiments, wherein the collection comprises a plurality of visual barcodes, each of the plurality of visual barcodes comprising a different set of dsDNA segments having different recognition sites (RS), designed cleavage sites (CS), or both for a specific restriction endonuclease (RE).

[0168] 8. The set of visual barcodes according to Example 7, wherein at least two visual barcodes of different visual barcodes are tethered to the same solid substrate.

[0169] 9. An orthogonal cut ligation sequencing (OCLS) barcode comprising two or more dsDNA segments (cassettes), each dsDNA segment containing a recognition site (RS) for a specific restriction endonuclease (RE) and one or more overlapping regions configured to allow ligation with flanking dsDNA segments to form a strand of the segment, the strand of the segment constituting the OCLS barcode.

[0170] 10. A visually detectable orthogonal linkage probe comprising: a complete or partial double-stranded DNA oligonucleotide having a 3' or 5' overhang of at least two nucleotides, the sequence of the overhang comprising: a recognition site (RS) for a specific restriction endonuclease (RE), a designed cleavage site (CS), or both RS and CS; and a visually detectable tag covalently linked to the complete or partial dsDNA oligonucleotide.

[0171] 11. A visually detectable orthogonal linkage probe according to Example 10 or any other probe example, wherein the complete or partial double-stranded DNA oligonucleotide comprises: a linear double-stranded DNA oligonucleotide having a 5' protrusion; a linear double-stranded DNA oligonucleotide having a 3' protrusion; a single-stranded DNA oligonucleotide with a hairpin stem-loop configuration having a 5' protrusion; or a single-stranded DNA oligonucleotide with a hairpin stem-loop configuration having a 3' protrusion.

[0172] 12. A visually detectable orthogonal linkage probe according to Example 10 or any other probe embodiment, wherein the visually detectable marker is connected to the oligonucleotide via a flexible connector.

[0173] 13. The visually detectable orthogonal connection probe according to Example 10 or any other probe embodiment, wherein the visually detectable marker includes one or more of fluorescent markers, bioluminescent markers, chemiluminescent markers, chromophores, quantum dots, Raman markers, biotin moieties, or radioactive isotopes.

[0174] 14. A visually detectable orthogonal linkage probe according to Example 10 or any other probe example, wherein the RE is an IIS-type restriction endonuclease and the RS is specific for the IIS-type RE.

[0175] 15. A visually detectable orthogonal connection probe according to Example 10 or any other probe embodiment, comprising an RS specific to IIS-type REs, the RS being appropriately positioned so that homologous IIS-type REs can be cut into designed CSs based on their positioning relative to the RS.

[0176] 16. A visually detectable orthogonal connection probe according to any one of Examples 10 to 15 or any other probe embodiment, which, as Figure 3A or Figure 3B As shown or generally as described in this article.

[0177] 17. A set of visually detectable orthogonal linking probes of any one of embodiments 10 to 16 or any other probe embodiment, wherein the set comprises a plurality of visually detectable orthogonal linking probes, each of the plurality of visually detectable orthogonal linking probes comprising a different recognition site (RS) or a different RS and a different cleavage site (CS) for a specific restriction endonuclease (RE).

[0178] 18. A set of visually detectable orthogonal connection probes according to Example 17 or any other set of embodiments, wherein at least two of the different detectable orthogonal connection probes include visually distinguishable detectable markers.

[0179] 19. A set of visually detectable orthogonal connection probes according to Example 18 or any other set of embodiments, comprising a plurality of different probes, each of the plurality of different probes being configured such that cutting the probe with the RE produces a protrusion with a sequence different from the sequence of at least 5, at least 7, at least 10, at least 12, at least 15 or more other probes in the set.

[0180] 20. An orthogonal cleavage ligation sequencing (OCLS) oligonucleotide pair comprising: a visual barcode comprising: at least two or more double-stranded DNA (dsDNA) oligonucleotide segments (cassettes) functionally linearly linked to each other, and each dsDNA oligonucleotide segment including within the sequence of the dsDNA segment: a recognition site (RS) for a specific restriction endonuclease (RE), a designed cleavage site (CS), or both RS and CS; and an untethered end located at one end of the visual barcode; and a visually detectable orthogonal ligation probe comprising: a complete or partial double-stranded DNA oligonucleotide, the complete or partial The double-stranded DNA oligonucleotide has a 3' or 5' protrusion of at least two nucleotides, the sequence of which includes: a recognition site (RS) for a specific restriction endonuclease (RE), or both RS and cleavage site (CS); and a visually detectable tag covalently linked to the complete or partial dsDNA oligonucleotide; wherein cleavage of the RS or CS in the visual barcode produces a single-stranded "sticky end" protrusion having a sequence completely complementary to the sticky end (protrusion) produced by cleavage of the RS in the visually detectable orthogonal linker probe.

[0181] 21. A set of OCLS oligonucleotide pairs according to Example 20, wherein each pair of visual barcodes and visually detectable orthogonal linking probes has different fully complementary sequence overlaps, and each visually detectable orthogonal linking probe includes different visually distinguishable detectable markers.

[0182] 22. A method of encoding a visual barcode, the method comprising: contacting a double-stranded DNA (dsDNA) oligonucleotide tethered at a first end to a solid carrier with a first dsDNA segment, the dsDNA oligonucleotide having a single-stranded overhang at a second untethered end, the first dsDNA segment having a first overhang and a second overhang compatible with binding to the single-stranded overhang of the tethered dsDNA oligonucleotide, and including within the sequence of the first dsDNA segment: a recognition site (RS) for a specific restriction endonuclease (RE), a designed cleavage site (CS), or both RS and CS; the contact occurring under conditions sufficient to allow specific hybridization of the single-stranded overhang of the first dsDNA segment with the single-stranded overhang of the tethered dsDNA oligonucleotide; ligating the first dsDNA segment to the tethered dsDNA oligonucleotide to form a first captured barcode segment, the first captured barcode segment comprising: The second protrusion of the first dsDNA segment; contacting the first captured barcode segment with the second dsDNA segment, the second dsDNA segment having a first protrusion and a second protrusion compatible with binding to the single-stranded protrusion of the oligonucleotide of the first captured barcode segment, and including within the sequence of the second dsDNA segment: an RS for a specific RE different from the RS / RE in the first dsDNA segment, a CS designed different from the designed CS in the first dsDNA segment, or both; and linking the second dsDNA segment to the first captured barcode segment to form a second captured barcode segment, the second captured barcode segment including the second protrusion of the second dsDNA segment, the first captured barcode segment and the second captured barcode segment constituting the visual barcode.

[0183] 23. The method according to Example 22 or any other method embodiment further includes repeating the contact and connection steps one or more additional times, each time connecting an additional dsDNA segment to the captured barcode segment to form the visual barcode.

[0184] 24. The method according to Example 22 or Example 23 or any other method embodiment, wherein at least one of the dsDNA segments comprises a designed CS, and the visual barcode comprises an RS specific to IIS-type REs, the RS being appropriately positioned so that homologous REs can cleave the designed CS based on their positioning relative to the RS.

[0185] 25. The method described according to any one of Embodiments 22 to 24 or any other method embodiment, wherein... Figure 1A or Figure 1B As shown or as described in this article.

[0186] 26. The method according to Example 24 or any other method embodiment, wherein the visual barcode is constructed using unlabeled DNA segments through multiple rounds of splitting and merging.

[0187] 27. The method according to Example 26 or any other method embodiment, wherein one or more rounds of splitting and merging comprise: attaching a barcode box to a bead at a time; splitting the resulting beads into separate compartments, optionally into floor holes; attaching different first compartment-specific barcode boxes to the beads in each separate compartment to obtain a set of beads containing two different pairs of barcode boxes; washing the beads containing two barcode boxes; merging the beads containing two barcode boxes; splitting the merged beads containing two barcode boxes into separate compartments, optionally into floor holes; and repeating the attaching, washing, merging, and splitting steps to increase the diversity of the set of barcodes.

[0188] 28. The method according to any one of Examples 22 to 27 or any other method embodiment, wherein the visual barcode comprises a continuous strand of dsDNA segment (cassette), or the visual barcode comprises at least two separate cassettes directly and individually connected to the solid carrier.

[0189] 29. The method according to any one of Examples 22 to 28 or any other method embodiment, wherein the segment is co-encoded together with the next-generation sequencing (NGS) capture barcode.

[0190] 30. A visual barcode, which is prepared by the method according to any one of Examples 22 to 29.

[0191] 31. A method for decoding a visual barcode, the method comprising: in an environment, subjecting at least one double-stranded DNA (dsDNA) orthogonal cut ligation sequencing (OCLS) barcode including at least one restriction site (RS) to a restriction endonuclease (RE) that recognizes the RS, such that the RE cleaves the dsDNA. Under OCLS barcode conditions, RS / RE cleavage produces single-stranded protrusions, thereby generating a partial single-stranded (ss) DNA-partial dsDNA OCLS barcode; if the sequence of the protrusion of at least one orthogonal linker probe, including a dsDNA oligonucleotide with a protrusion at a first end and a visually detectable marker, is the reverse complementary sequence of the protrusion sequence of the partial ss DNA-partial dsDNA OCLS barcode, then the partial ss DNA-partial dsDNA OCLS barcode is contacted with the orthogonal linker probe under conditions sufficient to allow the protrusion of the orthogonal linker probe to bind to the protrusion on the partial ss DNA-partial dsDNA OCLS barcode via base pair-mediated hydrogen bonding; if base pair-mediated binding occurs, the orthogonal linker probe is ligated to the partial single-stranded (ss) DNA-partial dsDNA OCLS barcode to generate a captured probe; and the presence, absence, and / or amount of the captured probe is detected by imaging the visually detectable marker.

[0192] 32. The method according to Example 31 or any other method embodiment further includes repeating the contact / cleavage, contact / base pair-mediated binding, ligation and detection steps one or more times, wherein each additional cycle involves cleavage of the dsDNA OCLS barcode at different cleavage sites (CS), base pair-mediated binding of different orthogonal ligation probes and / or detection of the presence, absence and / or amount of different labeled capture probes.

[0193] 33. The method according to Example 31 or any other method embodiment, wherein one or more of the following are true: the dsDNA OCLS barcode is attached to a bead or other solid surface; multiple different dsDNA OCLS barcodes are attached to a single address on a single bead or another solid surface; the dsDNA OCLS barcode includes more than one non-overlapping RS; at least one RS of the dsDNA OCLS barcode is recognized by an IIS-type RE and is cleaved at a predetermined location outside the RS; at least one RS of the dsDNA OCLS barcode is recognized by an RE that is cleaved within the RS; or the visually detectable marker includes at least one of fluorescent markers, bioluminescent markers, chemiluminescent markers, chromophores, quantum dots, Raman markers, or radioactive isotopes.

[0194] 34. The method according to Example 32 or any other method embodiment, wherein one or more of the following are true: the orthogonal connection probe comprises a single-stranded DNA oligonucleotide having a stem-loop hairpin structure, wherein the protrusion is located at the end of the stem of the hairpin.

[0195] 35. The method according to Example 34 or any other method embodiment, further comprising, after ligation, contacting the environment including the captured probe with a 5'-exonuclease.

[0196] 36. The method according to Example 32 or any other method embodiment, comprising one or more of the following: sequentially contacting the at least one dsDNA OCLS barcode with two or more REs that each recognizes a different non-overlapping RS within the dsDNA OCLS under conditions sufficient to cause each RE to cleave the dsDNA OCLS barcode, each RS / RE cleavage producing a single-stranded overhang, thereby producing a partially single-stranded (ss) DNA-partially dsDNA OCLS barcode; the ligation comprising a chemical ligation; or the ligation comprising an enzyme-mediated ligation.

[0197] 37. The method according to Example 31 or any other method embodiment, comprising: contacting two or more dsDNA OCLS barcodes, each comprising at least one RS, with an RE recognizing the RS under conditions sufficient to cause the RE to cleave the dsDNA OCLS barcode, RS / RE cleavage producing single-stranded overhangs, thereby producing a partially single-stranded (ss) DNA-partially dsDNA OCLS barcode, wherein the RS / RE is different for each dsDNA OCLS barcode.

[0198] 38. The method according to Example 37 or any other method embodiment, comprising contacting the two or more dsDNA OCLS barcodes with two or more orthogonal REs.

[0199] 39. The method according to embodiment 38, wherein the contact with two or more orthogonal REs is simultaneous or sequential.

[0200] 40. The method according to Example 39 or any other method embodiment, wherein after contact with one or more orthogonal REs, a specific orthogonal reaction is used to connect the differentially labeled probe.

[0201] 41. The method according to embodiment 40 or any other method embodiment, wherein the specific orthogonal connection of the differentially marked probes enables visual differentiation of the barcode at each feature in the visual barcode array.

[0202] 42. The method according to Example 31 or any other method embodiment, wherein connecting the orthogonal linking probe to the OCLS barcode of the partial ssDNA-partial dsDNA adds a new RS to the resulting captured probe.

[0203] 43. A method for decoding visual barcodes using orthogonal cut-link sequencing (OCLS) generally as described herein.

[0204] 44. An improved system for molecular barcode encoding, the system comprising a cycle of repeating labeling, orthogonal cutting, ligation, and imaging to identify individual features, wherein the orthogonal cutting comprises cutting a double-stranded DNA barcode with an IIS-type restriction endonuclease.

[0205] 45. The system according to Example 44, wherein two or more markers and orthogonal probes are connected in a cyclical or simultaneous manner.

[0206] 46. ​​An orthogonal cleavage ligation sequencing (OCLS) system, which, as Figures 5A-5E As shown in the image.

[0207] Example 1: Orthogonal cut-ligation sequencing (OCLS) using labeled ssDNA hairpin probes

[0208] This example describes an exemplary system and method for OCLS using labeled single-stranded DNA that forms a hairpin structure as a probe.

[0209] To demonstrate a single cycle (cleavage, ligation, cleavage) of OCLS, the oligonucleotide pair TIIS stem1 (BsmFI) and TIIS stem1 comp were first annealed in 1X NHS conjugation buffer (NCB: 100 mM NaPO4, pH 8.5). Annealing was performed by mixing these oligonucleotides at an equimolar ratio (to a final concentration of 200 µM), subjecting them to 95°C for 5 minutes in a hot block, and then allowing the block to cool to room temperature over a period of at least 1 hour. The annealed dsDNA was then biotinylated (by providing a primary amino group at the 5' end of the TIIS stem oligonucleotide) by adding NHS-LC-biotin (APExBIO A8004) at a final concentration of 2 mM to a solution containing 200 µM of double-stranded oligonucleotides. The biotinylation reaction was allowed to proceed overnight at room temperature and then quenched by adding 1 M Tris buffer (pH 7.5) to reach a final concentration of 50 mM. The quenched reaction was desalted and buffer-exchanged into 10 mM Tris pH 7.5 buffer containing 80 mM NaCl using two consecutive 7 K MWCO Zeba™ rotary desalting columns (Thermo Fisher 89882). Then, biotinylated and annealed oligonucleotides were bound to MyOne T1 streptavidin 42ynabead (Thermo Fisher 65601) at a concentration of 200 nM annealed oligonucleotides mixed with 0.1 mg / ml MyOne T1 beads in 1X streptavidin binding buffer (SBB: 10 mM Tris pH 7.5; 500 mM NaCl). The DNA hairpin ligation probes (TIIS s1hp1 and s1hp3) were labeled with Alexa Fluor 488 NHS ester (Thermo Fisher Scientific A20000) and Alexa Fluor 555 NHS ester (Thermo Fisher Scientific A20009) in the same manner as described above, but without prior annealing.

[0210] Prior to use, MyOne T1 beads coated with TIIS stem1 oligonucleotides (0.25 mg / ml beads in 200 µl volume) were incubated with BsmFI (New England Biolabs R0572L) that had been desalted on a 7K MWCO Zeba™ rotary desalting column (Thermo Fisher Scientific 89882) and then eluted in 1x rCutSmart™ buffer to remove glycerol. BsmFI enzyme (40 µl) was added to 200 µl of MyOne T1 beads at 0.25 mg / ml and incubated at 37°C for 40 min (first round of digestion). At the end of 40 min, the sample was subjected to six washes (two washes in 1x rCutSmart™ buffer, two washes in 10 mM Tris-HCl / 500 mM NaCl at pH 7.5, and 2x in 1x T4 DNA ligase buffer (New England Biolabs M0202S). During a single wash in 200 µl Tris-NaCl, a 30 µl sample of the suspended beads was collected and set aside (Sample 1). Following these washes, the Stem1 oligonucleotide-coated beads, digested with BsmFI, were subjected to a ligation reaction containing 1 µM TIIS s1hp1 labeled with Alexa-488. In this ligation reaction, T4 DNA ligase (New England Biolabs M0202S) was added at 10 units / µl, and T4 PNK (New England Biolabs M0201S) was added at 0.5 units / µl. This ligation was allowed to incubate at room temperature for 40 minutes. At this point, the reaction was subjected to the same 6x washes as described above, but during a single wash in 170 µl Tris-NaCl, a 30 µl sample of the suspended beads was collected and set aside (Sample 2). Following these washes, the beads were then subjected to a second round of digestion with BsmFI, wherein the beads and enzyme were maintained at the same concentrations as in the first digestion described above. After washing twice in 1x rCutSmart™ buffer, two additional washes were performed using 140 µl of 10 mM Tris-HCl / 500 mM NaCl at pH 7.5. During the second wash of these final washes, a 30 µl sample of the suspended beads was collected (sample 3).

[0211] Three bead samples were analyzed using two separate methods. In the first method, 2.5 µl of each bead sample was bound to a biotin-coated glass slide and then mounted for fluorescence microscopy on a Leica THUNDER wide-field microscope equipped with a 20 x 0.8 NA PLAN-apo eyepiece. Images of the three bead samples were acquired using a 488 LED light source with the exact same imaging parameters, and the fluorescence intensity of the A488 beads in the images was quantified using the Volocity® Image Analysis Package from Qurom Technologies Inc. This analysis showed that the total background subtraction intensity of the beads after the ligation reaction with TIIS s1hp1 labeled with Alexa-488 was 42-fold higher than that of the beads digested with BsmFI carrying stem1 oligonucleotides (p < 0.0001). Figure 6 (See figure). This shows that the stem1 oligonucleotide was digested on the beads by BsmFI, and the Alexa-488-tagged s1hp1 probe containing the homologous protrusion was able to ligate to this oligonucleotide. Since the Alexa-488-tagged s1hp1 probe introduces a new BsmFI site onto the stem1 oligonucleotide after ligation, this site is appropriately spaced from the encoded cleavage site downstream of the A488 tag, so a second productive cleavage event should remove the tag from the stem1 oligonucleotide. After a second digestion with the BsmFI enzyme, the beads were found to return to baseline fluorescence levels, indicating that BsmFI had recognized the BsmFI site introduced during the ligation of the Alexa-488-tagged s1hp1 probe (p < .0001) and had already cleaved the stem1 oligonucleotide at the encoded “next right” cleavage site. These results indicate that, in one cycle, the enzyme has downregulated the stem1 oligonucleotide to the next designed sequence for ligation with the “next right” tagged probe in a ratchet manner. These results indicate that one round of OCLS is performed on OCLS-barcoded oligonucleotides bound to beads.

[0212] A second method for analyzing these results was performed on a 10% TBE-urea gel (Thermo Fisher Scientific). Briefly, 15 µl of each of the above bead samples (samples 1-3) was mixed with 15 µl of 2x formamide loading dye (95% formamide, 10 mM EDTA), heated to 95°C for 5 minutes, and then placed directly on wet ice. Additionally, a fourth sample containing beads coated with undigested stem1 oligonucleotides was produced and prepared for loading onto the denaturing gel as described above. All four samples were run on the gel in 1X TBE buffer at 150 volts for 1.5 hours and then imaged on a Thermo Fisher Scientific iBright system, which allows recording of SYBR gold-stained gels and has an illumination module for imaging 488, 550, 647, and 750 dyes. Analysis of this gel showed that after digestion of beads coated with stem1 oligonucleotides (Sample 1) using BsmFI enzyme, no band corresponding to the control oligonucleotide (undigested stem1 oligonucleotide) or the expected ligation product was observed. Stem1 oligonucleotides were clearly digested by incubation with BsmFI, as evidenced by the smaller fragments on the gel. In the lane corresponding to the bead sample (Sample 2) that was first cleaved with BsmFI enzyme and subsequently ligated to the Alexa-488-labeled s1hp1 probe, a distinct band was observed in the 488 imaging channel running at approximately 60 bases, consistent with the expected size of the ligated product. This result indicates that the Alexa-488-labeled s1hp1 probe was ligated to the BsmFI-digested stem1 oligonucleotide immobilized on the beads. Finally, in the lane containing the bead sample (sample 3) that had undergone a second digestion with BsmFI, this 488-positive ligation band disappeared, indicating that the enzyme had recognized the new BsmFI site introduced by the ligation of the Alexa-488-labeled s1hp1 probe, and that the stem1 oligonucleotide had been digested at the next correctly encoded cleavage site. Thus, the enzyme has downregulated the stem1 oligonucleotide "in a ratchet manner" to the next designed sequence for ligation with the "next correct" labeled probe. These results are consistent with bead imaging analysis.

[0213] Figure 6 This illustrates the OCLS method and workflow implementation used in this example, as well as the results obtained through the methods described herein. Figure 3B The type of AF-488-labeled ssDNA hairpin probe shown (at the bottom) is an example. Labeled ssDNA hairpin probes contain encoded RS and are used for cutting... Figure 1B ( Figure 2The type depicted on the right (within the diagram) involves orthogonally linking OCLS barcodes containing multiple encoded CSs. For Figure 6 The experiment outlined in the schematic diagram involved an imaging step performed in the 488 nm (emission) channel to determine the signal intensity of the beads after the initial OCLS barcode cleaving using IIS-type RE, specifically BsmFI. Following probe attachment and subsequent washing steps, the beads were imaged in the 488 nm channel to determine the signal obtained from the tag and thus identify any exposed protrusions on the cleaved OCLS barcode. The same RS-encoded IIS-type RE (BsmFI) used in the initial cleaving reaction was also incorporated into the attached probe; therefore, this enzyme was added to the beads after subsequent washing to remove components from the previous reaction for a second digestion of the OCLS barcode. Following the second digestion and washing steps, an imaging step was performed in the 488 nm channel to determine the signal obtained from the beads. The signals obtained in all three imaging steps in the 488 nm channel are plotted on [the graph / image]. Figure 6 In the graph, the y-axis represents the relative fluorescence units (RFU).

[0214] These experiments demonstrate that probe ligation and subsequent probe cleavage were successful. The average strength value (< 1,000 RFU) of the beads after the first cleavage with BsmFI (TIIS RE cleavage 1) was almost identical to that after the second cleavage with BsmFI (TIIS RE cleavage 2), but the average strength value of the beads after ligation with AF-488-labeled ssDNA hairpin probes was approximately 33,000 RFU. Ligation reactions containing incorrectly labeled ssDNA hairpin probes (hairpin probe 3, containing incorrect protrusions for OCLS barcoding) did not produce ligation products (also determined by gel analysis).

[0215] Based on the results reported in this example, it can be extrapolated that many different beads in the library, encoded with different combinations of OCLS barcodes containing different CS, can be decoded in a highly parallel manner using the OCLS workflow described herein. This method involves ratcheting the OCLS barcodes by adding orthogonal connection probes containing encoded RS for use with IIS-type REs. In the illustrated embodiment, RS corresponding to IIS-type enzymes are used, and the individual probes used in each decoding loop contain markers for identifying, such as... Figure 6 The image shows a ssDNA hairpin oligonucleotide with a specific protrusion marking the exposed protrusion on a cut OCLS barcode.

[0216] Example 2: OCLS option for using labeled ssDNA hairpin probes

[0217] In the methods described in Example 1 and other parts of this document, optionally, different IIS-type RSs are included in each subsequent probe used in each subsequent cycle, which advantageously reduces aberrant cleavage in each cycle. This approach reduces the tendency for enzyme cleavage used in the previous cycle to survive (remain uncut) intact OCLS barcodes in digestion following the previous cleavage cycle.

[0218] Additionally, using labeled ssDNA hairpin oligonucleotides as ligation probes allows for a "clean-up" step after the ligation step, which can be performed before or after the imaging step. This clean-up step is waived when using a 5'-exonuclease (such as λ exonuclease), which recognizes and is used to digest and remove the 5'-phosphorylated ends of the strand. This optional clean-up step ensures that the digested barcode cannot interact with any subsequent enzymes or probes used in future cycles (thus excluding them from the analysis). The clean-up step removes any dsDNA left after a not 100% efficient ligation step, as the ligation product (containing labeled ssDNA hairpin oligonucleotides) can be engineered to not contain open 5'-phosphorylated ends.

[0219] Example 3: Individual segments and chains of OCLS barcodes containing standard RE sites

[0220] In another embodiment, a set of standard orthogonal restriction enzymes can be used. In this case, OCLS barcodes can be purchased from a supplier (such as IDT) as a complete construct of barcodes or barcode segments containing one or more orthogonal recognition sites (RS). These barcodes can be manufactured by, for example, […]. Figure 1A The segment construction shown in the figure can be designed for use at RS by, for example Figure 2 (Left) The site-specific restriction endonuclease (RE) shown specifically cleaves the material and can, as... Figure 4A The usage is illustrated in the diagram. In this case, decoding can be achieved by fixing the beads to a surface, such as a standard microscope slide or other surface / application favorable for identifying and / or determining the location of the features, followed by the introduction of one or more orthogonal REs (in a single reaction mixture) to bring the enzyme into contact with one or more OCLS barcodes. Figure 4AAs shown, after digestion of one or more OCLS barcodes by RE enzyme (which exposes the specific protrusions on the OCLS barcodes), a washing step (e.g., using 1X CutSmart buffer, New England Biolabs) is performed to remove the RE enzyme, followed by washing with 1X T4 DNA ligase buffer (e.g., supplied by New England Biolabs as T4 DNA ligase MO202). The 1X T4 DNA ligase buffer contains ATP and Mg. 2+ This is a key component for a successful ligation reaction. After equilibration in ligase buffer, T4 DNA ligase and polynucleotide kinase (PNK; this enzyme phosphorylates any unphosphorylated 5' end of an oligonucleotide, making it a suitable substrate for T4 DNA ligase) are introduced into a 1X T4 DNA ligase buffer containing labeled probes. This introduction can be accomplished, for example, in a flow cell equipped with a microfluidic device or in a microfluidic apparatus under instrument control software for controlling fluid flow rate and time to achieve the online imaging step. Such instrument configurations are known in the art as standard and are used in methods and systems requiring different solution circulations coordinated with imaging, such as next-generation DNA synthesis sequencing (SBS) workflows.

[0221] Here, each differentially labeled probe will contain a protrusion specific to the protrusions produced on the OCLS barcode after the digestion steps described above. Upon introduction of the enzyme ligation solution containing the differentially labeled probe, ligation will occur between the correctly matched protrusions (perfect base complementarity) of the OCLS barcode and one of the probes in the enzyme ligation solution. After incubation with the enzyme ligation solution, a washing step will be performed to remove the ligase and PNK enzyme in order to perform an imaging step. The imaging step will identify the specific protrusion sequence exposed on the OCLS barcode after the described orthogonal digestion and ligation steps. Because each orthogonal ligation probe will have a unique label or combination of labels, differentiation between different protrusions present on different OCLS barcodes can be achieved through the imaging step or by otherwise specifically identifying beads encoded by the OCLS barcode (e.g., Figure 4B This is achieved through steps associated with detectable probe marking (as shown in the diagram). Depending on the number of unique protrusions exposed on the OCLS barcode after the digestion step, which are associated with individual beads or features, the ligation and imaging steps (such as...) can be performed multiple times. Figure 4C and Figure 4D(As shown). This is because each orthogonal protrusion generated on the OCLS barcode after the digestion step must be individually distinguished (read out) by a specific probe carrying a tag or combination of tags corresponding to the matching protrusion. Multiple different protrusions on a single bead can also be distinguished in this way during a single connection event, thus enabling... Figure 4E The diagram illustrates the creation of a combination of detectable markers on OCLS barcodes. The OCLS method relies on the generation of specific orthogonal protrusions on dsDNA OCLS barcodes (orthogonality is generated through RE digestion of the OCLS barcode) and the use of probes containing both a predetermined marker and a protrusion corresponding to a detected protrusion exposed on the OCLS barcode (generating specific base complementarity with said protrusion). In this way, many individual members of a library of beads or features can be distinguished in multiple cycles, similar to those performed in a DNA sequencing workflow. In contrast, during an NGS workflow, nucleotides containing both a predetermined marker and a base corresponding to the next correct base in the induced nucleic acid template (generating specific base complementarity with said next correct base) are incorporated by a polymerase and imaged to determine which base is incorporated in each cycle. Within multiple cycles, and in a highly parallel manner, many beads or features can be sequenced by NGS or OCLS.

[0222] Example 4: Individual segments and chains of OCLS barcodes containing IIS-type RE identification sites (RS) and / or cleavage sites (CS)

[0223] As described in Example 3, OCLS barcodes may contain one or more recognition sites (RS) for cleavage by one or more standard REs, but in another embodiment, IIS-type RE enzymes may be used. IIS-type RE enzymes have RSs spaced a known number of bases from their corresponding CSs. IIS-type RE enzymes bind to their homologous RSs, and then these enzymes cleave at their corresponding CSs, leaving a known number of protruding bases. The specificity of IIS-type REs in recognizing dsDNA occurs at the RSs, but the CSs can be any set of bases; these enzymes will cleave at any designed CSs, as long as it is at the correct distance from the RSs. Therefore, OCLS barcodes can be generated with one or more CSs, without RSs, or with one or more RSs. Figure 5AAs shown, experiments can be performed whereby two distinct barcodes are linked to individual beads, which can be contained within a library of OCLS-encoded beads. Each of the two distinct OCLS barcodes on the bead can contain different combinations of RS and CS to achieve compatibility with two different (orthogonal) IIS-type enzymes. In this example, the beads can be immobilized on a surface for cycling as described in Example 2, and two different IIS-type enzymes (BsmFI and BpuEI) can be introduced into a single reaction mixture composed of mutually compatible buffers (such as New England Biolabs CutSmart buffer). Figure 5A As shown, the digestion performed by these enzymes removes the dsDNA cleavage product by cutting at its corresponding CS rather than at the RS, unlike standard REs (i.e., REs that cut within their RS). Therefore, in OCLS barcodes designed for use with IIS-type REs, the CS should be designed as long as the presence of... Figure 5B The RS shown is positioned within the barcode at the correct distance from the specific enzyme used. Figure 5B Each IIS-type enzyme substrate (OCLS barcode shown below, with the BsmFI-specific barcode shown above the BpuEI-specific barcode at the bottom) will be cut at a CS position at a known number of bases from RS, leaving a known number of bases at the resulting protrusion on the barcode after digestion. Following IIS-type enzyme cutting, a washing step (e.g., using 1X CutSmart buffer from NEB) can be performed to remove the enzyme and cutting products, followed by equilibration with 1X T4 DNA ligase buffer before the ligation step.

[0224] In this example, and as Figure 5CAs shown, the two distinguishable protrusions on each feature would require two cycles of labeled probe ligation and imaging to identify the two distinct protrusions produced after digestion. However, in this example, the probe will not only contain the same distinguishable label and corresponding protrusions as in Example 3, but will also contain additional RSs for the IIS type RE (as demonstrated in Example 1 using ssDNA hairpin ligation probes). After the ligation and imaging steps, the newly introduced RSs will be ligated to the correct OCLS barcode via the matching protrusions by the probes to create a new “box” for the IIS type enzyme (the RS positioned at an appropriate distance from the next CS in the OCLS barcode). A washing step can be performed using 1X CutSmart buffer before introducing the IIS type enzyme for the next digestion cycle. This process of down-regulating the OCLS barcode “in a ratchet manner” with one designed CS per cycle can be achieved by encoding the new IIS type enzyme RSs within the introduced labeled ligation probes. This was demonstrated in Example 1 using labeled ssDNA hairpin oligonucleotides containing BsmFI sites, which are capable of cleaving the barcode a second time after the ligation step. Examples of oligonucleotides that can be used as barcodes are included in this manner (TIIS stem1; SEQ ID NO: 1 and 2, TIIS stem2; SEQ ID NO: 12 and 13), and corresponding probe oligonucleotides that can be used to read OCLS barcodes are included in this manner (TIIS stem1 probe; SEQ ID NO: 3-11, TIIS stem2 probe; SEQ ID NO: 14-19).

[0225] The description provided herein is included to illustrate specific embodiments of this disclosure. Based on this disclosure, those skilled in the art will recognize that many changes can be made to the specific embodiments disclosed herein without departing from the spirit and scope of this disclosure and still obtaining similar or analogous results.

[0226] Concluding paragraph

[0227] As will be understood by those skilled in the art, each embodiment disclosed herein may include, consist of, or be composed of the elements, steps, ingredients, or components specifically stated herein. Therefore, the terms “include” or “including” should be interpreted as stating: “comprise,” “compose of,” or “consistently constitute.” The transitional terms “comprise” or “comprises” mean having, but not limited to, and allow the inclusion of unspecified elements, steps, ingredients, or components, even if they constitute a major portion. The transitional phrase “composes of” excludes any unspecified elements, steps, ingredients, or components. The transitional phrase “consistently constitutes” limits the scope of the embodiment to the specified elements, steps, ingredients, or components, and restricts them to elements, steps, ingredients, or components that do not materially affect the embodiment.

[0228] Unless otherwise specified, all figures representing amounts of components, properties such as molecular weight, and reaction conditions used in this specification and claims should be understood to be modified by the term "about" in all cases. Therefore, unless indicated to the contrary, the numerical parameters set forth in the specification and appended claims are approximations that can vary depending on the desired properties sought to be obtained according to the invention. At least, and not at all, the application of the equivalence principle is limited to the scope of the claims, and each numerical parameter should be interpreted at least according to the number of significant figures reported and by applying ordinary rounding techniques. When further clarification is required, the term "about" has the meaning reasonably assigned to it by one of skill in the art when used in conjunction with the stated numerical value or range, namely, slightly greater than or slightly less than the specified value or range, within ±20% of the specified value; within ±19% of the specified value; within ±18% of the specified value; within ±17% of the specified value; within ±16% of the specified value; within ±15% of the specified value; within ±14% of the specified value; within ±13% of the specified value; within ±12% of the specified value; within ±11% of the specified value; within ±10% of the specified value; within ±9% of the specified value; within ±8% of the specified value; within ±7% of the specified value; within ±6% of the specified value; within ±5% of the specified value; within ±4% of the specified value; within ±3% of the specified value; within ± Within 2%; or within ± 1% of the specified value.

[0229] Although the numerical ranges and parameters illustrating the broad scope of the invention are approximate, the values ​​described in specific examples are reported as precisely as possible. However, any numerical value inherently contains some error, which is necessarily caused by the standard deviation found in its corresponding test measurement.

[0230] Unless otherwise specified herein or obviously contradicted by the context, the terms “a,” “an,” “the,” and similar pronouns used in the context of describing the invention (particularly in the context of the following claims) should be interpreted as encompassing both the singular and plural. The description of ranges of values ​​herein is intended only as a simplified way of referring individually to each individual value falling within the stated range. Unless otherwise specified herein, each individual value is incorporated into this specification as if each individual value were separately referenced herein. Unless otherwise indicated herein or obviously contradicted by the context, all methods described herein can be performed in any suitable order. Unless otherwise required, the use of any and all example or exemplary language (e.g., “such”) provided herein is intended only to better illustrate the invention and does not constitute a limitation on the scope of the otherwise claimed invention. No language in the specification should be construed as indicating that any unclaimed element is necessary for practicing the invention.

[0231] The grouping of alternative elements or embodiments of the invention disclosed herein should not be construed as limiting. Each member of a group may be cited and protected individually or in any combination with other members of the group or other elements present herein. For convenience and / or patentability reasons, it is contemplated that one or more members of a group may be included in or removed from the group. When any such inclusion or removal is made, the specification shall be regarded as containing the modified group, thereby satisfying the written description of all Markush groups as used in the appended claims.

[0232] This document describes certain embodiments of the invention, including the best modes known to the inventors for carrying out the invention. Of course, variations of these described embodiments will become clear to those skilled in the art upon reading the foregoing description. The inventors expect those skilled in the art to adopt these variations where appropriate, and the inventors intend to practice the invention in ways different from those specifically described herein. Therefore, the invention includes all modifications and equivalents to the subject matter set forth in the appended claims, where permitted by applicable law. Furthermore, the invention covers any combination of the foregoing elements in all possible variations, unless otherwise stated herein or otherwise clearly contradicted by the context.

[0233] Furthermore, extensive references are made throughout this specification to patents, print publications, magazine articles, other written texts, and website content (references herein). Each reference is incorporated herein by means of a full citation, starting from the filing date of the first application in the priority chain that includes the specific reference, for illustrative purposes. For example, regarding chemical compounds, nucleic acid, and amino acid sequences cited herein that are available in public databases, information from the database entries is incorporated herein by reference from the application date in the priority chain, whereby the database identifier of the compound or sequence is included in the text for the first time.

[0234] It should be understood that the embodiments of the invention disclosed herein are illustrative of the principles of the invention. Other modifications that may be made are also within the scope of the invention. Therefore, alternative configurations of the invention may be utilized based on the teachings herein, by way of example and not limitation. Thus, the invention is not limited to exactly as shown and described.

[0235] The details shown herein are by way of example only and for the purpose of illustrative discussion of preferred embodiments of the invention, and are presented to provide a description that is considered most useful and readily understood of the principles and concepts of various embodiments of the invention. In this regard, no attempt is made to show the structural details of the invention in more detail than is necessary for a basic understanding of the invention; the description, taken in conjunction with the accompanying drawings and / or examples, makes it clear to those skilled in the art how various forms of the invention can be embodied in practice.

[0236] Unless explicitly and clearly modified in the instance, or when the application of the meaning renders any construction meaningless or substantially meaningless, the definitions and interpretations used in this disclosure are intended and aimed at controlling any future constructions. If the construction of a term would render it meaningless or substantially meaningless, the definition should be taken from the 11th edition of Webster's Dictionary or a relevant dictionary known to a person skilled in the art, such as the 2nd edition of the Oxford Dictionary of Biochemistry and Molecular Biology (edited by Anthony Smith, Oxford University Press, Oxford, 2006) and / or the 8th edition of a Dictionary of Chemistry (edited by J. Law and R. Rennie, Oxford University Press, 2020).

Claims

1. A visual barcode, comprising: At least two or more double-stranded DNA (dsDNA) oligonucleotide segments (cassettes), wherein the at least two or more dsDNA oligonucleotide segments are functionally linearly linked to each other, and each dsDNA oligonucleotide segment contains within the sequence of the dsDNA segment: Targeting the recognition site (RS) of a specific restriction endonuclease (RE), Designed cut site (CS), or Both RS and CS; as well as The untethered end is located at one end of the visual barcode.

2. The visual barcode of claim 1, wherein it is tethered to a solid substrate by a flexible connector, the flexible connector being connected to or near an end of the dsDNA of the visual barcode, the end being not the untethered end.

3. The visual barcode according to claim 1, which does not contain visually detectable markings.

4. The visual barcode according to claim 1, wherein the RE is an IIS type restriction endonuclease, and the CS does not overlap with the corresponding RS.

5. The visual barcode of claim 1, wherein at least one of the dsDNA segments comprises a designed CS, and the visual barcode comprises an RS specific to IIS-type REs, the RS being appropriately positioned such that homologous IIS-type REs can cleave the designed CS based on their positioning relative to the RS.

6. The visual barcode according to any one of claims 1 to 5, as shown in FIG1A or FIG1B or generally as described herein.

7. A collection of visual barcodes according to any one of claims 1 to 6, wherein the collection comprises a plurality of visual barcodes, each of the plurality of visual barcodes containing a different set of dsDNA segments having a different recognition site (RS), a designed cleavage site (CS), or both for a specific restriction endonuclease (RE).

8. The set of visual barcodes according to claim 7, wherein at least two visual barcodes of different visual barcodes are tethered to the same solid substrate.

9. An orthogonal cut ligation sequencing (OCLS) barcode comprising two or more dsDNA segments (cassettes), each dsDNA segment containing a recognition site (RS) for a specific restriction endonuclease (RE) and one or more overlapping regions, said one or more overlapping regions being configured to allow ligation with flanking dsDNA segments to form a strand of the segment, said strand constituting the OCLS barcode.

10. A visually detectable orthogonal connection probe, comprising: A complete or partial double-stranded DNA oligonucleotide, wherein the complete or partial double-stranded DNA oligonucleotide has a 3' or 5' overhang of at least two nucleotides, the sequence of which includes: Targeting the recognition site (RS) of a specific restriction endonuclease (RE), Designed cut site (CS), or Both RS and CS; as well as A visually detectable marker covalently linked to the complete or partial dsDNA oligonucleotide.

11. The visually detectable orthogonal linkage probe of claim 10, wherein the complete or partial double-stranded DNA oligonucleotide comprises: Linear double-stranded DNA oligonucleotides with 5' protrusions; Linear double-stranded DNA oligonucleotides with 3' protrusions; Single-stranded DNA oligonucleotides with a hairpin stem-loop configuration having a 5' protrusion; or Single-stranded DNA oligonucleotides with a hairpin stem-loop configuration having a 3' protrusion.

12. The visually detectable orthogonal linkage probe of claim 10, wherein the visually detectable marker is connected to the oligonucleotide via a flexible connector.

13. The visually detectable orthogonal connection probe according to claim 10, wherein the visually detectable marker comprises one or more of fluorescent markers, bioluminescent markers, chemiluminescent markers, chromophores, quantum dots, Raman markers, biotin moieties, or radioactive isotopes.

14. The visually detectable orthogonal linkage probe of claim 10, wherein the RE is an IIS-type restriction endonuclease, and the RS is specific for the IIS-type RE.

15. The visually detectable orthogonal connection probe of claim 10, comprising an RS specific to IIS-type REs, the RS being appropriately positioned so that homologous IIS-type REs can cut the designed CS based on their positioning relative to the RS.

16. The visually detectable orthogonal connection probe according to any one of claims 10 to 15, as shown in Figure 3A or Figure 3B or generally as described herein.

17. A collection of visually detectable orthogonal linkers according to any one of claims 10 to 16, wherein the collection comprises a plurality of visually detectable orthogonal linkers, each of the plurality of visually detectable orthogonal linkers containing either a different recognition site (RS) or a different RS and a different cleavage site (CS) for a specific restriction endonuclease (RE).

18. The set of visually detectable orthogonal connection probes according to claim 17, wherein at least two of the different detectable orthogonal connection probes contain visually distinguishable detectable markers.

19. The set of visually detectable orthogonal connection probes according to claim 18, comprising a plurality of different probes, each of the plurality of different probes being configured such that cutting the probe with the RE produces a protrusion with a sequence different from the sequence of at least 5, at least 7, at least 10, at least 12, at least 15 or more other probes in the set.

20. An orthogonal cleavage ligation sequencing (OCLS) oligonucleotide pair, comprising: A visual barcode, the visual barcode comprising: At least two or more double-stranded DNA (dsDNA) oligonucleotide segments (cassettes), wherein the at least two or more dsDNA oligonucleotide segments are functionally linearly linked to each other, and each dsDNA oligonucleotide segment contains within the sequence of the dsDNA segment: Targeting the recognition site (RS) of a specific restriction endonuclease (RE), Designed cut site (CS), or Both RS and CS; as well as The untethered end is located at one end of the visual barcode; as well as Visually detectable orthogonal connection probe, the visually detectable orthogonal connection probe comprising: A complete or partial double-stranded DNA oligonucleotide, wherein the complete or partial double-stranded DNA oligonucleotide has a 3' or 5' overhang of at least two nucleotides, the sequence of which includes: Targeting the recognition site (RS) of a specific restriction endonuclease (RE), or Both RS and cleavage site (CS); as well as A visually detectable marker covalently linked to the complete or partial dsDNA oligonucleotide; The cutting of the RS or CS in the visual barcode produces a single-chain "sticky end" protrusion, which has a sequence that is completely complementary to the sticky end (protrusion) produced by cutting the RS in the visually detectable orthogonal connection probe.

21. A set of OCLS oligonucleotide pairs according to claim 20, wherein each pair of visual barcodes and visually detectable orthogonal linking probes has different fully complementary sequence overlaps, and each visually detectable orthogonal linking probe contains different visually distinguishable detectable markers.

22. A method for encoding a visual barcode, the method comprising: A double-stranded DNA (dsDNA) oligonucleotide tethered to a solid carrier at a first end is contacted with a first dsDNA segment, the dsDNA oligonucleotide having a single-stranded overhang at a second untethered end, the first dsDNA segment having a first overhang and a second overhang compatible with binding to the single-stranded overhang of the tethered dsDNA oligonucleotide, and containing within the sequence of the first dsDNA segment: Targeting the recognition site (RS) of a specific restriction endonuclease (RE), Designed cut site (CS), or Both RS and CS; The contact occurs under conditions sufficient to allow specific hybridization between the single-stranded protrusion of the first dsDNA segment and the single-stranded protrusion of the tethered dsDNA oligonucleotide; The first dsDNA segment is linked to the tethered dsDNA oligonucleotide to form a first captured barcode segment, the first captured barcode segment including the second overhang of the first dsDNA segment; The first captured barcode segment is contacted with a second dsDNA segment, the second dsDNA segment having a first protrusion and a second protrusion compatible with binding to the single-stranded protrusion of the oligonucleotide of the first captured barcode segment, and containing within the sequence of the second dsDNA segment: The RS / RE in the first dsDNA segment is different from the RS / RE in the specific RE. CS designs different from those in the first dsDNA segment, or Both; as well as The second dsDNA segment is linked to the first captured barcode segment to form a second captured barcode segment, the second captured barcode segment including the second protrusion of the second dsDNA segment, and the first captured barcode segment and the second captured barcode segment constitute the visual barcode.

23. The method of claim 22, further comprising repeating the contact and connection step one or more times, each time connecting an additional dsDNA segment to the captured barcode segment to form the visual barcode.

24. The method of claim 22 or 23, wherein at least one of the dsDNA segments comprises a designed CS, and the visual barcode comprises an RS specific to IIS-type REs, the RS being appropriately positioned so that homologous REs can cleave the designed CS based on their positioning relative to the RS.

25. The method according to any one of claims 22 to 24, as shown in FIG1A or FIG1B or as described herein.

26. The method of claim 24, wherein the visual barcode is constructed using unlabeled DNA segments through multiple rounds of splitting and merging.

27. The method of claim 26, wherein the splitting and merging of one or more rounds comprises: One barcode box is attached to the bead at a time; The resulting beads are separated into individual compartments, optionally into floor holes; Different first-compartment-specific barcode boxes are attached to the beads in each individual compartment to obtain a set of beads containing two different pairs of barcode boxes; Wash the beads containing two barcode boxes; The beads containing two barcode boxes are combined; The combined beads containing two barcode boxes are separated into individual compartments, optionally through floor holes; as well as Repeat the connecting, washing, merging, and splitting steps to increase the diversity of the set of barcodes.

28. The method according to any one of claims 22 to 27, wherein the visual barcode comprises a continuous strand of dsDNA segments (cassettes), or the visual barcode comprises at least two separate cassettes directly and individually connected to the solid carrier.

29. The method according to any one of claims 22 to 28, wherein the segment is co-encoded together with the next-generation sequencing (NGS) capture barcode.

30. A visual barcode, which is prepared by the method according to any one of claims 22 to 29.

31. A method for decoding a visual barcode, the method comprising: In a certain environment, at least one double-stranded DNA (dsDNA) orthogonal cut ligation sequencing (OCLS) barcode containing at least one restriction site (RS) is contacted with a restriction endonuclease (RE) that recognizes the RS under conditions sufficient to cause the RE to cut the dsDNA OCLS barcode. RS / RE cutting produces single-stranded overhangs, thereby producing a partial single-stranded (ss) DNA-partial dsDNA OCLS barcode. If the sequence of the protrusion of at least one orthogonal linker probe containing a dsDNA oligonucleotide with a protrusion at a first end and a visually detectable marker is the reverse complementary sequence of the protrusion sequence of the OCLS barcode of the partial ssDNA-partial dsDNA, then the OCLS barcode of the partial ssDNA-partial dsDNA is contacted with the orthogonal linker probe under conditions sufficient to allow the protrusion of the orthogonal linker probe to bind to the protrusion on the OCLS barcode of the partial ssDNA-partial dsDNA via base pair-mediated hydrogen bonding; If base pair-mediated binding occurs, then the orthogonal linking probe is ligated to the OCLS barcode of the partial single-stranded (ss) DNA-partial dsDNA to generate a captured probe; and The presence, absence, and / or quantity of the captured probes are detected by imaging the visually detectable markers.

32. The method of claim 31, further comprising repeating the contact / cleavage, contact / base pair-mediated binding, ligation, and detection steps one or more times, wherein each additional cycle involves cleavage of the dsDNA OCLS barcode at a different cleavage site (CS), base pair-mediated binding of different orthogonal ligation probes, and / or detection of the presence, absence, and / or quantity of different labeled capture probes.

33. The method of claim 31, wherein one or more of the following are true: The dsDNA OCLS barcode is attached to beads or other solid surfaces; Multiple different dsDNA OCLS barcodes are linked to a single address on a single bead or another solid surface; The dsDNA OCLS barcode contains more than one non-overlapping RS; At least one RS in the dsDNA OCLS barcode is recognized by the IIS type RE, and cleavage occurs at a predetermined location outside the RS; At least one RS in the dsDNA OCLS barcode is identified by a RE that is cleaved within the RS; or The visually detectable marker includes at least one of fluorescent markers, bioluminescent markers, chemiluminescent markers, chromophores, quantum dots, Raman markers, or radioactive isotopes.

34. The method of claim 32, wherein one or more of the following are true: The orthogonal connection probe comprises a single-stranded DNA oligonucleotide with a stem-loop hairpin structure, wherein the protrusion is located at the end of the hairpin's stem.

35. The method of claim 34, further comprising, after ligation, contacting the environment containing the captured probe with a 5'-exonuclease.

36. The method of claim 32, comprising one or more of the following: The at least one dsDNA OCLS barcode is sequentially contacted with two or more REs that each recognizes a different non-overlapping RS within the dsDNA OCLS under conditions sufficient to cause each RE to cleave the dsDNA OCLS barcode, and each RS / RE cleavage produces a single-stranded overhang, thereby producing a partial single-stranded (ss) DNA-partial dsDNA OCLS barcode. The connection includes a chemical connection; or The connection includes enzyme-mediated connections.

37. The method of claim 31, comprising: Two or more dsDNA OCLS barcodes, each containing at least one RS, are brought into contact with an RE that identifies the RS under conditions sufficient to cause the RE to cleave the dsDNA OCLS barcode. The RS / RE cleavage produces single-stranded overhangs, thereby producing a partial single-stranded (ss) DNA-partial dsDNA OCLS barcode, wherein the RS / RE is different for each dsDNA OCLS barcode.

38. The method of claim 37, further comprising contacting the two or more dsDNA OCLS barcodes with two or more orthogonal REs.

39. The method of claim 38, wherein the contact with two or more orthogonal REs is simultaneous or sequential.

40. The method of claim 39, wherein after contact with one or more orthogonal REs, the differentially labeled probes are linked using a specific orthogonal reaction.

41. The method of claim 40, wherein the specific orthogonal connection of the differentially labeled probes enables visual differentiation of the barcode at each feature in the visual barcode array.

42. The method of claim 31, wherein connecting the orthogonal linking probe to the OCLS barcode of the partial ssDNA-partial dsDNA will add a new RS to the resulting captured probe.

43. A method for decoding visual barcodes using orthogonal cut-link sequencing (OCLS) generally as described herein.

44. An improved system for molecular barcode encoding, the system comprising a cycle of repeating labeling, orthogonal cutting, ligation, and imaging to identify individual features, wherein the orthogonal cutting comprises cutting the double-stranded DNA barcode with an IIS-type restriction endonuclease.

45. The system of claim 44, wherein two or more markers and orthogonal probes are connected in a cyclical or simultaneous manner.

46. ​​An orthogonal cut ligation sequencing (OCLS) system, as shown in Figures 5A-5E.

Images