Application of camellia glycoside B in preparation of anti-aging and whitening products

Abstract

The invention belongs to the field of skin medicine, and discloses application of camellia glycoside B in preparation of anti-aging products. The camellia glycoside B has a remarkable anti-aging effect on skin cells damaged by ultraviolet rays, and has remarkable effects of inhibiting generation of active oxygen and activating autophagy on the skin cells damaged by the ultraviolet rays. The invention discloses an application of camellia glycoside B in preparation of a whitening product. Camellia glycoside B can reduce melanogenesis and inhibit tyrosinase activity, can inhibit melanosome from being transferred from melanocytes to cuticle cells, and has a whitening effect.

Description

Technical Field

[0001] This invention belongs to the field of dermatology and relates to the application of camelliaside B in the preparation of anti-aging and whitening products, particularly the application of camelliaside B in repairing photoaging and whitening the skin. Background Technology

[0002] Skin aging is the result of a complex interplay of multiple factors, manifesting as histological and functional damage to the skin. Skin aging is generally divided into endogenous aging and exogenous aging. The former, or natural aging (the inevitable result of aging), is determined by genes; the latter refers to skin aging caused by environmental factors such as solar radiation, air pollution, or exposure to toxic or harmful chemicals. Solar radiation is the primary influencing factor, hence exogenous skin aging is also known as photoaging. Solar wavelengths include ultraviolet (UV), visible, and infrared light. Among these, UV light is the most damaging to the skin. Photoaging primarily occurs on skin exposed to UV radiation, often manifesting as dull skin color, appearing yellow or grayish-yellow; skin laxity, decreased elasticity, dryness, roughness, flaking, and increased sensitivity. Over time, this is accompanied by pigmentation abnormalities such as age spots or freckles. Simultaneously, UV radiation stimulates melanocytes in the skin to secrete more melanin, which is then distributed upwards to the stratum corneum of the epidermis, forming dark spots or sunspots. This is a self-protective mechanism of the skin against UV radiation, but it can also affect skin whitening effects.

[0003] Recent studies have shown that UV radiation has a significant impact on autophagy levels. Autophagy is the main pathway by which eukaryotic cells degrade their own cytoplasmic proteins or organelles through lysosomes, playing a crucial role in the aging process of organisms. Research indicates that the body can activate autophagy to remove erroneous or damaged organelles and proteins, thereby promoting cell renewal and ultimately slowing down the aging process. As part of the organism, human skin tissue's aging process is also closely related to autophagy.

[0004] Camellia glycoside B is a natural component discovered in camellia oil, belonging to the polyphenol class of compounds, with the molecular formula: C. 32 H 38 O 19 Relative molecular weight: 726.63, structural formula as shown below:

[0005] .

[0006] Current research reports that camelliaside B possesses anti-inflammatory properties, reducing inflammatory responses and alleviating pain and discomfort caused by inflammation. Camelliaside B can also lower cholesterol levels, preventing atherosclerosis and cardiovascular disease. However, there are no reports on the effects of camelliaside B in repairing skin aging and whitening the skin. Summary of the Invention

[0007] The purpose of this invention is to provide the application of camelliaside B in the preparation of anti-aging and skin-whitening products. Camelliaside B can effectively repair photoaging and inhibit melanin production, and has broad market application prospects.

[0008] To achieve the above objectives, the present invention provides the following technical solution:

[0009] Application of camelliaside B in the preparation of anti-aging products.

[0010] Furthermore, the aging described herein is exogenous aging.

[0011] Furthermore, the aforementioned extrinsic aging refers to photoaging of the skin.

[0012] Specifically, the aging referred to is photoaging of the skin caused by ultraviolet light exposure.

[0013] Furthermore, the application is the use of camelliaside B in the preparation of products that exert anti-aging effects by performing at least one of the following actions: activating autophagy, inhibiting oxidative stress, and inhibiting skin collagen degradation.

[0014] Furthermore, the application is the use of camelliaside B in the preparation of products that exert anti-aging effects by performing at least one of the following actions: activating autophagy, inhibiting oxidative stress, inhibiting the expression of skin collagen degradation-related proteins, and inhibiting the expression of aging-related proteins.

[0015] The skin collagen degradation-related proteins are MMP-1 and MMP-9; the aging-related proteins are p21 and p16.

[0016] Application of camelliaside B in the preparation of anti-aging products.

[0017] Furthermore, the whitening effect described refers to repairing skin darkening caused by ultraviolet light exposure.

[0018] Furthermore, the application is the use of camelliaside B in the preparation of products that achieve whitening by exerting at least one of the following effects: inhibiting melanin production and inhibiting the transfer of melanosomes.

[0019] The inhibition of melanin production is achieved by suppressing the expression of proteins related to melanin production.

[0020] Furthermore, the anti-aging and / or whitening products include cosmetics, medical aesthetic products, or pharmaceuticals.

[0021] Furthermore, the cosmetics mentioned are selected from serums, lotions, essences, creams, toners, toners, face creams, masks, sunscreens, eye creams, sprays, sunscreens, foundations, or body lotions.

[0022] Furthermore, the medical aesthetic products mentioned are selected from serums, dressings, cold compresses, gels, sponges, films, hyaluronic acid injections, implants, lotions, creams, or ointments.

[0023] Furthermore, the drug uses camelliaside B as the active ingredient or the main active ingredient, and also includes pharmaceutically acceptable excipients.

[0024] Furthermore, the pharmaceutically acceptable excipients include at least one of the following: diluents, binders, wetting agents, lubricants, disintegrants, solvents, emulsifiers, cosolvents, solubilizers, preservatives, pH adjusters, osmotic pressure adjusters, surfactants, coating materials, antioxidants, antibacterial agents, and buffers.

[0025] Furthermore, the dosage form of the medicine is selected from at least one of granules, capsules, powders, tablets, pills, emulsions, suspensions, syrups, ointments, injections, suppositories, aerosols, gels, patches, and drops.

[0026] Furthermore, the route of administration of the drug includes at least one of sublingual administration, oral administration, skin administration, injection administration, and spray administration.

[0027] A topical preparation for repairing photoaging and / or whitening the skin, wherein the active ingredient of the topical preparation is camelliaside B.

[0028] Furthermore, the mass percentage of kaempferol in the topical preparation is 1-5%.

[0029] The present invention has the following beneficial effects:

[0030] (1) Camellia glycoside B has no cytotoxicity and good safety.

[0031] (2) Camellia glycoside B has a significant anti-aging effect on skin cells damaged by ultraviolet radiation. Camellia glycoside B has a significant inhibitory effect on the production of reactive oxygen species and an activation effect on autophagy in skin cells damaged by ultraviolet radiation.

[0032] (3) Camellia glycoside B can reduce melanin production and inhibit tyrosinase activity, as well as inhibit the expression of melanin production-related genes. It can also inhibit the transfer of melanosomes from melanocytes to keratinocytes, thus having a whitening effect.

[0033] (4) Camellia glycoside B has good water solubility, is easy to add and prepare a variety of formulations, can be produced on a large scale, and can be used to prepare cosmetics, medical beauty products or pharmaceuticals to help prevent and / or repair photodamaged skin, and has broad market application prospects. Attached Figure Description

[0034] Figure 1 The wavelength of α is the ultraviolet absorption wavelength of cambogia glycoside B.

[0035] Figure 2 To screen for the optimal UVB (wavelength range 275~320 nm) irradiation dose for modeling, *p<0.05, ***p<0.001, ****p<0.0001.

[0036] Figure 3 The effect of kaempferol B on HaCaT cell viability was calculated as follows: *p<0.05, ***p<0.001, ****p<0.0001.

[0037] Figure 4 The effect of camelliaside B on the expression levels of MMP-1 and MMP-9 proteins in photoaged HaCaT cells was investigated. In this study, A represents the expression levels of MMP-1 and MMP-9 in HaCaT cells of each group as detected by Western blot; B represents the relative expression level of MMP-1; and C represents the relative expression level of MMP-9. *p<0.05, **p<0.01, ***p<0.001.

[0038] Figure 5 Microscopic images showing the number of β-galactosidase-positive cells in HaCaT cells of each group; where A represents the change in SA-β-Gal (β-galactosidase) activity level in HaCaT cells of each group, the scale bar in the figure is 200 μm, and the magnification is 10×10; B represents the relative expression level of SA-β-Gal activity; **p<0.01, ****p<0.0001.

[0039] Figure 6 The expression levels of aging-related proteins p16 and p21 in HaCaT cells of each group are shown in Figure 1. A represents the expression of p21 and p16 in HaCaT cells of each group as detected by Western blot; B represents the relative expression of p21; and C represents the relative expression of p16. **p<0.01.

[0040] Figure 7 The fluorescence expression levels of the aging marker γ-H2AX in HaCaT cells of each group are shown in Figure A. A represents the expression of γ-H2AX in HaCaT cells of each group as detected by immunofluorescence. The scale bar in the figure is 100 μm, and the magnification is 20×20. B represents the relative expression of γ-H2AX. ***p<0.001, ****p<0.0001.

[0041] Figure 8The values ​​represent the protein secretion levels of p62 and Beclin1 in HaCaT cells of each group; where A represents the expression of p62 and Beclin1 in HaCaT cells of each group as detected by Western blot, B represents the relative expression of p62, and C represents the relative expression of Beclin1; *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0042] Figure 9 The results show the gene expression levels of p62 and BECN1 in HaCaT cells of each group; where A represents the relative expression of BECN1 in HaCaT cells of each group detected by RT-qpcr, and B represents the relative expression of p62 in HaCaT cells of each group detected by RT-qpcr; *p<0.05, **p<0.01, ***p<0.001.

[0043] Figure 10 The images show fluorescence micrographs of ROS content in HaCaT cells of each group; where A represents the ROS content in HaCaT cells of each group detected by fluorescence microscopy, with scale bars of 100 μm and magnification of 10×10; B represents the relative expression of ROS; *p<0.05, ***p<0.001.

[0044] Figure 11 The results show the melanin content in PIG1 melanocytes of each group; **p<0.01, ***p<0.001.

[0045] Figure 12 The expression levels of MITF and TYR, proteins related to melanin production, in PIG1 melanocytes of each group are shown in Figure 1. A represents the expression of TYR and MITF in PIG1 cells of each group as detected by Western blot, B represents the relative expression of TYR, and C represents the relative expression of MITF. *p<0.05, **p<0.01, ***p<0.001.

[0046] Figure 13 Fluorescence micrographs show the transfer of mature melanosomes (labeled with CMTPX) from PIG1 melanocytes (using CMTPX fluorescence) to keratinocytes (labeled with CMFDA fluorescence) via dendritic structures. The scale bars in the images are all 20 μm, and the magnification is 40×40.

[0047] Figure 14 This is a schematic diagram illustrating the mechanism by which UVB irradiation promotes HaCaT aging and the transfer of mature melanosomes from PIG1 melanocytes to HaCaT. Detailed Implementation

[0048] The technical solution of the present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0049] Experimental methods not specified in the examples are generally performed under standard conditions or as recommended by the manufacturer.

[0050] Unless otherwise specified, all materials and reagents used in the examples are obtained commercially.

[0051] In this embodiment, the wavelength of the UVB light source used for UVB irradiation is 312 nm.

[0052] Example 1

[0053] Assessment of the anti-photoaging potential of camelliaside B

[0054] Camellia glycoside B was dissolved in DMSO by ultrasonication to obtain a 20 μg / mL solution. 3 mL of this solution was placed in a quartz cuvette, and ultraviolet absorption spectroscopy was immediately performed at 220–420 nm. The change in the molar absorptivity of camellia glycoside B in the UV band was observed by ultraviolet absorption spectroscopy, which also allowed for the assessment of its absorption capacity for ultraviolet light in the 275–320 nm (UVB band) wavelength range, thus evaluating its photoprotective potential. Results are as follows: Figure 1 As shown, camelliaside B exhibits a certain degree of ultraviolet absorption. In the UVB band, camelliaside B has a higher molar absorptivity. Therefore, camelliaside B has the potential to combat photoaging.

[0055] Example 2

[0056] Selecting the optimal UVB power

[0057] HaCaT cells were collected at a density of 3 × 10⁶ cells per well. 3 Cells were seeded in 96-well plates and cultured in DMEM complete medium. After cell attachment, the medium was discarded, and the cells were washed twice with PBS (pH = 7.4). The cells were then starved in DMEM basal medium for 12 h, the medium was discarded, and a small amount of PBS was added to cover the cells. The cells were then irradiated with different doses (0 mJ / cm²). 2 20 mJ / cm 2 40 mJ / cm 2 60mJ / cm 2 80 mJ / cm 2Cells were irradiated with UVB (wavelength 312 nm) for 300 s, PBS was discarded, and cells were cultured in DMEM basal medium. Blank wells without inoculated cells were included to eliminate background differences in detection. Cells in each group were cultured for 24 h after irradiation, and 100 μL of 10% CCK-8 solution was added to each well. After incubation for 30 min, the absorbance (OD) value at 450 nm was measured using a microplate reader. The cell proliferation fold of each group was calculated and plotted. The irradiation dose that significantly inhibited HaCaT cell proliferation without causing significant cell death was selected as the irradiation dose for constructing the HaCaT cell photoaging model.

[0058] Cell viability = [(OD value of experimental group - OD value of blank well) / (OD value of blank group - OD value of blank well)] × 100%

[0059] Data were analyzed using one-way ANOVA and the Turkey test; *p<0.05, ***p<0.001, ****p<0.0001, compared with the control group (no UVB irradiation, i.e., UVB irradiation dose of 0 mJ / cm). 2 )Compare.

[0060] For details on the effects of different UVB irradiation doses on HaCaT cell survival, please refer to [link to relevant documentation]. Figure 2 .Depend on Figure 2 It can be seen that: compared with the control group (no UVB irradiation group), the UVB irradiation dose is 20 mJ / cm². 2 At that time, the survival rate of HaCaT cells was over 90%, even with an irradiation dose of 40 mJ / cm². 2 At that time, the survival rate remained above 75%, however, at an irradiation dose of 60 mJ / cm², the survival rate decreased. 2 At that time, the survival rate of HaCaT cells decreased significantly, dropping to 30%, even at an irradiation dose of 80 mJ / cm². 2 At that time, only 5% of the cells survived. Therefore, 40 mJ / cm² was selected. 2 300 s of UVB irradiation was used as the irradiation dose for the HaCaT cell photoaging model group.

[0061] Example 3

[0062] Investigating the effects of different concentrations of camelliaside B on the proliferation of HaCaT cells

[0063] HaCaT cells were collected at a ratio of 1 × 10⁶ cells per well. 4 Cells were seeded in 96-well plates and divided into a blank group (0 μM of cambogia glycoside B) and groups with different concentrations of cambogia glycoside B. They were cultured in DMEM complete medium and blank wells without seeded cells were set up to eliminate background differences in detection.

[0064] Camellia glycoside B stock solution with a concentration of 80 mM was prepared using DMSO. 1.2 μL of the camellia glycoside B stock solution was placed in a 1.5 mL EP tube and diluted to 80 μM with 1200 μL of DMEM basal medium. Then, it was half-diluted until the minimum concentration was 0.625 μM to obtain DMEM basal medium containing different concentrations of camellia glycoside B.

[0065] When the cells reached 60-70% confluence, the complete culture medium was discarded, and the cells were starved in DMEM basal medium for 12 h. Then, DMEM basal medium containing different concentrations of camucoside B or DMEM basal medium (blank group) was added and incubated for 24 h. 100 μL of 10% CCK-8 solution was added to each well and incubated for 30 min. The absorbance (OD) value at 450 nm was measured with a microplate reader, and the cell viability of each group was calculated and plotted.

[0066] Cell viability = [(OD value of experimental group - OD value of blank well) / (OD value of blank group - OD value of blank well)] × 100%

[0067] For details on the effects of different concentrations of camelliaside B on the survival rate of HaCaT cells, please refer to [link / reference needed]. Figure 3 .Depend on Figure 3 The results showed that, compared with the control group, the survival rate of HaCaT cells was 86.78 ± 2.08% at 40 μM and 85.83 ± 0.98% at 80 μM. Furthermore, the survival rate of HaCaT cells remained above 90% at concentrations below 40 μM. This indicates that camelliaside B exhibits low cytotoxicity to HaCaT cells.

[0068] Example 4

[0069] The effects of camelliaside B on the expression of MMP-1 and MMP-9 proteins, which are closely related to the degeneration of the extracellular matrix structure in dermal tissue, were investigated.

[0070] Camellia glycoside B stock solution with a concentration of 80 mM was prepared using DMSO and diluted to 10 μM and 20 μM with DMEM basal medium to obtain DMEM basal medium containing different concentrations of camellia glycoside B.

[0071] HaCaT cells in the logarithmic growth phase were used at a density of 1 × 10⁻⁶ cells per well. 6 Cells were seeded at a density of [number] cells per well in 6-well plates and cultured in DMEM complete medium. When the cells reached 60-70% cell growth, the complete medium was discarded, and the cells were starved for 12 hours in DMEM basal medium. The old medium was then discarded, and the cells were divided into a control group (Ctrl group, no drug added and no UVB radiation) and a model group (UVB group, no drug added but exposed to 40 mJ / cm² radiation). 2UVB irradiation) and drug treatment groups (pretreated with different concentrations (10 μM, 20 μM) of camelliaside B followed by 40 mJ / cm) 2 UVB irradiation), drug treatment group: pretreated with DMEM basal medium containing different concentrations (10 μM, 20 μM) of cambogia glycoside B for 6 h, and then treated with 40 mJ / cm 2 Cells were irradiated with UVB; Model group: cells were pretreated with DMEM basal medium for 6 h, then treated with 40 mJ / cm² medium. 2 Cells were irradiated with UVB; control group: pretreated with DMEM basal medium for 6 h. Cells in all groups were cultured for 24 h after UVB irradiation. After 6-well plates, the cells were washed twice with PBS, and then 100 μL LRIPA lysis buffer, 25 μL loading buffer, and 1.25 μL PMSF (phenylmethylsulfonyl fluoride) were added to each well. Cells were lysed on ice, repeatedly pipetted, and collected into EP tubes. The cells were denatured at 100℃ for 10 min, then centrifuged, gel-coated, transferred, blocked, incubated with primary and secondary antibodies, and developed. The expression levels of senescence-related proteins matrix metalloproteinase 1 (MMP-1) and matrix metalloproteinase 9 (MMP-9) in HaCaT cells were detected using GAPDH as an internal control for standardization. Detailed results are available in [link to relevant documentation]. Figure 4 .

[0072] Depend on Figure 4 It is evident that, compared to the control group, the increased expression of MMP-1 and MMP-9 in the model group cells inhibited collagen synthesis, suggesting an aggravation of skin photoaging. Camellia glycoside B significantly inhibited the expression of skin collagen degradation-related proteins MMP-1 and MMP-9 in HaCaT cells after UVB irradiation, indicating that camellia glycoside B can inhibit skin photoaging.

[0073] Example 5

[0074] Investigating the effects of camelliaside B on senescence markers in HaCaT cells after UVB irradiation.

[0075] I. β-Galactosidase Staining Experiment

[0076] Primary HaCaT cells in the logarithmic growth phase were used at a density of 1 × 10⁻⁶ cells per well. 6 Cells were seeded at a density of [number] cells per well in 6-well plates and cultured in DMEM complete medium. Once the cells reached 60-70% cellularity, the complete medium was discarded, and the cells were starved for 12 hours in DMEM basal medium. The cells were then divided into a control group (no drug added and no UVB irradiation) and a model group (no drug added but irradiated with 40 mJ / cm²). 2UVB irradiation) and drug treatment groups (pretreated with different concentrations (10 μM, 20 μM) of camelliaside B followed by 40 mJ / cm) 2 (UVB irradiation). Drug treatment group: Pretreated with DMEM basal medium containing different concentrations (10 μM, 20 μM) of camboside B for 6 h, then treated with 40 mJ / cm 2 Cells were irradiated with UVB; Model group: cells were pretreated with DMEM basal medium for 6 h, then treated with 40 mJ / cm² medium. 2 Cells were irradiated with UVB; control group: pretreated with DMEM basal medium for 6 h. Cells in each group were cultured for 24 h after irradiation, washed with PBS, and then 1 mL of β-galactosidase (SA-β-Gal) staining fixative was added. Cells were fixed at room temperature for 15 minutes, the β-galactosidase staining fixative was removed, and the cells were washed with PBS. Then, 1 mL of staining working solution was added to each well, and the cells were incubated overnight at 37°C before observation under a conventional optical microscope.

[0077] SA-β-Gal is a β-galactosidase that exhibits increased activity during cellular senescence. By detecting the activity level of SA-β-Gal in cells, the degree of cellular senescence can be assessed. Figure 5 It was observed that the number of β-galactosidase-positive cells in HaCaT cells in the model group was significantly increased compared to the control group. However, pretreatment with 10 μM and 20 μM camelliaside B significantly reduced the number of β-galactosidase-positive cells in HaCaT cells after UVB irradiation compared to the model group. This indicates that camelliaside B can significantly reduce the number of β-galactosidase-positive cells in HaCaT cells after UVB irradiation, meaning that camelliaside B can inhibit UVB-induced photoaging of the skin.

[0078] II. Western blot analysis of the protein expression levels of aging-related proteins p21 and p16

[0079] HaCaT cells in the logarithmic growth phase were used at a density of 1 × 10⁻⁶ cells per well. 6 Cells were seeded at a density of [number] cells per well in 6-well plates and cultured in DMEM complete medium. Once the cells reached 60-70% cellularity, the complete medium was discarded, and the cells were starved in DMEM basal medium for 12 hours. The cells were then divided into a control group (no drug added and no UVB irradiation) and a model group (no drug added but irradiated with 40 mJ / cm²). 2 UVB irradiation) and drug treatment group (pretreated with different concentrations (10 μM, 20 μM) of camelliaside B followed by 40 mJ / cm 2 (UVB irradiation). Drug treatment group: Pretreated with basal medium containing different concentrations (10 μM, 20 μM) of camelliaside B for 6 h, then treated with 40 mJ / cm2 Cells were irradiated with UVB; Model group: cells were pretreated with DMEM basal medium for 6 h, then treated with 40 mJ / cm² medium. 2 Cells were irradiated with UVB; control group: pretreated with DMEM basal medium for 6 h. Cells in each group were cultured for 24 h after irradiation. The cells were then removed from the 6-well plates, washed twice with PBS, and each well was filled with 100 μL RIPA lysis buffer, 25 μL loading buffer, and 1.25 μL PMSF (phenylmethylsulfonyl fluoride). Cells were lysed on ice, repeatedly pipetted, and collected into EP tubes. The cells were denatured at 100℃ for 10 min, then centrifuged, gel-coated, transferred, blocked, incubated with primary and secondary antibodies, developed, and normalized using GAPDH as an internal control. The expression levels of senescence-related proteins cyclin-dependent kinase inhibitor 1A (p21) and cyclin-dependent kinase inhibitor 2A (p16) in HaCaT cells were detected. Detailed results are available in [link to relevant documentation]. Figure 6 .

[0080] The expression levels of p21 and p16 proteins were significantly positively correlated with cellular senescence. Functionally, the expression levels of p21 and p16 directly determine the intensity of cellular senescence. Figure 6 It was observed that the expression of aging marker proteins p21 and p16 in HaCaT cells of the model group was significantly increased compared with that of the control group. However, pretreatment with 10 μM and 20 μM camelliaside B significantly reduced the expression of p21 and p16. This indicates that camelliaside B can significantly inhibit the expression of aging-related proteins p21 and p16 in HaCaT cells after UVB irradiation, meaning that camelliaside B can inhibit skin photoaging.

[0081] III. Immunofluorescence detection of protein expression levels of aging biomarker γ-H2AX

[0082] HaCaT cells in the logarithmic growth phase were used at a density of 1 × 10⁻⁶ cells per well. 6 Cells were seeded at a density of [number] cells per confocal microplate and cultured in DMEM complete medium. Once the cells reached 60-70% cellularity, the complete medium was discarded, and the cells were starved in DMEM basal medium for 12 hours. The cells were then divided into a control group (no drug added and no UVB irradiation) and a model group (no drug added but irradiated with 40 mJ / cm²). 2 UVB irradiation) and drug treatment group (pretreated with different concentrations (10 μM, 20 μM) of camelliaside B followed by 40 mJ / cm 2 (UVB irradiation). Drug treatment group: Pretreated with basal medium containing different concentrations (10 μM, 20 μM) of camelliaside B for 6 h, then treated with 40 mJ / cm 2Cells were irradiated with UVB; Model group: cells were pretreated with DMEM basal medium for 6 h, then treated with 40 mJ / cm² medium. 2 Cells were irradiated with UVB; control group: pretreated with DMEM basal medium for 6 h. Cells in each group were cultured for 24 h after irradiation. The 6-well plates were then removed, washed twice with PBS, and 400 μL of 4% paraformaldehyde was added to each well for fixation at room temperature for 20 min. After discarding the paraformaldehyde, the cells were washed twice more with PBS. Then, 1 mL of 0.5% Triton-X100 was added and incubated at room temperature for 10 min. Blocking was then performed with 3% BSA blocking solution for 1 h. Diluted primary antibody was added to confocal microscopy dishes and incubated overnight at 4°C. Secondary antibody was then added and incubated at room temperature in the dark for 1 h. Finally, 500 μL of DAPI working solution was added to each well and stained statically in the dark for 10 min. Observation was performed using a confocal microscope. The expression level of γ-H2AX protein, a senescence marker in HaCaT cells, was detected using DAPI as an internal control after standardization. Detailed results are available in [link to results]. Figure 7 .

[0083] Depend on Figure 7 It was observed that the aging marker γ-H2AX in HaCaT cells of the model group was significantly increased compared to the control group, but pretreatment with 10 μM and 20 μM camelliaside B significantly reduced γ-H2AX. This indicates that camelliaside B can significantly inhibit the expression of the aging marker γ-H2AX protein in HaCaT cells after UVB irradiation.

[0084] Example 6

[0085] Investigating whether camelliaside B activates autophagy to achieve anti-photoaging effects.

[0086] I. Western blot analysis of the protein expression levels of autophagy-related proteins p62 and Beclin1

[0087] HaCaT cells in the logarithmic growth phase were used at a density of 1 × 10⁻⁶ cells per well. 6 Cells were seeded at a density of [number] cells per well in 6-well plates and cultured in DMEM complete medium. Once the cells reached 60-70% cellularity, the complete medium was discarded, and the cells were starved for 12 hours in DMEM basal medium. The cells were then divided into a control group (no drug added and no UVB irradiation) and a model group (no drug added but irradiated with 40 mJ / cm²). 2 UVB irradiation) and drug treatment group (pretreated with different concentrations (10 μM, 20 μM) of camelliaside B followed by 40 mJ / cm 2 (UVB irradiation). Drug treatment group: Pretreated with basal medium containing different concentrations (10 μM, 20 μM) of camelliaside B for 6 h, then treated with 40 mJ / cm 2Cells were irradiated with UVB; Model group: cells were pretreated with DMEM basal medium for 6 h, then treated with 40 mJ / cm² medium. 2 Cells were irradiated with UVB; control group: pretreated with DMEM basal medium for 6 h. After irradiation, cells in each group were cultured for another 24 h. The cells were then removed from the 6-well plates, washed twice with PBS, and each well was filled with 100 μL RIPA lysis buffer, 25 μL loading buffer, and 1.25 μL PMSF (phenylmethylsulfonyl fluoride). Cells were lysed on ice, repeatedly pipetted, and collected into EP tubes. The cells were denatured at 100℃ for 10 min, then centrifuged, gel-coated, transferred, blocked, incubated with primary and secondary antibodies, developed, and normalized using GAPDH as an internal control. The expression levels of autophagy-related proteins p62 and Beclin1 in HaCaT cells were detected. Detailed results can be found in [link to relevant documentation]. Figure 8 .

[0088] Autophagy is a highly conserved biological process, considered a highly selective cellular clearance pathway associated with maintaining cellular and tissue homeostasis. It is generally believed that with skin aging, the abundance of autophagy-related proteins gradually declines, reducing the cargo transported to lysosomes; that is, impaired autophagy is a major characteristic of aging. Figure 8 It was observed that the expression of p62 protein in HaCaT cells of the model group was significantly increased compared to the control group, while the expression of Beclin1 protein was significantly inhibited, indicating that autophagy in HaCaT cells of the model group was significantly suppressed. However, after pretreatment with camelliaside B, the expression of p62 protein decreased and the expression of Beclin1 protein increased, indicating that camelliaside B can activate autophagy, that is, camelliaside has an anti-photoaging effect.

[0089] II. qPCR detection of mRNA expression levels of autophagy-related genes p62 and BECN1

[0090] HaCaT cells in the logarithmic growth phase were used at a density of 1 × 10⁻⁶ cells per well. 6 Cells were seeded at a density of [number] cells per well in 6-well plates and cultured in DMEM complete medium. Once the cells reached 60-70% cellularity, the complete medium was discarded, and the cells were starved for 12 hours in DMEM basal medium. The cells were then divided into a control group (no drug added and no UVB irradiation) and a model group (no drug added but irradiated with 40 mJ / cm²). 2 UVB irradiation) and drug treatment group (pretreated with different concentrations (10 μM, 20 μM) of camelliaside B followed by 40 mJ / cm 2 (UVB irradiation). Drug treatment group: Pretreated with basal medium containing different concentrations (10 μM, 20 μM) of camelliaside B for 6 h, then treated with 40 mJ / cm 2Cells were irradiated with UVB; Model group: cells were pretreated with DMEM basal medium for 6 h, then treated with 40 mJ / cm² medium. 2 Cells were irradiated with UVB; control group: pretreated with DMEM basal medium for 6 h. Cells in each group were cultured for another 6 h after irradiation, and then total RNA was extracted from HaCaT cells, reverse transcribed into cDNA, and gene normalized using GAPDH as an internal control. Analysis was performed using the 2−∆∆Ct method. The transcriptional levels of autophagy-related genes p62 and BECN1 were detected using upstream and downstream primer sequences of the relevant target proteins shown in Table 1. Detailed results are available in [Table 1]. Figure 9 .

[0091] Table 1. Primer sequences

[0092] upstream primer Downstream primer p62 GACTACGACTTGTGTAGCGTC AGTGTCCGTGTTTCACCTTCC BECN1 ACCTCAGCCGAAGACTGAAG AACAGCGTTTGTAGTTCTGACA GAPDH GGAGCGAGATCCCTCCAAAAT GGCTGTTGTCATACTTCTCATGG

[0093] Depend on Figure 9 It is evident that camelliaside B can significantly activate the transcriptional level of the autophagy-related gene BECN1 and inhibit the transcriptional level of p62, indicating that camelliaside B can activate autophagy to achieve the effect of anti-photoaging.

[0094] Example 7

[0095] Investigating the effects of camelliaside B on reactive oxygen species (ROS) in HaCaT cells after UVB irradiation.

[0096] HaCaT cells in the logarithmic growth phase were used at a density of 1 × 10⁻⁶ cells per well. 6 Cells were seeded at a density of [number] cells per well in 6-well plates and cultured in DMEM complete medium. Once the cells reached 60-70% cellularity, the complete medium was discarded, and the cells were starved for 12 hours in DMEM basal medium. The cells were then divided into a control group (no drug added and no UVB irradiation) and a model group (no drug added but irradiated with 40 mJ / cm²). 2 UVB irradiation) and drug treatment group (pretreated with different concentrations (10 μM, 20 μM) of camelliaside B followed by 40 mJ / cm 2 (UVB irradiation). The drug-treated groups were pretreated with basal medium containing different concentrations (10 μM, 20 μM) of camelliaside B for 6 h, and then treated with 40 mJ / cm² water. 2 Cells were irradiated with UVB; Model group: cells were pretreated with DMEM basal medium for 6 h, then treated with 40 mJ / cm² medium. 2 Cells were irradiated with UVB; control group: pretreated with DMEM basal medium for 6 h. Cells in each group were cultured for another 24 h after irradiation, then washed with PBS and 1 mL of 10 μmol·L⁻¹ medium was added. −1The cells were stained in 2,7-dichlorofluorescein diacetate (DCFH-DA) solution in the dark for 20 min; the working solution of the dye was removed, and the cells were washed 2-3 times with culture medium for 5 minutes each time. The ROS level of each group of cells was observed under an imaging fluorescence microscope.

[0097] DCFH-DA is a cell-penetrating green fluorescent probe used to detect intracellular ROS (reactive oxygen species). The stronger the green fluorescence, the higher the ROS level. ROS also play a crucial regulatory role in skin aging, contributing to skin aging through mechanisms such as inducing cellular senescence, affecting the synthesis and degradation of collagen and elastin, and inducing inflammatory responses. Figure 10 It is evident that compared to the control group, UVB irradiation significantly increased the ROS content in HaCaT cells. However, pretreatment with camelliaside B significantly reduced the increase in ROS content caused by UVB irradiation. This indicates that camelliaside B can significantly reduce the ROS content in HaCaT cells after UVB irradiation, thus inhibiting skin aging to some extent.

[0098] Example 8

[0099] The inhibitory effect of camelliaside B on melanin content was investigated.

[0100] PIG1 cells in the logarithmic growth phase were cultured at a density of 1 × 10⁶ cells per well. 6 Cells were seeded at a density of [number] cells per well in 6-well plates and cultured in DMEM complete medium. Once the cells reached 60-70% cellularity, the complete medium was discarded, and the cells were starved for 12 hours in DMEM basal medium. The cells were then divided into a control group (no drug added and no UVB irradiation) and a model group (no drug added but irradiated with 40 mJ / cm²). 2 UVB irradiation) and drug treatment group (pretreated with different concentrations (10 μM, 20 μM) of camelliaside B followed by 40 mJ / cm 2 (UVB irradiation). Drug treatment group: Pretreated with basal medium containing different concentrations (10 μM, 20 μM) of camboside B for 6 h, then treated with 40 mJ / cm 2 Cells were irradiated with UVB; Model group: cells were pretreated with DMEM basal medium for 6 h, then treated with 40 mJ / cm² medium. 2Cells were irradiated with UVB; control group: pretreated with DMEM basal medium for 6 h. Cells in each group were cultured for 72 h after irradiation. The 6-well plates were then removed, washed twice with PBS, and PIG1 cells were digested with trypsin until detached. Digestion was terminated with DMEM complete medium, and the cells were centrifuged to obtain the cell pellet. Cells were resuspended in PBS, and the total number of cells in each sample was recorded. The melanin content in PIG1 cells was then detected using the NaOH alkaline lysis method. Specifically, an appropriate amount (usually 200-400 μL) of 1M NaOH solution was added to each sample, and the mixture was vigorously vortexed to completely resuspend the cell pellet and disperse it in the alkaline solution. The mixture was then dissolved in an 80℃ metal bath for 2 h, removed, cooled at room temperature, and centrifuged at 12000 g for 10 min at 4℃. The supernatant was transferred to a new centrifuge tube, which was the test solution containing melanin. Subsequently, melanin standards were prepared as follows: 10 mg of synthetic melanin powder was accurately weighed and dissolved in 10 mL of 1M NaOH solution as a stock solution (1000 μg / mL). The stock solution was serially diluted with 1M NaOH solution to obtain standard solutions with concentrations of 100, 80, 40, 20, 10, and 5 μg / mL. 100 μL of the test supernatant and 100 μL of the standard solution were added to a 96-well plate, and the absorbance of each well was measured at 405 nm using a microplate reader. A standard curve was plotted with the standard concentration on the x-axis and the corresponding OD value on the y-axis. The measured OD value of the sample was substituted into the equation of the standard curve to calculate the melanin concentration in the sample. The formula for calculating melanin content is as follows:

[0101] Melanin content (μg / million cells) = [Melanin concentration in sample solution (μg / mL) × Total volume of sample solution (mL)] / Total number of cells (in millions).

[0102] Depend on Figure 11 It is evident that camelliaside B can significantly reduce the melanin content of PIG1 cells after UVB irradiation.

[0103] Example 9

[0104] The inhibitory effect of camelliaside B on MITF and TYR, proteins related to melanin production in PIG1 cells, was investigated.

[0105] PIG1 cells in the logarithmic growth phase were cultured at a density of 1 × 10⁶ cells per well. 6 Cells were seeded at a density of [number] cells per well in 6-well plates and cultured in DMEM complete medium. Once the cells reached 60-70% cellularity, the complete medium was discarded, and the cells were starved for 12 hours in DMEM basal medium. The cells were then divided into a control group (no drug added and no UVB irradiation) and a model group (no drug added but irradiated with 40 mJ / cm²). 2UVB irradiation) and drug treatment group (pretreated with different concentrations (10 μM, 20 μM) of camelliaside B followed by 40 mJ / cm 2 (UVB irradiation). Drug treatment group: Pretreated with basal medium containing different concentrations (10 μM, 20 μM) of camelliaside B for 6 h, then treated with 40 mJ / cm 2 Cells were irradiated with UVB; Model group: cells were pretreated with DMEM basal medium for 6 h, then treated with 40 mJ / cm² medium. 2 Cells were irradiated with UVB; control group: pretreated with DMEM basal medium for 6 h. Cells in each group were cultured for 24 h after irradiation. Six-well plates were removed, washed twice with PBS, and then 100 μL RIPA lysis buffer, 25 μL loading buffer, and 1.25 μL PMSF (phenylmethylsulfonyl fluoride) were added to each well. Cells were lysed on ice, repeatedly pipetted, and collected into EP tubes. The cells were denatured at 100℃ for 10 min, then centrifuged, gel-coated, transferred, blocked, incubated with primary and secondary antibodies, developed, and normalized using GAPDH as an internal control. The expression levels of MITF and TYR, proteins related to melanin production, in PIG1 cells were detected. Detailed results can be found in [link to relevant documentation]. Figure 12 .

[0106] Depend on Figure 12 It can be seen that, compared with the control group, UVB irradiation significantly increased the expression levels of MITF and TYR, proteins related to melanin production, in PIG1 cells, while camelliaside B significantly inhibited the expression levels of MITF and TYR, proteins related to melanin production, in PIG1 cells after UVB irradiation.

[0107] Example 10

[0108] The study investigated whether camelliaside B could inhibit the transfer of melanosomes from PIG1 cells to HaCaT cells.

[0109] HaCaT cells in the logarithmic growth phase were injected with 5 × 10⁻⁶ cells. 6 The cells were seeded at a density of 10 cm in 10 cm dishes and cultured in DMEM complete medium. When the cells grew to 60-70%, the complete medium was discarded, the cells were washed twice with PBS, stained with CMFDA (5-chloromethylfluorescein diacetate) dye for 30 min, the dye was discarded, and DMEM complete medium was added and the cells were cultured for another 12 h.

[0110] PIG1 cells in logarithmic growth phase were injected with 5 × 10⁻⁶ cells. 6The cells were seeded at a density of 10 cm in 10 cm dishes and cultured in DMEM complete medium. When the cells grew to 60-70%, they were stained with CMTPX (live cell tracer) dye for 30 min, the dye was discarded, and DMEM complete medium was added and cultured for another 12 h.

[0111] The treated PIG1 cells and HaCaT cells were mixed at a ratio of 1:10 and cultured at a concentration of 1×10⁻⁶. 6 Cells were seeded at a density of [number] cells per well in 6-well plates and cultured in DMEM complete medium for 24 h. The medium was discarded, and the cells were washed twice with PBS. The co-cultured cells were then starved in DMEM basal medium for 6 h and divided into a control group (no drug added and no UVB irradiation) and a model group (no drug added but irradiated with 40 mJ / cm²). 2 UVB irradiation) and drug treatment group (pretreated with different concentrations (10 μM, 20 μM) of camelliaside B followed by 40 mJ / cm 2 (UVB irradiation). The drug-treated groups were pretreated with basal medium containing different concentrations (10 μM, 20 μM) of camelliaside B for 6 h, and then treated with 40 mJ / cm² water. 2 Cells irradiated with UVB; Model group (UVB group, without added drugs but irradiated with 40 mJ / cm²). 2 UVB irradiation; control group (no drugs added and no UVB irradiation).

[0112] After irradiation, the cells in each group were cultured for another 24 h, then washed with PBS, and the transport of melanosomes from melanocytes to keratinocytes in the co-culture model was observed under a confocal microscope.

[0113] Skin pigmentation occurs because melanin is produced by epidermal melanocytes and transferred to surrounding keratinocytes. Therefore, the inventors used CMFDA (a cell-permeable fluorescent dye), commonly used for live cell tracking, which is green fluorescent, to successfully label HaCaT cells. The CMTPX cytoplasmic red fluorescent probe can easily penetrate the cell membrane and enter the cell, transforming into a non-cell-permeable reaction product that emits a strong red fluorescent signal. Melanocytes in the cytoplasm of PIG1 cells are stained red by CMTPX.

[0114] from Figure 13 PIG1 cells and HaCaT cells co-survived, and the co-localization of red and green fluorescence was significantly increased in the UVB group, indicating that UVB promotes the transfer of melanosomes to keratinocytes. Camellia glycoside B significantly reduced the co-localization of red and green fluorescence, indicating that camellia glycoside B inhibited the transport of melanosomes from melanocytes to keratinocytes.

[0115] In summary, camelliaside B not only exhibits low toxicity to HaCaT cells and significantly reduces the number of β-galactosidase-positive cells in HaCaT cells after UVB irradiation, but also significantly inhibits the expression of aging-related proteins p21 and p16, the aging-related marker γ-H2AX, and the expression of MMP-1 and MMP-9 proteins closely related to skin aging in HaCaT cells after UVB irradiation. Furthermore, camelliaside B can activate autophagy, significantly increase Beclin1 expression, and inhibit p62 expression, and also has similar effects on the mRNA of Beclin1 and p62. Camelliaside B can also significantly inhibit ROS formation and suppress oxidative stress. This indicates that camelliaside B can be used to prepare anti-photoaging products, and is particularly significant and valuable for addressing photoaging problems caused by UVB phototherapy. In addition, camelliaside B can significantly inhibit the formation of melanin in PIG1 cells after UVB irradiation and significantly inhibit the expression of TYR and MITF proteins, which are closely related to melanin formation, and inhibit the transfer of melanosomes from PIG1 cells to HaCaT cells. Figure 14 As shown in the figure, this fully demonstrates that camelliaside B can be used to prepare skin whitening products and has great potential.

[0116] Finally, it should be noted that the above should not be construed as a limitation on the scope of protection of this invention. Any non-essential improvements and adjustments made by those skilled in the art based on the above content of this invention shall fall within the scope of protection of this invention.

Claims

1. Application of camelliaside B in the preparation of anti-aging products.

2. The application according to claim 1, characterized in that: The aging described is exogenous aging.

3. The application according to claim 1 or 2, characterized in that: The aging mentioned refers to photoaging of the skin.

4. The application according to claim 1, characterized in that: The application described is that of camelliaside B in the preparation of products that exert anti-aging effects by performing at least one of the following actions: activating autophagy, inhibiting oxidative stress, and inhibiting the degradation of skin collagen.

5. Application of camelliaside B in the preparation of skin whitening products.

6. The application according to claim 5, characterized in that: The whitening effect described refers to repairing skin darkening caused by ultraviolet light exposure.

7. The application according to claim 5 or 6, characterized in that: The application described is that of camelliaside B in the preparation of products that achieve whitening by exerting at least one of the following effects: inhibiting melanin production and inhibiting the transfer of melanosomes.

8. The application according to claim 1 or 5, characterized in that: Anti-aging and / or skin whitening products include cosmetics, medical aesthetic products, or pharmaceuticals.

9. The application according to claim 8, characterized in that: The cosmetics mentioned are selected from serums, lotions, essences, creams, toners, conditioning lotions, face creams, masks, sunscreens, eye creams, sprays, sunscreens, foundations, or body lotions; the medical aesthetic products mentioned are selected from serums, dressings, cold compresses, gels, sponges, films, hyaluronic acid injections, implants, lotions, creams, or ointments; the medicines mentioned use camelliaside B as an active ingredient or main active ingredient, and also include pharmaceutically acceptable excipients; the dosage forms of the medicines mentioned are selected from at least one of granules, capsules, powders, tablets, pills, emulsions, suspensions, syrups, ointments, injections, suppositories, aerosols, gels, patches, and drops.

10. A topical preparation for repairing photoaging and / or whitening the skin, characterized in that: The active ingredient in the topical preparation is camelliaside B.

Images