Lactobacillus plantarum CFS-401, fermentation product and application of lactobacillus plantarum CFS-401 in regulating scalp micro-ecology

Abstract

The invention discloses lactobacillus plantarum CFS-401, a fermentation product and application of the lactobacillus plantarum CFS-401 to scalp micro-ecology regulation, and belongs to the technical field of microorganisms. Fermentation supernate of the lactobacillus plantarum CFS-401 can effectively inhibit malassezia and staphylococcus epidermidis, the minimum inhibitory concentration is low, and the lactobacillus plantarum CFS-401 can be more easily added into a product. While the staphylococcus epidermidis and the malassezia are reduced, the fermentation supernatant of the lactobacillus plantarum CFS-401 can promote the growth of the propionibacterium acnes, so that the scalp flora is balanced.

Description

TECHNICAL FIELD

[0001] The present application relates to a strain of Lactobacillus plantarum CFS-401, a fermentation product and its application in regulating the scalp micro-ecology, belonging to the field of microbial technology. BACKGROUND

[0002] With the deepening of the concept of skin care, in addition to the face skin, body skin, more and more attention is paid to the hair, scalp, and the use of targeted products. The influence of environmental factors such as PM2.5, ultraviolet rays and external factors such as work and life pressure leads to imbalance of scalp micro-ecology. Because the sweat glands in the scalp are more, the humidity and oil content are relatively high, forming a relatively anaerobic and high-lipid environment, which is very suitable for the growth and reproduction of microorganisms. When the scalp micro-ecology is imbalanced, a large number of harmful bacteria are easily bred, and the scalp itching, dandruff increase and even the phenomenon of falling out appear.

[0003] The bacteria on the human scalp are mainly propionibacterium (Propionibacterium, P. acnes > 99%), staphylococcus (Staphylococcus, S. epidermidis > 99%) and corynebacterium (Corynebacterium), and the fungi are mainly malassezia (Malassezia restricta and M. globosa are the main dominant species).

[0004] Most of the results of the microbiological study of dandruff people show that there is an excess of malassezia. Most of the malassezia are lipid-dependent and can multiply in large quantities under triggering factors. The host-derived lipids serve as a source of nutrition, and the lipase and phospholipase secreted by malassezia can hydrolyze the triacylglycerol contained in the skin to release unsaturated fatty acids such as oleic acid and arachidonic acid, destroy the barrier function of the epidermal keratin layer, induce keratinocytes to produce pro-inflammatory cytokines such as IL-1, IL-2, IL-4, IL-6, IFN-γ and TNF-α, and cause skin inflammatory response and desquamation. Prostaglandins synthesized from arachidonic acid can mediate inflammatory response by chemotaxis of neutrophils and promotion of vascular dilation. In turn, it can lead to dandruff. Therefore, inhibiting malassezia or inhibiting malassezia lipase activity to reduce the inflammatory response caused by malassezia is one of the methods for treating dandruff.

[0005] At the same time, studies have shown that propionibacterium and staphylococcus, two species, exhibit a mutual inhibitory state, which simultaneously affects the severity of dandruff. Compared with normal scalp, the number of propionibacterium near the scalp with dandruff decreases while the number of staphylococcus increases. Researchers believe that the sebum on the scalp is one of the food sources of propionibacterium, and the high water content on the scalp can provide a more suitable environment for the growth of propionibacterium, thereby reducing dandruff.

[0006] At present, the commonly used antidandruff agents are zinc pyrithione, piroctone olamine, climbazole, selenium disulfide, salicylic acid, etc., which are mainly designed for Malassezia colonization on the scalp, but the inhibition of single flora may lead to rapid emergence of drug resistance, loss of efficacy, and imbalance of scalp flora, thereby causing other problems. Therefore, measures need to be taken to improve the relationship between scalp microorganisms, host and environment, and maintain the balance and diversity of scalp microecology.

[0007] As a common probiotic, Lactobacillus plantarum has various health benefits, mainly including: 1. Regulating intestinal microecological balance 2. Enhancing immune function 3. Promoting nutrient absorption 4. Inhibiting inflammation and protecting intestinal barrier 5. Auxiliary metabolic regulation 6. Improving oral health. Lactobacillus plantarum can metabolize to produce various antibacterial substances, such as organic acids (lactic acid, acetic acid, etc.), which can reduce the environmental pH value and inhibit the growth and reproduction of pathogenic bacteria (such as Escherichia coli, Salmonella, Staphylococcus aureus, etc.); It can also produce bacteriocins (a kind of polypeptide or protein with antibacterial activity), which can specifically inhibit or kill certain gram-positive bacteria, and is not easy to make bacteria resistant.

[0008] Many studies have found that the effects of probiotics on the human body are no longer limited to the intestines, but also affect other organs outside the intestines. In recent years, probiotics have shown broad application prospects in improving hair loss. Huang Xiujuan's team published a study in Gut, which pointed out that emulsifiers can disrupt the intestinal flora of mice and cause hair loss. Targeted supplementation of Bifidobacterium longum HK003 can alleviate and reverse this phenomenon (Lam S, Zhang J, Yang K, Chu L C, Zhu w, Tang w, Chan F K L, Chan P K S, Wu W K K Ng S C. Modulation of gut microbiota impacts diet-induced and drug-induced alopecia in mice Gut, 2022, 71(11): 2366-2369.). Erdman et al. fed probiotics to old mice, which quickly induced the skin and hair to be more shiny, while the blank control group did not find this phenomenon (Habeshian K A, Cohen B A. Current issues in the Treatment of Acne Vulgaris. Pediatrics. 2020, 145(Supp12): 225-230.). Lee et al. found that Lactobacillus reuteri BM36301 can improve the hair growth cycle and promote hair growth (Lee J, Yang W, Hostetler A, Schultz N, Suckow MA, Stewart K L, Kim D D, Kim HS Characterization of the anti-inflammatory Lactobacillus reuteri BM36301 and its probiotic benefits on aged mice. BMC Microbiol, 2016, 16: 69-71.). Probiotic agent Lactobacillus paracasei ST11 regulates scalp microorganisms by regulating intestinal microorganisms. In vitro studies have shown that the experimental group has significantly reduced free and attached dandruff, erythema, and oil secretion compared to the control group. After taking for 57 days, irritation and itching were effectively reduced, and the effect was maintained after stopping taking for a week.(REYGAGNE P, BASTIEN P, COUAVOUX MP, et al. The positive benefit of Lactobacillus paracasei NCC2461 ST11 in healthy volunteers with moderate to severe dandruff [J]. Beneficial Microbes, 2017, 8(5): 1-10.) These are all oral products, and there is no research report on the application in washing and protecting products. The plant lactobacillus DZ041 fermentation broth in patent 202411468078.6 can inhibit the growth of malassezia furfur, lyse malassezia furfur, and inhibit the growth and biofilm formation of pseudomonas aeruginosa and staphylococcus aureus, but the minimum inhibitory concentration is high and cannot be applied to products.

[0009] The plant lactobacillus fermentation broth reported in the prior art to inhibit pathogenic bacteria on the scalp can exert efficacy in an acidic environment, and the inhibitory effect on pathogenic bacteria is weakened or even disappears when the pH is in an alkaline environment. The pH value of the scalp of healthy people ranges from 4.5 to 5.5, and the local pH value of the scalp with dandruff, inflammation or excessive oil secretion increases to about 6-7. Therefore, the plant lactobacillus fermentation supernatant reported in the prior art which can inhibit pathogenic bacteria on the scalp in an acidic environment cannot exert the inhibitory effect on the scalp with dandruff, inflammation or excessive oil secretion.

[0010] Therefore, it is urgent to find a strain with low effective concentration, wide pH tolerance range and the ability to regulate skin microecology. SUMMARY

[0011] [TECHNICAL PROBLEM]

[0012] At present, the commonly used antidandruff agents are mainly designed for malassezia colonization on the scalp, but the inhibition of a single bacterial group may lead to the rapid emergence of drug resistance, loss of efficacy, and may also cause more imbalance of the scalp bacterial group, thereby causing other problems. Therefore, measures need to be taken to improve the relationship between scalp microorganisms, hosts and the environment, and maintain the balance and diversity of the scalp microecology. And the fermentation broth of the existing strain capable of regulating the scalp microecology has high effective concentration and can only play a role in a specific pH range, which cannot be applied in products.

[0013] The present application provides a plant lactobacillus (Lactobacillus plantarum) CFS-401, which has been preserved in the China General Microbiological Culture Collection Center, with a preservation number of CGMCC No. 35557 and a preservation date of August 11, 2025.

[0014] The present application provides a postbiotic prepared from the Lactobacillus plantarum CFS-401.

[0015] In one embodiment, the postbiotic is prepared by inoculating the Lactobacillus plantarum CFS-401 into a culture medium, and then fermenting the inoculated culture medium to obtain a fermentation broth or a fermentation supernatant.

[0016] In one embodiment, the culture medium comprises beef extract 5-10 g, casein peptone 5-10 g, yeast extract 2-6 g, glucose 20-40 g, sodium acetate 2-8 g, diammonium hydrogen citrate 1-3 g, Tween 80 0-10 mL, K2HPO4 1-3 g, MgSO4.7H2O 0.29-1.74 g, and MnSO4.H2O 0-0.5 g.

[0017] In one embodiment, the fermentation supernatant is obtained by sequentially concentrating, filtering, and removing color and odor after centrifuging the fermentation broth.

[0018] In one embodiment, the filtering comprises ultrafiltration or nanofiltration.

[0019] In one embodiment, the fermentation supernatant is subjected to activated carbon treatment after filtering; the activated carbon comprises Yuanli 303-02-88, Fuerd FSG-A, or Enkai activated carbon No. 1.

[0020] In one embodiment, the fermentation broth is concentrated by 3 times after centrifugation.

[0021] In one embodiment, 2% (w / v) activated carbon is added to the fermentation supernatant, and the activated carbon is removed by centrifugation after incubation at 80°C for half an hour to complete decolorization.

[0022] The present application provides a product containing the Lactobacillus plantarum CFS-401 and / or the postbiotic thereof, wherein the product comprises a pharmaceutical product or a daily-use product.

[0023] In one embodiment, the daily-use product comprises a shampoo product or a hair care product.

[0024] In one embodiment, the product is in a liquid type, a cream type, a gel type, an emulsion type, a foam type, a powder type, a tablet type, a granule type, or a capsule type.

[0025] The present application provides an application of the Lactobacillus plantarum CFS-401 and / or the postbiotic thereof in preparing an antibacterial product, wherein the antibacterial refers to inhibiting the growth of Malassezia and / or Staphylococcus epidermidis.

[0026] The present application provides an application of the Lactobacillus plantarum CFS-401 and / or the postbiotic thereof in preparing an oil control, hair loss prevention, and / or dandruff removal product.

[0027] In an embodiment, the product comprises a shampoo product or a hair care product.

[0028] The present application provides the use of the Lactobacillus plantarum CFS-401 and / or its postbiotic in the preparation of a product for improving skin quality.

[0029] In an embodiment, the improving skin quality comprises modulating skin antioxidant level, modulating inflammation level, modulating sebum secretion, modulating microbiota balance.

[0030] Beneficial effects:

[0031] The present application discloses a Lactobacillus plantarum and application thereof, the Lactobacillus plantarum is Lactobacillus plantarum CFS-401, which is preserved in China General Microbiological Culture Collection Center on August 11, 2025, and the preservation number is CGMCC No.35557.

[0032] (1) The fermentation supernatant of Lactobacillus plantarum CFS-401 has better antibacterial effect on Malassezia than currently reported, can achieve effective antibacterial effect at very low concentration, the MIC90 is 5%, the corresponding antibacterial circle diameter is 20.77 mm, and it is easier to add in products.

[0033] (2) The fermentation supernatant of Lactobacillus plantarum CFS-401 can maintain good antibacterial effect in the pH range of 4-8, and is suitable for the actual application scene of oil control, anti-hair loss and / or anti-dandruff products.

[0034] (3) The fermentation supernatant of Lactobacillus plantarum CFS-401 is almost colorless and odorless after a series of purification, and the light transmittance can reach 95%.

[0035] (4) The fermentation supernatant of Lactobacillus plantarum CFS-401 can balance the scalp microbiota by reducing Staphylococcus epidermidis and Malassezia and increasing Propionibacterium acnes.

[0036] Biological material preservation

[0037] Lactobacillus plantarum CFS-401, taxonomically named as Lactobacillus plantarum, has been preserved in China General Microbiological Culture Collection Center on August 11, 2025, and the preservation number is CGMCC No.35557, and the preservation address is No.3, Beichen West Road, Haidian District, Beijing. BRIEF DESCRIPTION OF DRAWINGS

[0038] Figure 1 The genome circle of CFS-401.

[0039] Figure 2 CFS-401 colony on MRS plate.

[0040] Figure 3 Malassezia inhibitory effect of decolorized supernatant, non-decolorized supernatant and homogenized centrifuged supernatant of CFS-401 fermentation broth.

[0041] Figure 4 Effect of glucose concentration on Malassezia inhibitory effect of fermentation supernatant.

[0042] Figure 5 Effect of magnesium ion concentration on Malassezia inhibitory effect of fermentation supernatant.

[0043] Figure 6 Effect of Tween concentration on Malassezia inhibitory effect of fermentation supernatant.

[0044] Figure 7 Effect of pH on Malassezia inhibitory effect of fermentation supernatant.

[0045] Figure 8 Effect of concentration on Malassezia inhibitory effect of fermentation supernatant.

[0046] Figure 9 Effect of different filter membranes on Malassezia inhibitory effect of fermentation supernatant.

[0047] Figure 10 Effect of different activated carbons on Malassezia inhibitory effect of fermentation supernatant.

[0048] Figure 11 Regulatory effect of fermentation supernatant on Staphylococcus epidermidis and Propionibacterium acnes.

[0049] Figure 12 Toxicity of Lactobacillus plantarum fermentation product to HaCaT.

[0050] Figure 13 Toxicity of Lactobacillus plantarum fermentation product to SZ95.

[0051] Figure 14 Effect of different concentrations of samples on IL-8 secretion of HaCaT. # indicates significant difference from BC group; * indicates significant difference from TBHP group; * indicates P-value < 0.05; ** indicates P-value < 0.01; *** indicates P-value < 0.001; **** indicates P-value < 0.0001.

[0052] Figure 15 Schematic diagram of ROS immunofluorescence staining result (200x).

[0053] Figure 16The ROS immunofluorescence relative quantification column chart. Wherein # indicates significant difference with BC group; * indicates significant difference with TBHP group; * indicates P-value < 0.05; ** indicates P-value < 0.01; *** indicates P-value < 0.001; **** indicates P-value < 0.0001.

[0054] Figure 17 The Nile red staining result schematic diagram (400x).

[0055] Figure 18 The Nile red staining result relative quantification column chart. Wherein # indicates significant difference between LA and BC groups; * indicates significant difference between sample groups and BC group; * indicates P-value < 0.05; ** indicates P-value < 0.01; *** indicates P-value < 0.001; **** indicates P-value < 0.0001.

[0056] Figure 19 The number of keratinocytes.

[0057] Figure 20 The mouse inflammatory factor transcription level.

[0058] Figure 21 The mouse sebum content. DETAILED DESCRIPTION

[0059] The technical solutions in the embodiments of the present application will be described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative work belong to the scope protected by the present application. The following specific embodiments further describe the present application.

[0060] The culture medium used in the embodiments:

[0061] MRS liquid culture medium: beef extract 7.5g, casein peptone 7.5g, yeast extract 4g, glucose 20g, sodium acetate 5g, diaminium citrate 2g, Tween 80 1mL, K2HPO42g, MgSO4.7H2O 0.58g, MnSO4.H2O 0.25g, add distilled water to 1L, pH value 6.2.

[0062] MRS solid medium: beef extract 7.5 g, casein peptone 7.5 g, yeast extract 4 g, glucose 20 g, sodium acetate 5 g, di-ammonium hydrogen citrate 2 g, Tween 80 1 mL, K2HPO4 2 g, MgSO4.7H2O 0.58 g, MnSO4.H2O 0.25 g, agar powder 15 g, distilled water to 1 L, pH 6.2.

[0063] Fermentation medium 1 : beef extract 7.5 g, casein peptone 7.5 g, yeast extract 4 g, glucose 40 g, sodium acetate 5 g, di-ammonium hydrogen citrate 2 g, Tween 80 1 mL, K2HPO4 2 g, MgSO4.7H2O 0.58 g, MnSO4.H2O 0.25 g, distilled water to 1 L, pH 6.2.

[0064] Fermentation medium 2: beef extract 7.5 g, casein peptone 7.5 g, yeast extract 4 g, glucose 30 g, sodium acetate 5 g, di-ammonium hydrogen citrate 2 g, Tween 80 1 mL, K2HPO4 2 g, MgSO4.7H2O 0.58 g, MnSO4.H2O 0.25 g, distilled water to 1 L, pH 6.2.

[0065] Fermentation medium 3: beef extract 7.5 g, casein peptone 7.5 g, yeast extract 4 g, glucose 20 g, sodium acetate 5 g, di-ammonium hydrogen citrate 2 g, Tween 80 1 mL, K2HPO4 2 g, MgSO4.7H2O 0.58 g, MnSO4.H2O 0.25 g, distilled water to 1 L, pH 6.2.

[0066] Fermentation medium 4: beef extract 7.5 g, casein peptone 7.5 g, yeast extract 4 g, glucose 30 g, sodium acetate 5 g, di-ammonium hydrogen citrate 2 g, Tween 80 1 mL, K2HPO4 2 g, MgSO4.7H2O 0.29 g, MnSO4.H2O 0.25 g, distilled water to 1 L, pH 6.2.

[0067] Fermentation medium 5: beef extract 7.5 g, casein peptone 7.5 g, yeast extract 4 g, glucose 30 g, sodium acetate 5 g, di-ammonium hydrogen citrate 2 g, Tween 80 1 mL, K2HPO4 2 g, MgSO4.7H2O 1.16 g, MnSO4.H2O 0.25 g, distilled water to 1 L, pH 6.2.

[0068] Fermentation medium 6: beef extract 7.5 g, casein peptone 7.5 g, yeast extract 4 g, glucose 30 g, sodium acetate 5 g, ammonium citrate dibasic 2 g, Tween 80 1 mL, K2HPO4 2 g, MgSO4.7H2O 1.74 g, MnSO4.H2O 0.25 g, distilled water to 1 L, pH 6.2.

[0069] Fermentation medium 7: beef extract 7.5 g, casein peptone 7.5 g, yeast extract 4 g, glucose 30 g, sodium acetate 5 g, ammonium citrate dibasic 2 g, Tween 80 0 mL, K2HPO4 2 g, MgSO4.7H2O 1.16 g, MnSO4.H2O 0.25 g, distilled water to 1 L, pH 6.2.

[0070] Fermentation medium 8: beef extract 7.5 g, casein peptone 7.5 g, yeast extract 4 g, glucose 30 g, sodium acetate 5 g, ammonium citrate dibasic 2 g, Tween 80 5 mL, K2HPO4 2 g, MgSO4.7H2O 1.16 g, MnSO4.H2O 0.25 g, distilled water to 1 L, pH 6.2.

[0071] Fermentation medium 9: beef extract 7.5 g, casein peptone 7.5 g, yeast extract 4 g, glucose 30 g, sodium acetate 5 g, ammonium citrate dibasic 2 g, Tween 80 10 mL, K2HPO4 2 g, MgSO4.7H2O 1.16 g, MnSO4.H2O 0.25 g, distilled water to 1 L, pH 6.2.

[0072] LB liquid medium: tryptone 10 g, yeast extract 5 g, sodium chloride 10 g, distilled water to 1 L.

[0073] Fermentation medium 6: beef extract 7.5 g, casein peptone 7.5 g, yeast extract 4 g, glucose 30 g, sodium acetate 5 g, ammonium citrate dibasic 2 g, Tween 80 1 mL, K2HPO4 2 g, MgSO4.7H2O 1.74 g, MnSO4.H2O 0.25 g, distilled water to 1 L, pH 6.2.

[0074] Fermentation medium 6: beef extract 7.5 g, casein peptone 7.5 g, yeast extract 4 g, glucose 30 g, sodium acetate 5 g, ammonium citrate dibasic 2 g, Tween 80 1 mL, K2HPO4 2 g, MgSO4.7H2O 1.74 g, MnSO4.H2O 0.25 g, distilled water to 1 L, pH 6.2.

[0075] P. acnes liquid medium: tryptone 10 g, beef extract 10 g, glucose 5 g, sodium chloride 5 g, yeast extract 3 g, sodium acetate 3 g, soluble starch 1 g, L-cysteine hydrochloride 0.5 g, pH 6.6-7.0 (25°C).

[0076] The Malassezia used in the following examples is Malassezia furfur ATCC 44344, purchased from North Na Biotechnology; the Staphylococcus epidermidis is Staphylococcus epidermidis ATCC 12228, purchased from China Industrial Microbial Culture Collection Center; and the P. acnes is P. acnes ATCC 11827, purchased from North Na Biotechnology.

[0077] Example 1: Obtaining Lactobacillus plantarum CFS-401

[0078] The strain of the present application is isolated from the scalp of a healthy person. Specifically, a sterile cotton swab collecting a scalp sample is added to sterile normal saline and mixed by shaking, 100 μL of which is spread on an MRS agar plate, which is incubated at 37°C under anaerobic static conditions for 24 h, after which colonies with different morphologies are picked and again cultured by streaking on a plate to obtain the isolated strain CFS-401.

[0079] The above Lactobacillus plantarum CFS-401 is isolated from the scalp of a normal person and belongs to the genus Lactobacillus. The genomic DNA of DZ041 is extracted using an Omega kit and sent to GenScript Biotech Corporation for sequencing. It has high identity with Lactobacillus plantarum through genome sequencing comparison and is named Lactobacillus plantarum CFS-401, the genomic map of which is shown in Figure 1

[0080] 16S rRNA primer:

[0081] 16S rRNA F AGAGTTTGATCCTGGCTCAG;

[0082] 16S rRNA R GGTTACCTTGTTACGACTT.

[0083] The 16S rRNA sequence is shown in SEQ ID NO. 1 and is specifically shown as follows:

[0084] ​

[0085] The morphological characteristics of *Lactobacillus plantarum* CFS-401 are as follows: Colony characteristics ( Figure 2 Size: Colony diameter is generally 2-5 mm. Color: Usually white, occasionally light yellow or dark yellow. Shape: Round, with neat edges. Surface condition: Smooth, dense, and raised surface.

[0086] The optimal culture conditions are as follows: MRS medium, 30-37℃, 24h.

[0087] Example 2: Fermentation process of Lactobacillus plantarum CFS-401

[0088] The strain was taken out from the -80℃ ultra-low temperature freezer and inoculated into MRS solid medium with an inoculation loop. It was cultured at 30℃ for 24 hours. A single colony was picked and inoculated into MRS liquid medium. It was cultured at 37℃ for 12 hours. Then, it was transferred to secondary shake flasks of MRS liquid medium at a 1% inoculation rate and cultured at 37℃ for 24 hours as secondary seed culture.

[0089] Secondary seed culture was inoculated into the fermenter at a rate of 10%, with the temperature at 37℃, pH at rest, and aeration controlled at 0.3-0.5 vvm. The culture was incubated for 24 hours before being transferred to the fermenter. The supernatant was obtained by centrifuging the bacterial culture (20 OD / mL) at 8000 rpm / min, 4℃, for 15 min.

[0090] The supernatant was filtered through a 0.22 μm PES (polyethersulfone) membrane filter to obtain the unbleached supernatant 401-2 of Lactobacillus plantarum CFS-401, with a pH of 4.6. 2% (w / v) activated carbon was added to the supernatant, and after incubation at 80℃ for half an hour, centrifugation was performed to remove the activated carbon and complete the decolorization, resulting in the decolorized supernatant 401-1, with a pH of 4.6. The supernatant was homogenized three times at 12000 psi to obtain the homogenized centrifuged supernatant 401-3, with a pH of 6.3.

[0091] Bacterial content determination:

[0092] Malassezia strain was taken out from an ultra-low temperature freezer at -80℃ and inoculated into Malassezia solid medium with an inoculation loop. It was cultured at 30℃ for 48 hours. Single colonies were picked and inoculated into Malassezia liquid medium. The culture was kept at 30℃ overnight to obtain Malassezia bacterial suspension.

[0093] The Malassezia bacterial suspension was serially diluted 10-fold with physiological saline (0.5 ml bacterial suspension + 4.5 ml physiological saline); 10 -6 10 -7 10 -8Add 1 mL of each of the three bacterial titers to a plate, then pour 20 mL of Malassezia furfur solid culture medium into the plate and incubate at 30°C for 16–24 h; count the colonies: select plates with 30–300 colonies for counting. Calculate 1 × 10⁻⁶. 8 The absorbance corresponding to CFU / mL bacterial culture.

[0094] Table 1. Malassezia colony counts for each titer.

[0095] Number of colonies 1 x 10 -6 ]] 98 1 x 10 -7 ]] 10 1 x 10 -8 ]] 1

[0096] The colony counts for each titer are shown in Table 1. 1×10 -6 The corresponding number of colonies grown on the plates was 98, indicating that 1 mL contained 0.98 × 10⁸ viable colonies. 8 cells / mL, at which point the corresponding OD of the original bacterial culture 600 The OD value was 0.5. Therefore, in subsequent experiments, the colony count corresponding to the dilution of the bacterial culture to OD 0.5 was 0.98 × 10⁻⁵. 8 CFU / mL.

[0097] Determination of antibacterial concentration:

[0098] In 96-well plates, the fermentation supernatant was diluted with Malassezia furfur medium. The final concentrations for the experimental groups were 100%, 50%, 25%, 12.5%, 6.25%, 3.13%, 1.56%, 0.78%, 0.39%, and 0.2% by mass, respectively. A final concentration of 1×10⁻⁶ was added. 7 The test bacteria were prepared at CFU / mL; the experimental blank group consisted of fermentation supernatant at the corresponding concentration, but without the test bacteria; corresponding blank groups (containing only blank Malassezia culture medium without bacterial suspension) and control groups (containing Malassezia bacterial suspension without fermentation supernatant) were prepared on the same plate, with 6 replicates for each condition, and 1×PBS was added around the wells of the plate to prevent evaporation of the culture medium. After incubating the 96-well plate at 30℃ for 16-20 h, the OD value was measured using a microplate reader. 600 Detect the absorbance value.

[0099] Calculation formula:

[0100]

[0101] The results are as follows Figure 3 As shown, the fermentation supernatant was found to have a certain antibacterial effect, with the original solution having an antibacterial rate of about 80%. The effect of the decolorized supernatant was the same as that of the undecolorized supernatant. The antibacterial effect was worse after homogenization and centrifugation, so the homogenization and centrifugation supernatant treatment method was no longer used.

[0102] 1. Control residual sugar

[0103] The residual sugar of the fermentation broth obtained by fermenting CFS-401 for 24 hours is 5 g / L. It is speculated that the high residual sugar content leads to poor antibacterial effect. Therefore, the fermentation process is changed to inoculate the second-stage seed into the fermenter at a 10% inoculation amount, the temperature is 37°C, the pH is natural, and the aeration is controlled at 0.3-0.5 vvm. The fermentation is stopped when the sugar is basically consumed (within 0.5 g / L), the pH is 5-6, and the cycle is about 24-36 hours.

[0104] The fermentation medium used is fermentation medium 1, fermentation medium 2 and fermentation medium 3, respectively. The fermentation supernatant is then subjected to 2% centrifugal activated carbon decolorization treatment. 401-4, 401-5 and 401-6 are obtained, and the pH is 6.0. The corresponding malassezia inhibition rates are as shown in Table 1. Figure 4 It is found that the antibacterial effect of the fermentation supernatant after sugar control is improved compared with 401-1. Among them, 401-5 has the best antibacterial effect, and can achieve more than 95% inhibition rate on malassezia at a concentration of 50%, and more than 80% inhibition rate at a concentration of 25%.

[0105] 2. Magnesium ion concentration optimization

[0106] The original fermentation medium contains 0.58 g / L of magnesium ions. The magnesium ion concentration is changed to 0.29 g / L, 1.16 g / L and 1.74 g / L (corresponding to fermentation medium 4-6, respectively). The corresponding fermentation supernatants are 401-7, 401-8 and 401-9, and the pH is 6.0. The corresponding malassezia inhibition rates are as shown in Table 2. Figure 5 It is found that 401-8 has the best antibacterial effect on malassezia, and the inhibition rate on malassezia is more than 90% at a concentration of 50% and 25%, indicating that increasing the magnesium ion concentration can improve the antibacterial effect of Lactobacillus plantarum CFS-401.

[0107] 3. Tween 80 concentration optimization

[0108] The original fermentation medium contains 1 mL / L of Tween 80. The Tween 80 concentration is changed to 0 mL / L, 5 mL / L and 10 mL / L (corresponding to fermentation medium 7-9, respectively). The corresponding fermentation supernatants are 401-10, 401-11 and 401-12, and the pH is 6.0. The corresponding malassezia inhibition rates are as shown in Table 3. Figure 6 It is found that 401-11 has the best antibacterial effect on malassezia, and the inhibition rate on malassezia is more than 90% at a concentration of 50% and 25%, and more than 80% at a concentration of 12.5%, indicating that increasing the Tween 80 concentration can improve the antibacterial effect of Lactobacillus plantarum CFS-401.

[0109] 4. Optimal pH

[0110] The fermentation supernatant of the optimized medium was adjusted to 3, 4, 5, 6, 7, 8, 9, respectively, and the Malassezia inhibition rate was detected according to a 25% addition amount, and the results are shown in Table 1. Figure 7 As shown in Table 1, there was no significant difference in the antibacterial effect at pH 4-8, and the antibacterial effect was reduced at pH 3 and 9, indicating that the fermentation supernatant was stable at pH 4-8.

[0111] Example 3: Purification of Lactobacillus plantarum CFS-401 fermentation filtrate

[0112] 1. Concentration

[0113] The fermentation of Lactobacillus plantarum CFS-401 was carried out according to the method of Example 2, and the fermentation medium was beef extract 7.5 g, casein peptone 7.5 g, yeast extract 4 g, glucose 30 g, sodium acetate 5 g, diammonium hydrogen citrate 2 g, Tween 80 5 mL, K2HPO4 2 g, MgSO4.7H2O 1.16 g, MnSO4.H2O 0.25 g, and distilled water was added to 1 L, and the pH value was 6.2. The fermentation supernatant corresponding to 20 OD / mL was collected. The fermentation supernatant was concentrated 3 times by rotary evaporation at a vacuum degree of 0.08 MPa and a temperature of 45°C, and 401-13 was obtained, with a pH of 6.0. The concentrated fermentation supernatant was diluted with the Trichophyton mentagrophytes culture medium, and the corresponding Malassezia inhibition rate is shown in Table 2. Figure 8 As shown in Table 2, the inhibition rate of the fermentation supernatant on Malassezia was more than 98% at concentrations of 50%, 25%, and 12.5%, and the inhibition rate was 89% at a concentration of 6.25%. At this time, the light transmittance detected by the turbidimeter was 60%, the solution color was yellow, and there was a special smell of fermentation broth.

[0114] 2. Selection of filter membrane:

[0115] The fermentation of Lactobacillus plantarum CFS-401 was carried out according to the method of Example 2, and the fermentation supernatant corresponding to 20 OD / mL was collected. The concentrated fermentation supernatant was treated by ultrafiltration (UF) and nanofiltration (NF). The ultrafiltration membrane had a pore size of 0.001-0.1 μm and a molecular weight cut-off of 1-1000 kDa, and could retain macromolecular substances such as proteins, polysaccharides, and colloids, while allowing water, small molecule salts, and monosaccharides to pass through. The nanofiltration membrane had a pore size of 0.0001-0.001 μm and a molecular weight cut-off of 200-2000 Da, and had a retention effect on small molecule organic matter (such as antibiotics and amino acids) and multivalent ions, while allowing monovalent ions and water to pass through. The fermentation supernatant obtained by ultrafiltration was 401-14, with a pH of 6.0, and the measured light transmittance was 80%. The fermentation supernatant obtained by nanofiltration was 401-15, with a pH of 6.0, and the measured light transmittance was 85%. The corresponding Malassezia inhibition rate is shown in Table 3. Figure 9As shown, the results showed that the fermentation supernatant obtained by ultrafiltration had better antibacterial effect than 401-13, while the fermentation supernatant obtained by nanofiltration had worse antibacterial effect, which may be due to the retention of effective substances in the fermentation supernatant by the nanofiltration membrane, making the antibacterial effect of the fermentation supernatant worse. The fermentation supernatant 401-14 obtained by ultrafiltration had an inhibition rate of 93.3% on Malassezia at a concentration of 6.25%. However, at this time, the light transmittance of the fermentation supernatant was 80% and there was a distinct fermentation odor, so it still needs to be optimized to increase the light transmittance and reduce the odor.

[0116] 3. Activated carbon selection

[0117] Several different brands of activated carbon were selected to treat the supernatant obtained after concentration and ultrafiltration. The results are shown in Table 2. The fermentation supernatant treated with Yuanli 303-02-88 activated carbon had the highest light transmittance and almost no odor. The corresponding Malassezia inhibition rate was Figure 10 As shown, the inhibition rate of the fermentation supernatant on Malassezia was 99.8% and 90.8% at 10% and 5% addition, respectively, and the MIC90 was about 5%. When the addition was reduced to 4%, 3% and 2.5%, the inhibition rates were 80.4%, 63.9% and 50.2%, respectively. That is, when the addition is 2.5%, the half inhibition rate can be achieved. When the addition is reduced to 1.25%, the inhibition rate is only 8.6%.

[0118] At the same time, the antibacterial activity of the fermentation supernatant was detected by the inhibition zone method.

[0119] Malassezia bacterial solution was diluted to 1x10 8 CFU / mL, and a sterile cotton swab was used to dip the bacterial suspension and evenly rub it on the surface of the solid culture medium. It was placed at room temperature for 5-10 minutes to allow the bacterial solution to be absorbed. A sterile forceps was used to take a 6mm filter paper disc, which was soaked in the fermentation supernatant for 10-30 seconds. The concentration of the fermentation supernatant was 10%, 5%, 4%, 3%, 2.5% and 1.25%, respectively. The excess liquid was drained, and the filter paper disc was gently attached to the surface of the agar after bacterial coating. At the same time, a negative control was set up: filter paper disc soaked in sterile saline.

[0120] The culture dish was inverted and placed in a 30°C constant temperature incubator. After 24 hours, the culture dish was taken out and observed whether a transparent inhibition zone was formed (the negative control should have no inhibition zone). The diameter of the inhibition zone was measured with a vernier caliper (unit: mm).

[0121] The results of the inhibition zone experiment are shown in Table 3. The fermentation supernatant had an inhibition zone at an addition amount of 10%, 5%, 4%, 3%, and 2.5%, with a diameter of more than 10 mm. The inhibition zone was the largest at 25.86 mm at an addition amount of 10%. The MIC90 was 5%, and the corresponding inhibition zone diameter was 20.77 mm. At this time, the total polyphenol content in the fermentation supernatant was 0.05 g / L, the total protein content was 0.58 mg / mL, and the total polysaccharide content was 2.1 g / L.

[0122] Table 2 Effects of different brands of activated carbon on the light transmittance and odor of the fermentation supernatant

[0123] Brand / Model Transmittance Odor Metco 303-02-88 95％ Almost odorless Enkarel Activated Carbon No. 1 88％ Slight odor of fermentation broth Palladium FSG-A 90％ Almost odorless

[0124] Table 3 Results of the inhibition zone experiment

[0125]

[0126]

[0127] Example 4: Metabolic product of Lactobacillus plantarum CFS-401 for regulating the scalp micro-ecosystem

[0128] The fermentation supernatant was prepared by the optimal fermentation process and purification process of Examples 2 and 3, that is, the fermentation of Lactobacillus plantarum CFS-401 was carried out according to the method of Example 2. The fermentation medium was as follows: beef extract 7.5 g, casein peptone 7.5 g, yeast extract 4 g, glucose 30 g, sodium acetate 5 g, diammonium hydrogen citrate 2 g, Tween 80 5 mL, K2HPO4 2 g, MgSO4.7H2O 1.16 g, MnSO4.H2O 0.25 g, and distilled water was added to 1 L, with a pH value of 6.2. The purification process was as follows: the fermentation supernatant corresponding to 20 OD / mL was collected. The fermentation supernatant was concentrated 3 times by rotary evaporation under the conditions of a vacuum degree of 0.08 MPa and 45°C, then ultrafiltration was performed, and then 2% Yuanli 303-02-88 activated carbon was used for decolorization to obtain the fermentation supernatant.

[0129] The regulating ability of the fermentation supernatant on Staphylococcus epidermidis and Propionibacterium acnes was detected according to the method in Example 2, as follows: Figure 11As shown in the figure, it can be seen that the fermentation supernatant has a good inhibitory effect on Staphylococcus epidermidis, and can reach more than 90% of the inhibition rate at a concentration of 3.13%, and the corresponding inhibition zone diameter is 28.54mm at a concentration of 3.13%; at the same time, the fermentation supernatant has no obvious inhibitory effect on Propionibacterium acnes, and has a certain promoting effect on the growth of Propionibacterium acnes at an addition amount of 12.5%, and the growth rate increases by more than 20%. Compared with normal scalp, the number of Propionibacterium acnes in the dandruff area decreases and the number of Staphylococcus epidermidis increases, which indicates that the balance between the two has an important influence on the severity of dandruff, and the fermentation supernatant of Lactobacillus plantarum CFS-401 can balance the scalp flora by reducing Staphylococcus epidermidis and increasing Propionibacterium acnes.

[0130] Example 5: Lactobacillus plantarum CFS-401 metabolite cell experiment

[0131] The fermentation supernatant was prepared by the optimal fermentation process and purification process of Examples 2 and 3, that is, the fermentation of Lactobacillus plantarum CFS-401 was carried out according to the method of Example 2, and the fermentation medium was beef extract 7.5g, casein peptone 7.5g, yeast extract 4g, glucose 30g, sodium acetate 5g, diammonium hydrogen citrate 2g, Tween 80 5mL, K2HPO42g, MgSO4.7H2O 1.16g, MnSO4.H2O 0.25g, distilled water to 1L, pH 6.2. The fermentation supernatant corresponding to 20OD / mL was collected. The purification process: under the condition of vacuum degree 0.08MPa and 45℃, the fermentation supernatant was concentrated 3 times by rotary evaporator, then ultrafiltration, and then decolorized by 2% yuanli 303-02-88 activated carbon to obtain the fermentation supernatant. The purified fermentation supernatant was collected for cell experiment.

[0132] HaCaT cell toxicity test:

[0133] After the cells were recovered, the cell growth was observed, and when the cell coverage rate reached more than 80%, the cells were counted and inoculated into a 96-well plate. The plate was placed in a CO2 incubator (37℃, 5% CO2) and incubated overnight. When the HaCaT cell plating rate reached about 60%, the cells were grouped and dosed. Each group had 6 replicates. The test groups were set as: blank control group, sample group, and the specific grouping is shown in Table 4.

[0134] Table 4 Grouping Table

[0135]

[0136] After 24h incubation, the supernatant was discarded and 100μl 10% CCK-8 solution was added to each well. The plate was incubated at 37°C for 1h in the dark. After incubation, the OD value was read at 490nm. Cell survival rate was calculated according to the formula. The formula was as follows:

[0137] SZ95 cell toxicity test:

[0138] After the cells were recovered, the cell growth was observed and the cells were counted when the cell coverage reached more than 60%. The cells were inoculated into 96-well plates. The plates were incubated in a CO2 incubator (37°C, 5% CO2) overnight. When the SZ95 cell plating rate reached about 60%, the cells were grouped and dosed. Each group had 6 replicates. The test groups were set as follows: blank control group, sample group. The specific grouping is shown in Table 5.

[0139] Table 5 Grouping Table

[0140]

[0141] After 24h incubation, the supernatant was discarded and 100μl 10% CCK-8 solution was added to each well. The plate was incubated at 37°C for 1h in the dark. After incubation, the OD value was read at 490nm. Cell survival rate was calculated according to the formula. The formula was as follows:

[0142] Cell survival rate (%) = (sample well OD - zero well OD) / (blank well OD - zero well OD) x 100%.

[0143] The cell survival rate at different concentrations of the sample was used to characterize the toxicity of the sample to the cells. The toxicity test results are shown in Figure 12 、 13 and Tables 6 and 7.

[0144] Table 6 Lactobacillus plantarum fermentate cell toxicity results on human immortalized keratinocytes

[0145] Concentration (μg / ml) 20000 15000 10000 8000 5000 1000 800 500 Cell survival rate (%) 45.59 55.70 61.94 65.37 76.67 96.96 95.15 104.69

[0146] The toxicity test results prove that the concentration of Lactobacillus plantarum fermentate is <1000μg / ml, which has no toxicity to human immortalized keratinocytes.

[0147] Table 7 Lactobacillus plantarum fermentate cell toxicity results on human sebaceous gland cells

[0148] Concentration (μg / ml) 2000 1500 1000 800 500 100 80 50 Cell survival rate (%) 101.77 96.47 98.47 100.8 99.81 95.82 97.11 105.58

[0149] As shown in Table 7 and Figure 13The cytotoxicity experiment results show that the concentration of Lactobacillus plantarum fermentation product is <2000 μg / ml, which is non-toxic to human sebaceous gland cells.

[0150] As shown in Table 6 and Figure 12 The cytotoxicity experiment results show that the concentration of Lactobacillus plantarum fermentation product is <1000 μg / ml, which is non-toxic to human immortalized keratinocytes; and the concentration of <2000 μg / ml is non-toxic to human sebaceous gland cells.

[0151] Inflammatory factor content detection:

[0152] After the recovery of cells, the cell growth was observed, and when the cell coverage rate reached more than 80%, the cells were counted and inoculated into a 24-well plate. The well plate was incubated in a CO2 incubator (37°C, 5% CO2) overnight. When the plating rate of HaCaT cells reached about 60%, the cells were grouped and dosed. Each group had 3 replicate wells. The samples in the safe concentration range were selected for the detection of inflammatory factor IL-8 of HaCaT cells after tert-butyl hydroperoxide (TBHP) stimulation, to detect the soothing effect of Lactobacillus plantarum fermentation supernatant sample on TBHP stimulation. The test groups were set as follows: blank control group, sample group, and positive control group (PC) with added vitamin E. The specific grouping is shown in Table 4. After 24 h of sample dosing, the supernatant was discarded, 10 μM TBHP was added, and the plate was incubated in a CO2 incubator (37°C, 5% CO2) for 6 h.

[0153] The supernatant was collected and detected according to the operation instruction of the IL-8 detection kit.

[0154] Table 8 Test group grouping

[0155]

[0156] The inflammatory factor test results are shown in Figure 14 Compared with the negative control group, the release of inflammatory factors by human immortalized keratinocytes under the action of the sample group was significantly reduced, indicating that the test substance had an inhibitory effect on the release of inflammatory factors by human immortalized keratinocytes, and the test substance had a soothing effect. It is shown that the Lactobacillus plantarum fermentation supernatant can significantly reduce the inflammatory response caused by TBHP stimulation, and has a soothing effect.

[0157] Immunofluorescence staining to evaluate the expression of ROS in keratinocytes (antioxidant):

[0158] After cell counting, the cells were diluted to the required concentration, and the cell suspension was added to the cell culture plate so that the volume of the culture medium was 1 mL / well, and the number of living cells was 5×10 4 cells / well.

[0159] After plating for 24 h, the cell confluence rate was 40-60%, different concentrations of test substances were added according to Table 9 to make the concentration of the test concentration, and 3 parallel test holes were set. The positive control group and the sample group were added with test substances for 24 h, and then the negative control group, the positive control group, the sample group and the test group were stimulated with stimulants for 6 h.

[0160] Table 9 Grouping of test groups

[0161]

[0162] After 6 h of TBHP stimulation, the culture solution was aspirated, and PBS was used for washing 3 times. DCFH-DA was diluted with PBS at a dilution ratio of 1:500. DCFH-DA working solution was added, and incubation was performed at 37°C for 30 min. The liquid was aspirated, and washing was performed 3 times with washing solution, each time for 3-5 min. Observation was performed under a fluorescence microscope. The staining of ROS was green fluorescence.

[0163] The results are shown in Table 11. Figures 15-16 As shown in Table 11, the test substance Lactobacillus plantarum fermentation supernatant can reduce the expression of ROS of human immortalized keratinocytes at test concentrations of 1000 ppm and 100 ppm.

[0164] Nile Red staining was used to evaluate the oil control effect (oil control) of the sample in sebaceous gland cells:

[0165] Nile Red staining is a fluorescence staining technique commonly used to evaluate oil content and has important applications in the evaluation of oil control effects of cosmetics (such as skin care products). By utilizing the specific binding properties of Nile Red to oil, changes in oil content can be reflected through fluorescence signal intensity, thereby determining the effect of oil control products.

[0166] After counting the sebaceous gland cells, they were diluted to the required concentration, and cell suspension was added to the cell culture plate so that the volume of the culture medium was 1 mL / well, and the number of living cells was 5×10 4 After plating for 24 h, the cell confluence rate was 40-60%, 100 μM linoleic acid (LA) was added to the LA, PC and sample groups for 24 h, different concentrations of test substances were added according to Table 10 to make the concentration of the test concentration, and 3 parallel test holes were set, and incubation was continued for 24 h.

[0167] Table 10 Grouping of test groups

[0168]

[0169] Rinse: Discard the culture medium and wash with PBS for 3 times; Fix: Add 4% paraformaldehyde (300 μL) to fix for 30 min; Stain: Prepare the Nile Red staining solution (working concentration is 10 μg / mL), discard the fixing solution, rinse the cells with PBS for 3 times, add the Nile Red staining solution (300 μL) to stain for 15 min; Take pictures: Under the inverted fluorescence microscope, observe the staining of the cells in each group and take pictures. Result analysis: Use the Image Pro Plus software to quantitatively analyze the fluorescence intensity.

[0170] The fluorescence intensity emitted by Nile Red after combining with oil is positively correlated with the oil content in the sample. If there is a significant red area in the cell, it indicates that there is lipid, and the darker the color, the higher the relative content of lipid. The results are shown in Figures 17-18 As shown in Table 1, compared with the control group, the test substance can reduce the secretion of oil in sebaceous gland cells at the test concentrations of 2000 ppm, 1000 ppm and 500 ppm. It is proved that the Lactobacillus fermentation supernatant has a good oil control effect.

[0171] Example 6: Oil control animal experiment of Lactobacillus plantarum CFS-401 metabolites

[0172] The fermentation supernatant was prepared by the optimal fermentation process and purification process of Examples 1 and 2. Lactobacillus plantarum CFS-401 was fermented according to the method of Example 2. The fermentation medium was as follows: beef extract 7.5 g, casein peptone 7.5 g, yeast extract 4 g, glucose 30 g, sodium acetate 5 g, diammonium hydrogen citrate 2 g, Tween 80 5 mL, K2HPO4 2 g, MgSO4.7H2O 1.16 g, MnSO4.H2O 0.25 g, distilled water to 1 L, pH 6.2. The fermentation supernatant corresponding to 20 OD / mL was collected. The fermentation supernatant was concentrated 3 times by rotary evaporation under the condition of vacuum degree 0.08 MPa and 45°C, then ultrafiltrated, and then decolorized with 2% activated carbon to obtain the fermentation supernatant.

[0173] 6-8 week old C57BL / 6 mice (body weight 20-25 g) were selected. After the back of the mice was shaved (2 cm x 2 cm area), 100 μL of Malassezia suspension (1 x 10 6 CFU / mL) was applied daily for 3 consecutive days. After modeling, the skin was observed for 2-3 days until mild scaling and erythema appeared, indicating a successful model.

[0174] Blank control group: no modeling + back application of equal volume of sterile normal saline (containing 0.5% olive oil), once a day.

[0175] Modeling group: after successful Malassezia modeling, only equal volume of sterile normal saline (containing 0.5% olive oil) was applied, once a day.

[0176] Positive control group: After successful Malassezia modeling, apply the following: oil control (1% (m / m) zinc gluconate aqueous solution containing 0.5% olive oil); anti-falling control (2% (m / m) minoxidil containing 0.5% olive oil); anti-dandruff control (2% (m / m) ketoconazole containing 0.5% olive oil); once a day.

[0177] The preparation method of the minoxidil solution is as follows: 2.0 g of minoxidil powder is weighed into a clean beaker, 40 g of ethanol is added, and stirring is performed until the powder is completely dissolved. After the ethanol solution is cooled to room temperature, 10 mL of propylene glycol is slowly added, and stirring is continued for 1-2 minutes to uniformly mix the system. To the mixed solution, purified water is slowly added to 100 g, and finally 0.5% olive oil is added. The preparation method of the ketoconazole solution is as follows: 2.00 g of ketoconazole powder is placed in a beaker, and 40 g of ethanol is first added to preliminarily disperse the powder. Slowly add 20 g of propylene glycol, and continue to stir for 10-15 minutes until most of the powder is dissolved, and the solution is slightly turbid. Slowly add 38 g of purified water in multiple portions (5-10 g each time, stirring while adding), to avoid local water concentration being too high causing ketoconazole to precipitate; continue stirring for 20-30 minutes until the solution is completely clear, and finally add 0.5% olive oil.

[0178] Fermentation supernatant low-dose group: After successful Malassezia modeling, apply 2.5% (m / m) fermentation supernatant aqueous solution (containing 0.5% olive oil) once a day. The fermentation supernatant aqueous solution is prepared by diluting the purified fermentation supernatant to 2.5% with water and adding 0.5% olive oil.

[0179] Fermentation supernatant medium-dose group: After successful Malassezia modeling, apply 5% fermentation supernatant aqueous solution (containing 0.5% olive oil) once a day.

[0180] Fermentation supernatant low-dose group: After successful Malassezia modeling, apply 10% fermentation supernatant aqueous solution (containing 0.5% olive oil) once a day.

[0181] Dosing site: focus on the shaved area of the back (2 cm x 2 cm), to ensure that the drug directly acts on the dandruff skin, sebaceous glands and hair follicles.

[0182] Dosing frequency: once a day, with consistent application amount each time (20 μL per mouse, evenly applied with a pipette gun to avoid missed application).

[0183] Experimental period: 21 days of administration after successful modeling.

[0184] Anti-dandruff efficacy detection:

[0185] Visual dandruff: weekly scoring according to the "0-4 point system": 0 points: no dandruff; 1 point: a small amount of dandruff; 2 points: moderate dandruff; 3 points: a large amount of dandruff; 4 points: dandruff covering the entire shaved area

[0186] Amount of keratinocytes shed: Gently stick a piece of sterile transparent tape (1cm×1cm) to the shaved area (with consistent pressure), place the tape on a glass slide, stain with 0.1% methylene blue for 10 minutes, and count the number of stained keratinocytes under a microscope (200×).

[0187] Malassezia bacterial load: At the experimental endpoint, back skin tissue (approximately 0.1 g) was taken, homogenized, and spread onto the surface of Malassezia solid culture medium. The culture was carried out at 32°C for 5 days, and the number of colonies (CFU / g tissue) was counted.

[0188] Skin inflammatory factor levels: After the experiment, skin tissue homogenate was taken and the transcriptional levels of inflammatory factors TNF-α and IL-6 were detected by qPCR.

[0189] Skin barrier function (TEWL): Use a skin moisture loss tester (TEWL meter) to test the TEWL value of the shaved area weekly (reflecting the integrity of the skin barrier; a damaged barrier will aggravate flaking).

[0190] Sebum content testing: Weekly, gently press a sebum test strip (for animals) onto the shaved area for 10 seconds and read the sebum value using a sebum meter (unit: μg / cm³). 2 ), calculate the average value for each group.

[0191] Hair regrowth rating: Weekly rating on a scale of 0-4: 0 points: no regrowth; 1 point: <25% regrowth in the area; 2 points: 25%-50% regrowth; 3 points: 50%-75% regrowth; 4 points: >75% regrowth.

[0192] Table 11 Desquamation score in mice

[0193]

[0194] The desquamation scores of mice are shown in Table 11. In the model group, after infection with Malassezia, desquamation covered the entire shaved area and showed no improvement after 3 weeks. In the positive control group, desquamation was essentially absent after 3 weeks. After applying fermentation supernatant, the medium-dose group (5% fermentation supernatant) showed improvement to moderate flaky desquamation after 3 weeks, while the high-dose group (10% fermentation supernatant) showed virtually no desquamation after 3 weeks, consistent with the positive control group. This indicates that 10% fermentation supernatant can effectively remove dandruff.

[0195] Results of stratum corneum shedding measurement technology as follows Figure 19 As shown, the amount of keratinocytes shed in the blank group was 265 per mm. 2 The amount of keratinocytes shed in the model group increased significantly to 750 per mm. 2, indicating that the modeling was successful, and the amount of stratum corneum shedding in the positive control group was significantly reduced and had no significant difference with the blank group. Under the action of the fermentation supernatant, the low, medium and high doses could significantly reduce the number of keratinocyte shedding, and the effect of 10% was the best, which had no significant difference with the positive control group. It is indicated that the fermentation supernatant of 2.5%, 5% and 10% can achieve the effect of dandruff removal by reducing the number of keratinocyte shedding.

[0196] Table 12 Malassezia load of mice

[0197]

[0198]

[0199] The malassezia load of mice is shown in Table 12. The amount of malassezia on the back skin of mice was 8.2 x 10 1 CFU / cm 2 , the amount of malassezia in the modeling group was 6.5 x 10 6 CFU / cm 2 , and the amount of malassezia was significantly reduced after administration. In particular, the amount of malassezia in the high-dose (10%) group had no significant difference with the positive control group. It is indicated that the fermentation supernatant of 10% can achieve the effect of dandruff removal by significantly reducing the amount of malassezia.

[0200] From Figure 20 it can be seen that the transcription levels of TNF-α and IL-6 in the modeling group were significantly increased, indicating that malassezia can induce inflammatory response. The transcription levels of TNF-α and IL-6 were inhibited by adding 5% and 10% of the fermentation supernatant, and the effect was more obvious with the increase of the concentration. It is indicated that the fermentation supernatant of CFS401-1 of 5% and 10% can achieve the effect of anti-inflammation by inhibiting the transcription levels of TNF-α and IL-6.

[0201] Table 13 Skin barrier function (TEWL) value of mice

[0202]

[0203] The skin barrier function (TEWL) value of mice is shown in Table 13. The barrier function value of the modeling group was significantly increased. After 3 weeks of administration, the TEWL values were reduced to different degrees, and in particular, the TEWL value of the high-dose (10%) group had no significant difference with the blank group after 3 weeks.

[0204] After 21 days, the results of the detection of the sebum content of mice are shown in Figure 21 . Compared with the blank group, the sebum content of the modeling group was significantly increased. It is indicated that the modeling was successful, and the sebum content could be significantly reduced by adding 5% and 10% of the fermentation supernatant. In particular, the sebum content of mice under the action of the fermentation supernatant of 10% had no significant difference with the positive control group, indicating that the fermentation supernatant of 10% could achieve good oil control effect.

[0205] Table 14 Mouse hair regeneration score

[0206]

[0207]

[0208] The mouse hair regeneration score results are shown in Table 14. The model group did not have hair growth 3 weeks after being infected with Malassezia. The positive control group could achieve more than 75% hair regeneration 3 weeks later. After applying the fermentation supernatant, the medium-dose group, i.e., 5% fermentation supernatant, could achieve 50%-75% hair regeneration 3 weeks later, and the high-dose group, i.e., 10% fermentation supernatant, could achieve more than 75% hair regeneration, which was consistent with the effect of the positive control group, indicating that 5% and 10% fermentation supernatant could achieve the effect of hair regeneration.

[0209] Although the present application has been disclosed with reference to the preferred embodiments, it is not intended to limit the application, and any person skilled in the art can make various modifications and improvements without departing from the spirit and scope of the application. Therefore, the scope of protection of the present application should be defined by the claims.

Claims

1. Lactobacillus plantarum CFS-401 was deposited at the China General Microbiological Culture Collection Center on August 11, 2025, with accession number CGMCC No. 35557.

2. A metabiotic prepared from Lactobacillus plantarum CFS-401 as described in claim 1.

3. The epigenetic agent as described in claim 2, characterized in that, The post-biotic is obtained by inoculating Lactobacillus plantarum CFS-401 into a culture medium for fermentation and collecting the fermentation broth or fermentation supernatant.

4. The epigenetic agent as described in claim 3, characterized in that, The culture medium comprises: 5-10g beef extract, 5-10g casein peptone, 2-6g yeast extract, 20-40g glucose, 2-8g sodium acetate, 1-3g diammonium hydrogen citrate, 0-10mL Tween 80, 1-3g K2HPO4, 0.29-1.74g MgSO4·7H2O, and 0-0.5g MnSO4·H2O.

5. The epigenetic agent as described in claim 4, characterized in that, The fermentation supernatant is obtained by centrifuging the fermentation broth and then sequentially concentrating, filtering, and decolorizing and deodorizing it; the filtration includes ultrafiltration or nanofiltration.

6. The epigenetic agent as described in claim 5, characterized in that, After filtering the fermentation supernatant, it is treated with activated carbon; the activated carbon includes Yuanli 303-02-88, Feiruide FSG-A or Enkai Activated Carbon No.

1.

7. A product containing *Lactobacillus plantarum* CFS-401 as described in claim 1 and / or its post-biotic, characterized in that, The products include pharmaceuticals or daily chemical products; the daily chemical products include shampoos or hair care products; the products are liquid, cream, gel, lotion, foam, powder, tablet, granule, or capsule types.

8. The application of *Lactobacillus plantarum* CFS-401 and / or its postbiotics as described in claim 1 in the preparation of antibacterial products, characterized in that... The term "antibacterial" refers to inhibiting the growth of Malassezia and / or Staphylococcus epidermidis.

9. The application of *Lactobacillus plantarum* CFS-401 and / or its post-biotics as described in claim 1 in the preparation of oil-controlling, hair-preventing, and / or dandruff-removing products, characterized in that, The products include shampoo or hair care products.

10. The use of *Lactobacillus plantarum* CFS-401 and / or its post-biotics as described in claim 1 in the preparation of products for improving skin quality, characterized in that... The improvement in skin quality includes regulating the skin's antioxidant levels, regulating inflammation levels, regulating sebum secretion, and regulating the balance of gut microbiota.

Images