Methane-oxidizing bacteria transposon random mutant library construction method and application thereof

Abstract

The invention belongs to the technical field of microbial genetic engineering, and discloses a construction method and application of a random mutant library of a transposon of methane-oxidizing bacteria, and a codon-optimized transposase (the optimized codon sequence is as shown in SEQ ID NO.1) is adopted, so that the random mutant library can be efficiently constructed in the methane-oxidizing bacteria Methylomicrobium alcaliphilum, and the construction of the random mutant library of the transposon of the methane-oxidizing bacteria is facilitated. Mutation transformants of 104 or more can be constructed through one-time transformation, and a large sample material is provided for breeding screening for improving the growth rate of methane-oxidizing bacteria.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of microbial genetic engineering technology, and relates to a mutation method for causing random mutation of material in a methanotrophic bacterium Methylomicrobium alcaliphilum and application thereof. BACKGROUND

[0002] Methanotrophic bacteria are a group of bacteria that grow with methane as the sole carbon source, and have important application values in the fields of methane emission reduction, biological conversion with methane as raw material, and single-cell protein feed production.

[0003] Methanotrophic bacterium Methylomicrobium alcaliphilum is an important methanotrophic bacterium model strain, and has the characteristics of fast growth rate and strong stress resistance. It is one of important strains for applications such as methane emission reduction, methane biological conversion, and single-cell protein feed production with methane as raw material. As a core strain in the above application approaches, genetic modification of the strain is an important way to further improve its production performance. However, the methanotrophic bacterium Methylomicrobium alcaliphilum currently has the problem of difficult genetic operation, especially the lack of an efficient random mutant library construction method, which greatly limits the genetic modification thereof.

[0004] In order to solve the above technical problems, it is necessary to develop an efficient transposon random mutant library construction method and application for the methanotrophic bacterium Methylomicrobium alcaliphilum. SUMMARY

[0005] The purpose of the present application is to solve the problem of low efficiency of transposon random mutant library construction in methanotrophic bacteria. Methylomicrobium alcaliphilum The present application provides a methanotrophic bacterium transposon random mutant library construction method and application thereof, which can significantly improve the expression amount of transposase in methanotrophic bacteria.

[0006] In order to solve the above technical problems, the present application provides the following technical solutions: A Himar1 transposase gene, the sequence of which is shown in SEQ ID NO. 1.

[0007] The present application also provides application of the above-mentioned Himar1 transposase gene in construction of a methanotrophic bacterium transposon random mutant library.

[0008] A method for constructing a transposon random mutant library of methanotrophs, comprising the following steps: fusing the Himar1 transposase gene to a desulfitobactin inducible expression element and integrating the same into the genome of the methanotrophs, culturing in a culture medium with the addition of desulfitobactin to obtain a strain that induces the expression of the Himar1 transposase, preparing the strain into electrotransformation competent cells, mixing the transposon DNA with the electrotransformation competent cells for electrotransformation, and culturing the electrotransformation competent cells after recovery to obtain mutant transformants; the sequence of the desulfitobactin inducible expression element is shown in SEQ ID NO. 2.

[0009] Further, the preparation method of the transposon DNA comprises: adding the universal recognition sequence of the Himar1 transposase to both ends of the codon artificially optimized gentamicin resistance gene by means of primer introduction, and constructing the transposon DNA by PCR amplification; the sequence of the codon artificially optimized gentamicin resistance gene is shown in SEQ ID NO. 3.

[0010] Further, the electrotransformation condition is 25 muF, 200 ohms, and 2.5 kV.

[0011] Further, the induced concentration of desulfitobactin is 15 ng / mL or higher.

[0012] The application further provides the application of the above-mentioned Himar1 transposase gene or the above-mentioned method for constructing a transposon random mutant library of methanotrophs in the production of single-cell protein feed.

[0013] The application further provides the application of the above-mentioned Himar1 transposase gene or the above-mentioned method for constructing a transposon random mutant library of methanotrophs in improving the growth rate of methanotrophs.

[0014] Advantages

[0015] The application belongs to the technical field of microbial genetic engineering, and discloses a method for constructing a transposon random mutant library of methanotrophs and the application thereof, which adopts a codon-optimized Himar1 transposase to significantly improve the expression amount of the transposase in the methanotrophs and further efficiently construct a random mutant library in the methanotrophs, and one transformation can construct a library of 10 4 The above-mentioned mutant transformants are 127.3 times higher in efficiency than the existing triparental mating technology, and provide large sample materials for breeding and screening. BRIEF DESCRIPTION OF DRAWINGS

[0016] Figure 1 The overall technical route for constructing a transposon mutant library of methanotrophs Methylomicrobium alcaliphilum;

[0017] Figure 2 To integrate the expression of codon-optimized Himar1 transposase; wherein Figure 2 A is the expression of the original Himar1 gene and the codon-optimized gene in Methylomicrobium alcaliphilum 20Z in the present application; Figure 2 B is the expression of the desulfitomicrobium-induced Himar1 transposase expression system.

[0018] Figure 3 To test the efficiency of transposon mutant library construction in Methylomicrobium alcaliphilum 20Z; wherein, Figure 3 A is a comparison of the growth plates of the traditional three-parent hybrid method and the mutant constructed by the present application; Figure 3 B is a quantitative determination of the efficiency of the traditional three-parent hybrid method and the mutant constructed by the present application.

[0019] Figure 4 To test the growth of the mutant strain with significantly improved growth rate screened from the transposon mutant library. DETAILED DESCRIPTION

[0020] The advantages and effects of the present application will be described below in conjunction with specific embodiments.

[0021] As Figure 1 shown, the core technical idea of the present application is to pre-integrate an induced expression transposase in the genome of methanotrophic bacteria Methylomicrobium alcaliphilum, then to electrically transform the transposon DNA constructed in vitro into the cell, and the expressed transposase randomly inserts the transposon DNA into the genome, thereby causing the inactivation of the corresponding gene at the insertion site, and the corresponding transformant is the mutant.

[0022] Example 1

[0023] In this embodiment, the methanotrophic bacteria Methylomicrobium alcaliphilum model strain 20Z is selected, which is from the reference literature (Journal of Bacteriology 2012, https: / / doi.org / 10.1128 / jb.06392-11). The strain is preserved in the Russian Microbial Preservation Center with the preservation number: VKM B-2133, and in the British Food Industry and Marine Bacterium Species Preservation Center with the preservation number: NCIMB 14124.

[0024] The Himar1 transposase gene in the pSC123 plasmid is artificially manually codon-optimized according to the codon usage bias of methanotrophic bacteria, and the optimized sequence is shown as SEQ ID NO. 1. AsFigure 2 In Example A, the original Himar1 gene in pSC123 plasmid (sequence as SEQ ID NO. 7) and the codon-optimized Himar1 gene were respectively under the control of Ptac promoter for constitutive expression in Methylomicrobium alcaliphilum 20Z. The results showed that the expression of the original Himar1 gene was low, while the expression of the codon-optimized Himar1 of the application was significantly improved, which could significantly improve the transposition efficiency. Figure 2 The arrow in Example A).

[0025] Further, the induced expression of Himar1 transposase (codon-optimized gene, sequence as SEQ ID NO. 1) was integrated in the genome of the methanotrophic bacterium Methylomicrobium alcaliphilum 20Z.

[0026] A neutral integration site in the genome of Methylomicrobium alcaliphilum 20Z strain was selected, and in this example, the selected site was 300 bases before the start codon of the pcm gene.

[0027] The method in the literature (Appl Environ Microbiol 2016, https: / / doi.org / 10.1128 / AEM.03724-15) was used for genome site-specific integration in the strain Methylomicrobium alcaliphilum 20Z. The 500 bp sequence before and after the selected neutral integration site was PCR amplified as the homologous arm sequence for homologous recombination. The desulfitobacterium inducible expression element (sequence as SEQ ID NO. 2) was obtained by gene synthesis, which contained tetR gene and P tetAThe promoter codon-optimized Himar1 transposase gene (sequence as SEQ ID NO. 1) is also obtained by gene synthesis, and the kanamycin resistance gene with a promoter (sequence as SEQ ID NO. 6) is obtained by PCR amplification with plasmid pAWP89 as a template. The above-mentioned left homologous arm, desulfo-biotin inducible expression element, codon-optimized Himar1 transposase, kanamycin resistance gene with a promoter, and right homologous arm are sequentially connected into a linear fragment for integrating the "desulfo-biotin inducible Himar1 transposase expression system" on the genome by overlap extension PCR. The connected fragment is electroporated into the competent cells of the strain Methylomicrobium alcaliphilum 20Z, and after recovery, it is plated on a kanamycin resistant plate for screening to obtain the target strain with the "desulfo-biotin inducible Himar1 transposase expression system" integrated on the genome.

[0028] The desulfo-biotin inducible Himar1 transposase expression system in the strain is tested and analyzed, as shown in B of Figure 2 As shown in B of the above table, the obtained strain can express a large amount of Himar1 transposase under the induction of desulfo-biotin, and the appropriate induction concentration of desulfo-biotin is 15 ng / mL and above.

[0029] Example 2

[0030] In vitro construction of transposon DNA

[0031] The universal recognition sequences of Himar1 transposase 5'-TAACAGGTTGGCTGATAAGTCCCCGGTCTGACA-3' (SEQ ID NO. 4) and 5'-TGTTAGACCGGGGACTTATCAGCCAACCTGTTA-3' (SEQ ID NO. 5) are respectively added to the two ends of the codon-optimized gentamicin resistance gene (sequence as SEQ ID NO. 3) by means of primer, so as to construct the in vitro transposon DNA (double-stranded) by PCR amplification.

[0032] The double-stranded transposon DNA can be amplified by PCR, and after gel electrophoresis, the gel is recovered and purified for subsequent electroporation.

[0033] Example 3

[0034] Transposon mutant library construction efficiency test and application of typical mutants

[0035] The *Methylomicrobium alcaliphilum* 20Z strain obtained in Example 1, which integrates the codon-optimized Himar1 transposase, was used to induce Himar1 transposase expression by adding 15 ng / mL dethiobiotin to the culture medium, following the method described in the literature (Appl Environ Microbiol 2016, https: / / doi.org / 10.1128 / AEM.03724-15). The resulting bacterial cells were collected, washed multiple times with pre-cooled sterile water, and then prepared as electrotransformation competent cells at a concentration of 1.3 × 10⁻⁶ cells / mL. 11 CFU / L.

[0036] The transposon DNA constructed by in vitro PCR was mixed with the above-mentioned electroporation competent cells and then electroporated using an electroporator under the following conditions: 25 μF, 200 Ω, and 2.5 kV.

[0037] After electroporation, the cells were revived for 6 hours and then plated on agar plates containing gentamicin. The colonies that grew were the mutant transformants. Figure 3 As shown in Figure A, compared with the traditional triparental conjugation system, the mutation system in this invention can significantly obtain more mutant transformants; as Figure 3 As shown in Figure B, statistics indicate that the efficiency of constructing a Methylomicrobium alcaliphilum 20Z mutant library using the general triparental conjugation method is only 1.87 × 10⁻⁶. 2 The average efficiency of constructing mutants using the mutation system of this invention is 2.38 × 10⁻⁶ CFU / μg DNA. 4 CFU / μg DNA. That is, the system of this invention is 127.3 times more efficient than the traditional method.

[0038] The mutant library obtained using this mutation system was screened for growth. Transformants that grew preferentially were selected from the plates, resulting in two mutant strains with significantly enhanced growth rates: 20Z-MT29 and 20Z-MT113. Growth tests were then performed simultaneously on the wild-type strain 20Z and the two mutant strains. Figure 4 As shown in the figures, tests revealed that the obtained mutant strains 20Z-MT29 and 20Z-MT113 grew significantly faster than the original wild-type strain, while their growth rates were comparable. The data from this embodiment demonstrate that the present invention can provide a novel genetically modified strain for single-cell protein fermentation production of the methanogenic bacterium *Methylomicrobium alcaliphilum*, thereby further improving the fermentation performance of the strain.

[0039] SEQ ID NO.1 (Codon-optimized Himar1 transposase gene sequence)

[0040]

[0041] SEQ ID NO. 2 (desulphobiotin induction element DNA sequence)

[0042] TTAAGAGCCGGACTCACACTTCAGCTGTTTCTCCAGGCCACAGATAATCAGTTCCAGGCCAAACAGAAATGCCGGTTCTGCACCCTGATGGTCGAACAGTTCAATAGCCTGACGCAGCAGAGGCGGCATAGAGTCGGTAGTCGGGGTTTCGCGCTCTTCCTTAGCAACCTGGTGCTCCTGGTCTTCCAGGACGCAACCCAGGGTGAAGTGGCCCACAGCGCTCAGAGCATACAGGGCGTTTTCCAGGCTAAAACCCTGCTGGCACAGGAAGGCCAGTTGGTTTTCCAGGGTTTCGTACTGCTTTTCAGTCGGACGGGTGCCCAGGTGAACTTTCGCGCCGTCACGGTGGGACAGCAGTGCACAACGGAAGCTTTTGGCGTTGTTACGCAGGAAATCCTGCCAAGATTCACCTTCCAGCGGGCAGAAGTGGGTGTGATGACGATCCAGCATCTCGATAGCCAGAGCGTCCAGCAGCGCGCGCTTGTTTTTAACGTGCCAGTACAGGGTCGGCTGTTCGACACCCAGTTTCTGCGCCAGTTTACGCGTGGTCAGGCCTTCGATACCAACCTCGTTCAGCAGTTCCAGAGCGCTATTGATAACTTTGCTTTTATCCAGACGGGACATCATTAATTCCTAATTTTTGTTGACACTCTATCGTTGATAGAGTTATTTTACCACTCCCTATCAGTGATAGAGAAAAGAATTCGTCGACAAAGAGGAGAAAGATATC.

[0043] SEQ ID NO. 3 (sequence of codon-optimised gentamicin resistance gene)

[0044] ATGCTGCGCTCTTCTAATGACGTCACCCAGCAGGGCTCCCGTCCGAAAACGAAGCTGGGTGGTAGCAGCATGGGCATCATCCGCACTTGTCGTCTGGGCCCGGATCAGGTAAAATCCATGCGCGCAGCTCTGGACCTGTTCGGCCGTGAATTCGGTGATGTCGCAACTTACAGCCAGCATCAGCCGGACTCTGACTACCTGGGCAACCTGCTGCGTAGCAAGACCTTCATCGCGCTGGCTGCTTTCGATCAGGAAGCTGTGGTAGGTGCCCTGGCTGCTTACGTTCTGCCGCGTTTCGAGCAGCCACGTTCCGAGATCTACATCTACGATCTGGCAGTTTCTGGTGAACACCGTCGTCAAGGCATCGCGACTGCTCTGATTAACCTGCTGAAACACGAGGCCAACGCTCTGGGTGCGTACGTGATCTACGTACAGGCTGACTACGGTGACGATCCAGCTGTAGCCCTGTACACCAAACTGGGTATCCGCGAAGAAGTTATGCACTTCGATATCGACCCATCTACGGCCACCTAA.

[0045] SEQ ID NO. 4 (Himarl transposase universal recognition sequence 1)

[0046] TAACAGGTTGGCTGATAAGTCCCCGGTCTGACA.

[0047] SEQ ID NO. 5 (Himarl transposase universal recognition sequence 2)

[0048] TGTTAGACCGGGGACTTATCAGCCAACCTGTTA.

[0049] SEQ ID NO. 6 (kanamycin resistance gene with promoter)

[0050] CGCGTATAGCTTGCCGGAAGTCGAAAGCCACGTTGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGAACAATAAAACTGTCTGCTTACATAAACAGTAATACAAGGGGTGTTATGAGCCATATTCAACGGGAAACGTCTTGCTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCGATTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGGAAAACAGCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAGCTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCAGGATCTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCTCCTTCATTACAGAAACGGCTTTTTCAAAAATATGGTATTGATAATCCTGATATGAATAAATTGCAGTTTCATTTGATGCTCGATGAGTTTTTCTAA.

[0051] Sequence as in SEQ ID NO. 7 (original Himar1 gene)

[0052]

Claims

1. A Himarl transposase gene, characterized in that, The sequence of the Himar1 transposase gene is shown as SEQ ID NO.

1.

2. Use of the Himar1 transposase gene of claim 1 in constructing a random mutant library of methanotroph transposon.

3. A method for constructing a library of random mutants of a methanotrophic bacterial transposon, characterized in that, The method comprises the following steps: fusing the Himar1 transposase gene of claim 1 with a desthiobiotin-induced expression element and integrating into the genome of a methanotroph, culturing in a medium with the addition of desthiobiotin to obtain a strain inducing expression of the Himar1 transposase, preparing the above strain into electrotransformation competent cells, mixing the transposon DNA with the electrotransformation competent cells for electrotransformation, and culturing the electrotransformation competent cells after recovery to obtain mutant transformants; the sequence of the desthiobiotin-induced expression element is shown as SEQ ID NO.

2.

4. The method for constructing a library of random mutants of a methanotrophic bacterial transposon according to claim 3, characterized in that, The preparation method of the transposon DNA comprises: adding the Himar1 transposase universal recognition sequence to both ends of the codon artificially optimized gentamicin resistance gene by means of primer introduction, and constructing the transposon DNA by PCR amplification; the sequence of the codon artificially optimized gentamicin resistance gene is shown as SEQ ID NO.

3.

5. The method for constructing a library of random mutants of a methanotrophic bacterial transposon according to claim 3, characterized in that, The electrotransformation condition is 25 μF, 200 Ω, 2.5 kV.

6. The method for constructing a library of random mutants of a methanotrophic bacterial transposon according to claim 3, characterized in that, The induced concentration of desthiobiotin is 15 ng / mL or above.

7. Use of the Himar1 transposase gene of claim 1 or the method for constructing a random mutant library of methanotroph transposon of any one of claims 3-6 in the production of single-cell protein feed.

8. Use of the Himar1 transposase gene of claim 1 or the method for constructing a random mutant library of methanotroph transposon of any one of claims 3-6 in improving the growth rate of methanotrophs.

Images