Primer group for detecting pangolin plague virus, kit and application

Abstract

The invention relates to a primer group for detecting pangolin plague virus, a kit and application, and relates to the technical field of gene engineering. The primer group comprises a forward primer ORF1-F and a reverse primer ORF1-R. The forward primer ORF1-F and the reverse primer ORF1-R. On the basis of the primer group, the E gene in the conserved region of the pangolin plague virus can be specifically recognized, so that the primer group is combined with an RAA amplification system and a detection system, and detection is rapidly completed within a short time under the constant-temperature condition.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of genetic engineering, in particular to a primer set for detecting a pangolin pestivirus, a kit and application thereof. BACKGROUND

[0002] Pangolins belong to the genus Manis (family: Manidae, order: Pholidota, class: Mammalia). Their bodies are covered with scales and they have no teeth. Pangolins are nocturnal animals that feed on termites and ants, so they are also known as scaly ant-eaters. In the global wildlife trade, pangolins are the most affected species among mammals because their meat and medicinal value are exaggerated, and the Chinese and Malayan pangolins are listed as critically endangered species in the Red List of Endangered Species of the International Union for Conservation of Nature.

[0003] Pangolin viruses belong to the Pestivirus genus of the Flaviviridae family and are positive-strand single-strand RNA viruses. They are spherical and have an envelope. Pestiviruses mainly infect pigs and ruminants and cause serious diseases in animals, such as hemorrhagic diseases in pigs, cattle and sheep, and respiratory diseases. They have been detected in wild animals such as bamboo rats, pangolins, giraffes and wild deer. Rescued pangolins are prone to death, and a case of death of a pangolin in Zhejiang in 2020 was identified as a kind of pangolin pestivirus and enterovirus in its body. At the same time, the pangolin pestivirus is also considered to be one of the causes of the death of the pangolin. Traditional diagnostic methods for pangolin pestivirus include reverse transcription polymerase chain reaction (RT-PCR), electron microscopy, immunohistochemistry, and fluorescent quantitative PCR, but these diagnostic methods not only consume time and money, but also are not convenient to operate in practice. In recent years, nucleic acid isothermal amplification technologies such as recombinase-aid amplification (RAA) technology have been developed, which is a nucleic acid detection technology that can replace PCR. RAA is a constant-temperature nucleic acid rapid amplification technology that can make the final amplification product grow exponentially, complete the amplification of the target gene, and provide rapid and effective pathogen detection for the protection of wild pangolins and the detection of pangolin viruses. Therefore, there is an urgent need for a primer that can rapidly detect pangolin pestivirus. SUMMARY

[0004] In order to solve the above problems, the present application provides a primer set for detecting a pangolin pestivirus, which can specifically recognize the conserved region E gene of the pangolin pestivirus based on the primer set, so as to combine with the RAA amplification system and the detection system, and complete the detection in a short time under constant temperature conditions.

[0005] In order to achieve the above purpose, the present application provides a primer set for detecting a pangolin pestivirus, which comprises a forward primer ORF1-F and a reverse primer ORF1-R.

[0006] the forward primer ORF1-F: ATGGGTGTTGTTACTCTCTGGGGTCAACGCC (SEQ ID NO: 1);

[0007] the reverse primer ORF1-R: ATCCAGATTGTAATCTTCCCATTGTGTTGTT (SEQ ID NO: 2).

[0008] In one of the embodiments, the primer set is used for amplifying a target sequence as shown in SEQ ID NO: 5.

[0009] In one of the embodiments, the 5' end of the forward primer ORF1-F is modified by biotin.

[0010] The application further provides an application of the primer set in preparing a kit for detecting the giant panda pestivirus.

[0011] The application further provides a kit for detecting the giant panda pestivirus, comprising an amplification system and a detection system, wherein the amplification system comprises the primer set.

[0012] The kit can complete the detection within 25 min under the condition of constant temperature at 39℃, does not have cross-reaction with other common pathogens, can rapidly detect the novel giant panda pestivirus infection, has high specificity and sensitivity, and is suitable for providing the method for the giant panda epidemic disease monitoring, the zoo quarantine and the wild giant panda protection.

[0013] In one of the embodiments, the amplification system further comprises a probe ORF1-probe, and the probe ORF1-probe comprises a first probe segment and a second probe segment.

[0014] The sequence of the first probe segment is GTTTAAGTACGCCCTTGCCTCAGGAGTA (SEQ ID NO: 3);

[0015] The sequence of the second probe segment is ATCCAGATTGTAATCTTCCCATTGTGTTGTT (SEQ ID NO: 4).

[0016] In one of the embodiments, one end of the first probe segment is modified by fluorescein, the other end of the first probe segment is connected with the second probe segment by tetrahydrofuran, and the remaining one end of the second probe segment has an interval arm modification.

[0017] In one of the embodiments, the 5' end of the first probe fragment is connected with fluorescein, the 3' end of the first probe fragment is connected with the 5' end of the second probe fragment with tetrahydrofuran, and the 3' end of the second probe fragment has an interarm modification.

[0018] In one of the embodiments, the fluorescein is carboxyfluorescein, and the interarm modification is a C3 interarm.

[0019] In one of the embodiments, the detection system comprises a negative control sample, a positive control sample, and a nucleic acid-colloidal gold immunochromatography test strip.

[0020] The application also provides a method for detecting a poxvirus of a pangolin for non-diagnostic purposes, which comprises the following steps: extracting nucleic acid of a sample to be tested, reverse transcribing to obtain cDNA, and detecting by using the kit.

[0021] In one of the embodiments, the detection comprises: performing an amplification reaction on the cDNA by using the amplification system to obtain an amplification product; and detecting the amplification product by using the detection system.

[0022] In one of the embodiments, the amplification reaction is an RAA reaction, and the conditions of the amplification reaction comprise: a temperature of 35-40 DEG C.

[0023] Compared with the prior art, the application has the following beneficial effects:

[0024] The primer set, the kit and the application for detecting a poxvirus of a pangolin can specifically recognize a conserved region E gene of the poxvirus of the pangolin, so that the detection can be rapidly completed in a short time under constant temperature conditions in combination with an RAA amplification system and a detection system. Meanwhile, the application uses an RAA primer pair for specifically recognizing a conserved region gene of the poxvirus of the pangolin and a probe with FAM / Biotin double labels as a basis, further adjusts the concentration of the primer by optimization, uses an RAA-LFD (recombinase aided amplification-flow-through layer chromatography test strip) technology, achieves good effects, obtains a detection result in 25 min under a constant temperature condition of 39 DEG C, amplifies about 10 12 copies, reaches a nucleic acid detectable level, and has the advantages of rapidity and effectiveness. The application also realizes high specificity and high sensitivity of the detection of the poxvirus of the pangolin by optimizing other parameters in the amplification system and combining the designed primer, and the minimum detection limit is: 1.73 x 10 1The detection method for pangolin plague virus provided by this invention exhibits high specificity, with a sensitivity higher than that of conventional PCR methods. It does not cross-react with other common pathogens or react non-specifically with host RNA. The 25 μL system used in this experiment minimizes costs and reduces the detection time to 25 minutes, significantly reducing the required testing time. The invention is simple and easy to operate, requiring no specialized testing personnel for on-site testing; it is rapid and accurate, and has shown good application results in preliminary applications, demonstrating significant importance for the prevention and control of pangolin plague virus. Attached Figure Description

[0025] Figure 1 The diagram illustrates the detection results for primer concentration optimization, where 1: negative control, 2: 0.5 μL, 3: 1 μL, 4: 1.5 μL, and 5: 2 μL.

[0026] Figure 2 A schematic diagram for optimizing the detection results based on reaction time, where 1: negative control, 2: 20 min, 3: 25 min, 4: 30 min, 5: 35 min, 6: 40 min;

[0027] Figure 3 This is a schematic diagram illustrating the results of primer sensitivity analysis, where 1: 1.73 × 10⁻⁶. 4 copies / μL, 2: 1.73×10 3 copies / μL, 3: 1.73×10 2 copies / μL, 4: 1.73×10 1 copies / μL, 5: negative control, 6: 1.73 × 10 -1 copies / μL;

[0028] Figure 4 This is a schematic diagram of the detection results of primer specificity analysis, where 1: positive control, 2: pangolin typhoid virus cDNA, 3: CPV, 4: H9N2, and 5: TGEV. Detailed Implementation

[0029] To facilitate understanding of the present invention, a more complete description will be given below with reference to the accompanying drawings. Preferred embodiments of the invention are shown in the drawings. However, the invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the invention.

[0030] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used herein in the specification of this invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0031] source:

[0032] Unless otherwise specified, all reagents, materials and equipment used in this invention are commercially available; unless otherwise specified, all test methods are conventional test methods in the field.

[0033] Example 1

[0034] Design of specific primers and probes

[0035] The pangolin plague virus RNA was extracted using RNAfast 200 total RNA and prepared using the Prime Script TMIV 1st strand cDNA Synthesis Mix kit. The cDNA was stored at -20℃.

[0036] A positive plasmid was constructed, and a recombinant plasmid DNA containing the target gene ORF1 fragment was created. The recombinant plasmid was transformed into DH5α competent cells for amplification. The plasmid was extracted using the Plasmid Mini Kit I kit, and the plasmid concentration was measured using a full-wavelength microplate reader (Thermo Fisher Scientific). The plasmid was stored at -20℃. The partial genomic sequence of the target gene ORF1 is shown below.

[0037] Target gene fragment:

[0038] ATGGGTGTTGTTACTCTCTGGGGTCAACGCCTATTCATGGGACAAATATTCAAAAAT TAGCTGCAAAGACCAGTTTAAGTACGCCCTTGCCTCAGGAGTAGGTATGGACCTGTTAG GGCCTACCCAGTTAACAACACAATGGGAAGATTACAATCTGGAT(SEQ ID NO.5)

[0039] After comparing the complete sequences of 141 pangolin plague virus strains published in the NCBI GenBank database, specific primers and probes were designed for conserved regions of the pangolin plague virus, as shown in Table 1. The primers and probes were all sent to Shanghai Sangon Biotech for synthesis and modification.

[0040] Table 1 Primer and Probe List

[0041]

[0042] The probe ORF1-probe consists of two parts: the 3' end of SEQ ID NO.3 and the 5' end of SEQ ID NO.4 are connected by tetrahydrofuran; the first part is shown in SEQ ID NO.3, and the second part is shown in SEQ ID NO.4; the 5' end of SEQ ID NO.3 is connected to a carboxyfluorescein group, and the 3' end of SEQ ID NO.4 is connected to a C3 intermarginal arm. PEF: Biotin-ATGGGTGTTGTTACTCTCTGGGGTCAACGCC

[0043] PE-Probe:

[0044] FAM-GTTTAAGTACGCCCTTGCCTCAGGAGTA|THF|ATCCAGATTGTAATCTTCCCATTGT GTTGTT|C3-Spacer|.

[0045] Example 2

[0046] Establishment and optimization of the reaction system

[0047] The total reaction volume of 25 μL contained 5 μL of sterile water, 12.5 μL of A Buffer, 1 μL of 2 μL forward primer, 1 μL of 2 μL reverse primer, 0.5 μL of 2 μM probe, 2.5 μL of cDNA template, and 2.5 μL of B Buffer.

[0048] The specific steps are as follows:

[0049] (1) Add the forward primer, reverse primer and probe described in Example 1 to centrifuge tubes according to volume, then add 12.5 μL of A Buffer, shake briefly and centrifuge quickly; put 2.5 μL of cDNA template and 5 μL of sterile water into a PCR tube, mix well, put into the centrifuge tube, shake briefly and centrifuge quickly to obtain a mixed solution.

[0050] (2) Transfer the above mixed solution to a reaction unit tube containing the reaction dry powder and gently tap to mix.

[0051] (3) Add 2.5 μL of B Buffer, mix thoroughly, and activate the reaction;

[0052] (4) Place the reaction tube in a thermostat at 39°C and incubate for 30 minutes;

[0053] (5) After the reaction is complete, take 5 μL of the reaction product and mix it with 95 μL of sterile water;

[0054] (6) Visual detection using single nucleic acid test strips: Transfer 80 μL of diluted sample to the sample pad of the single nucleic acid test strip; observe the results after 2-5 minutes;

[0055] The results are defined as follows: a positive sample should show two bands, while a negative sample should only show one band at the control line; when red bands appear at both the control line and the test line of the re-nucleic acid test strip, the sample is considered to contain pangolin plague virus.

[0056] Primer concentration optimization: With other reaction components remaining constant, upstream and downstream primers were added to the reaction system at volumes of 2 μL, 1.5 μL, 1 μL, and 0.5 μL, respectively, and brought to a final volume of 25 μL with sterile water. The reaction conditions remained unchanged, and a negative control (sterile water) was included to optimize the primer concentration for the RAA-LFD detection method. Amplification and detection of the positive standard plasmid were performed using primers at different concentrations, and the results are shown below. Figure 1 As shown, clearer detection and control lines appeared at the lowest primer concentration of 0.5 μL.

[0057] To conserve primers, 0.5 μL of primers will be used for the reaction in the following steps.

[0058] Optimization of reaction time: With other reaction components in the system remaining unchanged, the reaction time of the experiment was carried out in gradients of 20 min, 25 min, 30 min, 35 min, and 40 min, with a negative control (sterile water) set up, to optimize the reaction time of the RAA-LFD detection method.

[0059] Under different reaction time conditions, the shortest reaction time with clear bands and no drag was selected, and the results are as follows: Figure 2 As shown, clear detection bands and control lines appeared in as little as 20 minutes. To improve detection efficiency, a reaction time of 20 minutes was selected as the reaction time for subsequent embodiments.

[0060] Example 3

[0061] Determination of sensitivity test

[0062] The concentration of the constructed positive plasmid was determined using a full-wavelength microplate reader (Thermo Fisher Scientific). The copy number was calculated using the following formula: Copy number (copies / μL) = [DNA concentration (ng / μL) / fragment size (bp)] × 9.12 × 10⁻⁶ 11 The positive plasmid was then serially diluted 10-fold. Using the positive plasmids at different dilutions as templates, the primer concentrations and reaction conditions optimized in Example 2 were used, and a negative control (sterile water) was set up to determine the sensitivity of the RAA-LFD detection method.

[0063] The positive plasmids at different dilutions were detected according to the RAA-LFD detection method in Example 2.

[0064] The results are as follows Figure 3 As shown, from Figure 3 As can be seen from the data, when the first primer pair (PEF, PER) and probe (PE-Probe) are used in the RAA-LFD method, the copy number is 1.73 × 10⁻⁶. 4 1.73×10 3 1.73×10 2 1.73×10 1 1.73×10 -1 When the concentration is 1 copies / μL, clear detection and control bands are visible, indicating that the method has a sensitivity of 1.73 × 10⁻⁶. 1 copies / μL.

[0065] The sensitivity of conventional PCR detection using a self-built system is approximately 10. 3 The reaction system for conventional PCR consisted of 25 μL of 2×Taq buffer (Nanjing Novizan Biotechnology Co., Ltd.), 10 μM of forward and reverse primers (sequences: F: 5'-GGTGTTGTTACTCTCTGGGGTCA-3' (SEQ ID NO. 6), R: 5'-TTGTAATCTTCCCATTGTGTTGT-3' (SEQ ID NO. 7)), and 2 μL of template DNA. The reaction program was as follows: pre-denaturation at 95℃ for 5 min; followed by 35 cycles (95℃ for 30 s, 60℃ for 30 s, 72℃ for 15 s); and a final extension at 72℃ for 7 min. The amplified products were detected by 1% agarose gel electrophoresis. In comparison, the sensitivity of this detection method (RAA-LFD) was approximately 100-fold higher, indicating that the RAA-LFD detection method in this experiment has high sensitivity.

[0066] Example 4

[0067] Specificity test determination

[0068] To investigate whether the RAA-LFD detection method would cross-react with other pathogens, DNA or cDNA of canine parvovirus (CPV), low pathogenic avian influenza H9N2, and transmissible gastroenteritis virus (TGEV) were used as templates. Positive plasmid DNA containing the E gene fragment of pangolin plague virus was used as a template as a positive control to evaluate the specificity of the RAA-LFD detection method.

[0069] The above-mentioned different templates were detected according to the RAA-LFD detection method of the present invention.

[0070] The results are as follows Figure 4 The results showed that no bands appeared at the test line of the colloidal gold immunochromatographic test strip sample pad after the negative control was reacted with CPV, H9N2, and TGEV as templates, while bands appeared at the test line of the colloidal gold immunochromatographic test strip sample pad of the positive control.

[0071] The above results indicate that this detection method does not cross-react with other common pathogens, does not react nonspecifically with host RNA, and has high specificity.

[0072] In summary, this invention provides a RAA primer pair that specifically identifies the conserved E gene of pangolin septicemia virus and a probe with FAM / Biotin dual labeling. Furthermore, by optimizing the primer concentration and using RAA-LFD technology, rapid detection of pangolin septicemia virus with high specificity and high sensitivity can be achieved.

[0073] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0074] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. A primer set for detecting pangolin plague virus, characterized in that, The primer set includes the forward primer ORF1-F and the reverse primer ORF1-R; The forward primer ORF1-F is: ATGGGTGTTGTTACTCTCTGGGGTCAACGCC (SEQ ID NO: 1); The reverse primer ORF1-R is: ATCCAGATTGTAATCTTCCCATTGTGTTGTT (SEQ ID NO: 2).

2. The primer set according to claim 1, characterized in that, The primer set is used to amplify the target sequence, which is shown in SEQ ID NO:

5.

3. The primer set according to claim 1, characterized in that, The 5' end of the forward primer ORF1-F is modified with biotin.

4. The use of the primer set according to any one of claims 1-3 in the preparation of a kit for detecting pangolin typhus virus.

5. A kit for detecting pangolin plague virus, characterized in that, It includes an amplification system and a detection system, wherein the amplification system includes the primer set according to any one of claims 1-3.

6. The reagent kit according to claim 5, characterized in that, The amplification system further includes a probe ORF1-probe, which includes a first probe fragment and a second probe fragment. The sequence of the first probe fragment is shown in SEQ ID NO: 3, and the sequence of the second probe fragment is shown in SEQ ID NO:

4.

7. The reagent kit according to claim 6, characterized in that, One end of the first probe fragment is modified with fluorescein, the other end of the first probe fragment is connected to the second probe fragment with tetrahydrofuran, and the remaining end of the second probe fragment has an interarm modification.

8. A method for detecting pangolin plague virus for non-diagnostic purposes, characterized in that, The detection method includes the following steps: extracting nucleic acid from the sample to be tested, reverse transcribing to obtain cDNA, and detecting it using the kit described in any one of claims 5-7.

9. The detection method according to claim 8, characterized in that, The detection includes: amplifying the cDNA using the amplification system to obtain an amplification product; and detecting the amplification product using the detection system.

10. The detection method according to claim 9, characterized in that, The amplification reaction is a RAA reaction, and the conditions for the amplification reaction include a temperature of 35-40℃.

Images