Universal aptamer sensor detection platform and applications thereof

Abstract

The application relates to a universal aptamer sensor detection platform and application thereof. The detection platform comprises an aptamer sensor module, the aptamer sensor module comprising at least one of a first aptamer sensor and a second aptamer sensor, the first aptamer sensor comprising, from a 5' end to a 3' end, a first signal output sequence, a first promoter sequence, a first target aptamer sequence and an Assistor sequence; the second aptamer sensor comprising, from a 5' end to a 3' end, a second signal output sequence, a second promoter sequence, a second target aptamer sequence and a Locker sequence; and a reaction regulation module, the reaction regulation module comprising a polymerization reaction unit and a transcription reaction unit. The platform has good sensitivity (sub-nanomolar level) and fast response time (<40 min), and has universality, programmability and portability.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to a universal aptamer sensor detection platform and application thereof. BACKGROUND

[0002] Aptamer is a special single-stranded oligonucleotide, which can bind to target substances with high affinity and specificity through hydrogen bonds, electrostatic interactions, hydrophobic interactions and van der Waals forces. Moreover, there are only two cases of base complementary pairing and base non-complementary pairing between the 5' end and the 3' end of the aptamer. On this basis, a universal aptamer sensor detection platform is designed and assembled, which realizes the selection of different detection modes according to different detection targets.

[0003] Small molecule biosensors can accurately qualitatively and quantitatively detect small molecules without external equipment, which is of great significance to solve many problems in disease diagnosis, environment and food. It is still challenging to systematically convert the combination of small molecule antibodies, small molecule switches and aptamers into effective output signals. SUMMARY

[0004] Therefore, the present application provides a universal aptamer sensor detection platform and application thereof. The universal aptamer sensor detection platform utilizes two main functional regulatory components (polymerization and transcription) to realize the response to target molecules, and utilizes different downstream pathways to meet different sensitivity requirements.

[0005] The first aspect of the present application provides a universal aptamer sensor detection platform, comprising:

[0006] An aptamer sensor module, the aptamer sensor module comprising at least one of a first aptamer sensor and a second aptamer sensor, the first aptamer sensor comprising, from 5' end to 3' end: a first signal output sequence, a first promoter sequence, a first target aptamer sequence and an Assistor sequence; the second aptamer sensor comprising, from 5' end to 3' end: a second signal output sequence, a second promoter sequence, a second target aptamer sequence and a Locker sequence;

[0007] A reaction regulation module, the reaction regulation module comprising a polymerization reaction unit and a transcription reaction unit.

[0008] In the above universal aptamer sensor detection platform, the target aptamer integrated into the transcription template is used as a functional input, which can be designed and programmed to achieve wide target molecule compatibility, and utilizes two main functional regulatory components (polymerization and transcription) to achieve response to target molecules, and finally utilizes different downstream pathways to meet different sensitivity requirements. Through experimental verification, the universal aptamer sensor detection platform of the application has two different working modes: the first mode is a 'turn on' mode, in which after the target molecule binds to the DNA aptamer, the stem-loop structure is promoted to form, the subsequent DNA polymerization and transcription are activated, and the corresponding detection signal is output. Through continuous optimization, this mode realizes high sensitivity (detection limit of 51.60 nM) and high specificity detection with a shorter response time (<40 min). The second mode is a 'turn off' mode, in which after the target molecule binds to the DNA aptamer, the Locker DNA hybridizes with the T7 promoter, the DNA polymerization-transcription cascade reaction is inhibited, and the signal attenuation is induced. The detection limit of this mode is 7.664 μM, and it also has good specificity and selectivity. At the same time, by integrating with split CRISPR / Cas12a, with the help of spectrum and lateral flow assay (LFA), the analysis performance is significantly enhanced, and the portability and visualization of detection are realized. This platform has good sensitivity (sub-nanomolar level) and fast response time (<40 min), and also has universality, programmability and portability.

[0009] In some embodiments, the first signal output sequence contains a template sequence of the MG aptamer, the first promoter sequence contains a T7 promoter sequence, the first target aptamer sequence contains a DNA aptamer sequence of phenylalanine, and the Assistor sequence is used to promote 5' end and 3' end base complementary pairing of the template sequence of the MG aptamer.

[0010] In some embodiments, the template sequence of the MG aptamer is shown as SEQ ID NO. 1, the T7 promoter sequence is shown as SEQ ID NO. 2, the DNA aptamer sequence of phenylalanine is shown as SEQ ID NO. 3, and the length of the Assistor sequence is 0 nt-5 nt.

[0011] Further, the sequence of the first aptamer sensor contains any one of the sequences shown as SEQ ID NO. 4-SEQ ID NO. 9.

[0012] In some embodiments, the use concentration of the first aptamer sensor is 5 nM-250 nM; preferably, the use concentration of the first aptamer sensor is 50 nM.

[0013] In some embodiments, the response time of the universal aptamer sensor detection platform for detecting phenylalanine is 40 min to 4.5 h, preferably 40 min, when the aptamer sensor module is the first aptamer sensor.

[0014] In some embodiments, the second signal output sequence contains a template sequence of the Broccoli aptamer, the second promoter sequence contains a T7 promoter sequence, the second target aptamer sequence contains a DNA aptamer sequence of tyrosine, and the Locker sequence is used to form a stem-loop structure of the second aptamer sensor.

[0015] In some embodiments, the template sequence of the Broccoli aptamer is as shown in SEQ ID NO. 10, and the DNA aptamer sequence of tyrosine is as shown in SEQ ID NO. 11, and the length of the Locker sequence is 6 nt-11 nt.

[0016] Further, the sequence of the second aptamer sensor contains any one of the sequences as shown in SEQ ID NO. 12-SEQ ID NO. 17.

[0017] Further, the use concentration of the second aptamer sensor is 5 nM-250 nM; preferably, the use concentration of the second aptamer sensor is 100 nM.

[0018] In some embodiments, the signal output module further comprises a luminescent dye, and the luminescent dye is used to produce a luminescent signal in combination with the aptamer sensor module.

[0019] In some embodiments, the template sequence of the Broccoli aptamer is as shown in SEQ ID NO. 18.

[0020] Further, the sequence of the second aptamer sensor contains a sequence as shown in SEQ ID NO. 19.

[0021] Further, the use concentration of the second aptamer sensor is 1 nM-100 nM; preferably, the use concentration of the second aptamer sensor is 2 nM.

[0022] In some embodiments, the signal output module further comprises at least one of a fluorescent signal reporter probe and a visual signal reporter probe, and a Cas enzyme, a scaffold RNA and a dsDNA.

[0023] Further, the fluorescent group of the fluorescent signal reporter probe is FAM, and the quenching group is BHQ1; the 5' end of the visualization signal reporter probe is connected with FAM, and the 3' end is connected with biotin; the Cas enzyme is a Cas12a enzyme; the sequence of the scaffold RNA is shown as SEQ ID NO. 20; and the sequence of the dsDNA is shown as SEQ ID NO. 21-SEQ ID NO. 22.

[0024] In some embodiments, the polymerization reaction unit comprises a DNA polymerase, and the DNA polymerase is phi29 DNA polymerase.

[0025] The transcription reaction unit comprises a T7 RNA polymerase.

[0026] The second aspect of the present application provides an application of the above-mentioned universal aptamer sensor detection platform in detecting target substances or preparing reagents or equipment for detecting target substances.

[0027] The third aspect of the present application provides an aptamer sensor, which comprises, from 5' end to 3' end, a signal output sequence, a promoter sequence, a target aptamer sequence, and a regulatory sequence, wherein the regulatory sequence is an Assistor sequence or a Locker sequence; the Assistor sequence is used to promote the base complementary pairing of the 5' end and the 3' end of the signal output sequence, and the Locker sequence is used to form a stem-loop structure of the aptamer sensor. BRIEF DESCRIPTION OF DRAWINGS

[0028] Figure 1 The detection principle diagram for the 'turn on' mode;

[0029] Figure 2 The detection principle diagram for the 'turn off' mode;

[0030] Figure 3 The portable 'turn off' mode detection principle diagram;

[0031] Figure 4 The nucleic acid sequence related to the 'turn on' detection platform;

[0032] Figure 5 The nucleic acid sequence related to the 'turn off' detection platform;

[0033] Figure 6 The nucleic acid sequence related to the portable aptamer sensor detection platform;

[0034] Figure 7 The result diagram for screening the optimal conditions of the 'turn-on' mode;

[0035] Figure 8 Fluorescence intensity and plateau response of 'turn-on' mode in the absence and presence of different kinds of DNA polymerases;

[0036] Figure 9 Response of 'turn-on' mode to different concentrations of Phe;

[0037] Figure 10 Fluorescence response of 'turn-on' mode to non-specific target (80 μΜ) and Phe (8 μΜ);

[0038] Figure 11 Detection results of response time of 'turn-on' mode in stepwise optimization;

[0039] Figure 12 Response of fast 'turn-on' mode to different concentrations of Phe;

[0040] Figure 13 Results of screening of the best conditions for 'turn-off' mode;

[0041] Figure 14 Fluorescence intensity and plateau response of 'turn-off' mode in the absence and presence of different kinds of DNA polymerases;

[0042] Figure 15 Response of 'turn-off' mode to different concentrations of Tyr;

[0043] Figure 16 Fluorescence response of 'turn-off' mode to non-specific target (200 μΜ) and Tyr (20 μΜ);

[0044] Figure 17 Principle diagram of portable 'turn-off' mode fluorescence assay;

[0045] Figure 18 Fluorescence intensity of different concentrations of aptamer sensors in the absence of Tyr in portable 'turn-off' mode;

[0046] Figure 19 Response of portable 'turn-off' mode to different concentrations of Tyr;

[0047] Figure 20 LFA results of portable 'turn-off' mode. DETAILED DESCRIPTION

[0048] The application will be described in further detail below with reference to the embodiments and examples. It should be understood that these embodiments and examples are only used to explain the application and not intended to limit the scope of the application. The purpose of providing these embodiments and examples is to make the disclosure of the application more thoroughly and comprehensively understood. It should also be understood that the application can be implemented in many different forms and is not limited to the embodiments and examples described in the application. Those skilled in the art can make various changes or modifications without departing from the spirit and scope of the application, and the equivalent forms obtained by the changes or modifications also fall within the protection scope of the application. In addition, in the following description, a large number of specific details are given in order to provide a more complete understanding of the application. It should be understood that the application can be implemented without one or more of these details.

[0049] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used in the description of the application herein is for the purpose of describing the embodiments and examples only and is not intended to be limiting of the application.

[0050] Unless otherwise indicated or contradictory, the terms or phrases used in the application have the following meanings:

[0051] The selection range of the terms "and / or", "or / and", "and / or" used in the application includes any one of two or more related listed items, and also includes any and all combinations of the related listed items, including any two related listed items, any more related listed items, or all related listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and / or", "or / and", "and / or", it should be understood that in the application, the technical solution undoubtedly includes the technical solution connected by "logical and", and also undoubtedly includes the technical solution connected by "logical or". For example, "A and / or B" includes three parallel solutions of A, B and A+B. For another example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C and D (i.e. the technical solution connected by "logical or"), and also includes any and all combinations of A, B, C and D, i.e. includes the combination of any two or any three of A, B, C and D, and also includes the four-item combination of A, B, C and D (i.e. the technical solution connected by "logical and").

[0052] In the application, "preferably", "better", "better", "as appropriate" only describe the embodiments or examples with better effects, and it should be understood that it does not constitute a limitation on the protection scope of the application.

[0053] In the present application, "further", "even further", "in particular" and the like are used for descriptive purposes only and shall not be construed as limiting the scope of the present application.

[0054] In the present application, "optionally", "optional" and "optional" mean optional, i.e. selected from either of the two parallel schemes "with" or "without". If there are multiple "options" in a technical solution, and there is no contradictory or mutually restrictive relationship, each "option" is independent.

[0055] In the present application, the terms "first", "second", "third", "fourth" and the like in "first aspect", "second aspect", "third aspect", "fourth aspect" and the like are only used for descriptive purposes and cannot be understood as indicating or implying relative importance or quantity, nor can they be understood as implicitly indicating the importance or quantity of the indicated technical features. Moreover, "first", "second", "third", "fourth" and the like only serve the purpose of non-exhaustive enumeration and description, and should be understood as not constituting a closed limitation on the quantity.

[0056] In the present application, the technical features described in an open manner include both closed technical solutions consisting of listed features and open technical solutions containing listed features.

[0057] In the present application, %(w / w) and wt% both represent weight percentage, %(v / v) represents volume percentage, and %(v / v) represents mass volume percentage.

[0058] All documents mentioned in the present application are cited as references in the present application, as if each document is cited as a reference individually. Unless and to the extent that the cited documents conflict with the purpose and / or technical solutions of the present application, the cited documents are cited in the present application in their entirety and for all purposes. When the present application refers to the cited documents, the definitions of relevant technical features, terms, nouns, phrases and the like in the cited documents are also cited. When the present application refers to the cited documents, the examples and preferred modes of the cited relevant technical features can also be incorporated into the present application as references, but are limited to the implementation of the present application. It should be understood that when the cited content conflicts with the description in the present application, the present application is given priority or is modified adaptively according to the description in the present application.

[0059] It is still challenging to systematically convert the binding of small molecule antibodies, small molecule switches and aptamers into effective output signals. In order to overcome the above problems, the present application provides a universal aptamer sensor detection platform and its application. The universal aptamer sensor detection platform utilizes two main functional regulatory components (polymerization and transcription) to realize the response to target molecules, and utilizes different downstream pathways to meet different sensitivity requirements.

[0060] The first aspect of the application provides a universal aptamer sensor detection platform, comprising:

[0061] an aptamer sensor module, the aptamer sensor module comprising at least one of a first aptamer sensor and a second aptamer sensor, the first aptamer sensor comprising, from 5' end to 3' end: a first signal output sequence, a first promoter sequence, a first target aptamer sequence, and an Assistor sequence; the second aptamer sensor comprising, from 5' end to 3' end: a second signal output sequence, a second promoter sequence, a second target aptamer sequence, and a Locker sequence;

[0062] a reaction regulation module, the reaction regulation module comprising a polymerization reaction unit and a transcription reaction unit.

[0063] In the universal aptamer sensor detection platform described above, the target aptamer integrated into the transcription template is used as a functional input, which can be designed and programmed to achieve wide target molecule compatibility, and two main functional regulation components (polymerization and transcription) are used to achieve response to target molecules, and finally different downstream pathways are used to meet different sensitivity requirements. Through experiments, it has been verified that the universal aptamer sensor detection platform of the application has two different working modes: the first mode is 'turn on' mode, after the target molecule binds to the DNA aptamer, the formation of the stem-loop structure is promoted, the subsequent DNA polymerization and transcription are activated, and the corresponding detection signal is output. This mode is continuously optimized, and high sensitivity (detection limit of 51.60 nM) and high specificity detection are achieved by using a shorter response time (<40 min). The second mode is 'turn off' mode, after the target molecule binds to the DNA aptamer, the Locker DNA and the T7 promoter hybridization is destroyed, the DNA polymerization-transcription cascade reaction is inhibited, and the signal attenuation is induced. The detection limit of this mode is 7.664 μM, and it also has good specificity and selectivity. At the same time, by integrating with the split CRISPR / Cas12a, with the help of spectrum and lateral flow assay (LFA), the analysis performance is significantly enhanced, and the portability and visualization of detection are realized. This platform has good sensitivity (sub-nanomolar level) and fast response time (<40 min), and at the same time has universality, programmability and portability.

[0064] After a large number of investigations, it is found that the 5' end and 3' end of the aptamer of phenylalanine (Phe) are complementary base pairing, and the 5' end and 3' end of the aptamer of tyrosine (Tyr) are not complementary base pairing. And by detecting the content of phenylalanine and tyrosine in the human body, it can be judged whether it is a patient with phenylketonuria. Phenylketonuria (PKU), also known as phenylalanine hydroxylase (PAH) deficiency, is an autosomal recessive genetic disease caused by pathogenic variants of PAH gene, which is a congenital error in phenylalanine metabolism. PAH can catalyze the hydroxylation of phenylalanine (Phe) to form tyrosine (Tyr), and Tyr can participate in various metabolisms in the human body, including the production of neurotransmitters dopamine, adrenaline and norepinephrine, the conversion of thyroid to thyroxine, etc. Therefore, the lack of PAH or reduced enzyme activity will lead to hyperphenylalaninemia (HPA), mild Tyr deficiency, Phe accumulation; in severe cases, urine containing phenylpyruvic acid (the product of phenylalanine deamination) and other benzene ketone bodies is excreted. Clinically, untreated severe patients will have mental retardation, epilepsy, behavioral, mental and motor problems, and light pigmentation of the skin, eyes and hair, eczema and moldy odor. And the serum concentration of phenylalanine in healthy individuals is 60 ± 30 μM, according to the first European PKU guidelines, PAH deficiency is divided into mild HPA (Phe concentration is 120-360 μM) and PKU (Phe concentration is greater than 360 μM).

[0065] Based on this, the present application takes phenylalanine and tyrosine as target substances in 'turn-on' mode and 'turn-off' mode to construct a detection platform.

[0066] As Figure 1 ( Figure 1As shown in the schematic diagram of the 'turn on' mode detection principle, the 'turn on' mode consists of five parts, which are the construction of the aptamer sensor, the recognition of the target substance, the polymerization of DNA, the transcription and the signal output of the downstream pathway. When the 5' end and 3' end of the aptamer of the target substance are base complementary pairing, the 'turn on' mode is selected. The aptamer sensor consists of four parts, from 5' end to 3' end, which are signal output (RNA aptamer template chain), T7 promoter, target aptamer and Assistor. When the aptamer binds to the target substance, the Assistor at the 3' end of the aptamer sensor promotes the base complementary pairing of the 5' end and 3' end of the aptamer. Therefore, in the presence of the target substance, the structure of the aptamer sensor changes to form a stem-loop structure, which is normally polymerized and extended under the action of DNA polymerase, forming a complete double-stranded sequence, so that the aptamer sensor becomes an open state. Therefore, the T7 RNA polymerase recognizes the complete T7 promoter and starts transcription to generate RNA aptamer. This RNA aptamer can specifically bind to the corresponding dye, and the complex formed after excitation can emit fluorescence, which is finally monitored by the instrument for signal output. When the target substance is not present, the aptamer sensor remains in the initial state, and thus cannot be normally polymerized and transcribed, which ultimately affects the generation of the corresponding RNA aptamer, causing the corresponding fluorescence signal to decay.

[0067] In some embodiments, the first signal output sequence contains a template sequence of the MG aptamer, the first promoter sequence contains a T7 promoter sequence, the first target aptamer sequence contains a DNA aptamer sequence of phenylalanine, and the Assistor sequence is used to promote base complementary pairing of the 5' end and 3' end of the template sequence of the MG aptamer.

[0068] wherein the template sequence of the MG aptamer is shown in SEQ ID NO. 1, the T7 promoter sequence is shown in SEQ ID NO. 2, the DNA aptamer sequence of phenylalanine is shown in SEQ ID NO. 3, and the length of the Assistor sequence is 0 nt-5 nt.

[0069] Further, the sequence of the first aptamer sensor contains any one of the sequences shown in SEQ ID NO. 4-SEQ ID NO. 9.

[0070] Specifically:

[0071] the sequence shown in SEQ ID NO. 1:

[0072] GGATCCATTCGTTACCTGGCTCTCGCCAGTCGGGATCC;

[0073] The sequence shown in SEQ ID NO.2 is: CCCTATAGTGAGTCGTATTA;

[0074] The sequence shown in SEQ ID NO.3:

[0075] CGACCGCGTTTCCCAAGAAAGCAAGTATTGGTTGGTCG;

[0076] The sequence shown in SEQ ID NO.4:

[0077] GGATCCATTCGTTACCTGGCTCTCGCCAGTCGGGATCCCCCTATAGTGAGTCGTATTACGACCGCGTT TCCCAAGAAAGCAAGTATTGGTTGGTCG ;

[0078] The sequence shown in SEQ ID NO.5:

[0079] GGATCCATTCGTTACCTGGCTCTCGCCAGTCGGGATCCCCCTATAGTGAGTCGTATTACGACCGCGTT TCCCAAGAAAGCAAGTATTGGTTGGTCG T;

[0080] The sequence shown in SEQ ID NO.6:

[0081] GGATCCATTCGTTACCTGGCTCTCGCCAGTCGGGATCCCCCTATAGTGAGTCGTATTACGACCGCGTT TCCCAAGAAAGCAAGTATTGGTTGGTCG TA;

[0082] The sequence shown in SEQ ID NO.7:

[0083] GGATCCATTCGTTACCTGGCTCTCGCCAGTCGGGATCCCCCTATAGTGAGTCGTATTACGACCGCGTT TCCCAAGAAAGCAAGTATTGGTTGGTCG TAA;

[0084] The sequence shown in SEQ ID NO.8:

[0085] GGATCCATTCGTTACCTGGCTCTCGCCAGTCGGGATCCCCCTATAGTGAGTCGTATTACGACCGCGTT TCCCAAGAAAGCAAGTATTGGTTGGTCG TAAT;

[0086] The sequence shown in SEQ ID NO.9:

[0087] GGATCCATTCGTTACCTGGCTCTCGCCAGTCGGGATCCCCCTATAGTGAGTCGTATTACGACCGCGTT TCCCAAGAAAGCAAGTATTGGTTGGTCG TAATA.

[0088] Note: As shown in the sequences SEQ ID NO.4-SEQ ID NO.9, " "Represents the template sequence of the MG aptamer;" "Indicates the T7 starter sequence;" "" indicates the DNA aptamer of Phe; un-underlined indicates the Assistor sequence.

[0089] The aptamer of Phe has complementary base pairing at the 5' and 3' ends, therefore, as Figure 1As shown, the aptamer sensor consists of an MG aptamer template strand, a T7 promoter, a Phe aptamer, and an assistor, located from the 5' to the 3' end, respectively. In the presence of Phe, the aptamer sensor structure changes, forming a stem-loop structure. Under the action of phi29 DNA polymerase, it polymerizes and extends normally, forming a complete double-stranded structure, thus becoming active. After recognizing the complete T7 promoter, T7 RNA polymerase initiates transcription, generating the corresponding MG aptamer. This MG aptamer binds to malachite green (MG) dye, forming a complex that emits fluorescence upon excitation, which is then detected by the instrument. For the final signal output, the optimal excitation and emission wavelengths for RNA-dye are set to 616 nm and 655 nm, respectively. The difference in fluorescence intensity between the presence and absence of Phe is used as the standard for evaluating the response of the detection platform. The length of the assistor and the concentration of the aptamer sensor affect the affinity for Phe binding, while the type of DNA polymerase affects the polymerization effect; ultimately, all three factors influence the platform's response. In some embodiments, the concentration of the first aptamer sensor is 5 nM to 250 nM. Preferably, the concentration used for the first aptamer sensor is 50 nM. Using 50 nM results in a better platform response.

[0090] When the aptamer sensor module is the first aptamer sensor, the response time for phenylalanine detection using the universal aptamer sensor detection platform is 40 min to 4.5 h, preferably 40 min. A 40-minute response time facilitates point-of-care testing (POCT).

[0091] like Figure 2 ( Figure 2As shown in FIG. 1 (schematic diagram of the 'turn off' mode detection principle), the 'turn off' mode is composed of five parts, which are the construction of aptamer sensor, the recognition of target substance, the polymerization of DNA, transcription and the signal output of downstream pathway. When the 5' end and 3' end bases of the aptamer of the target substance are not complementary to each other, the 'turn off' mode is selected. Among them, the aptamer sensor is composed of four parts, from 5' end to 3' end, which are signal output, T7 promoter, aptamer and Locker. The Locker at the 3' end makes the sensor have a stem-loop structure in the initial state. When the target substance exists, the sensor structure changes, breaks the original stem-loop structure, hinders the normal polymerization and extension of DNA, so that the DNA cannot extend a complete T7 promoter sequence, the sensor becomes a closed state, affects the generation of the corresponding RNA aptamer, thereby affecting the formation of the RNA-dye complex, and finally makes the corresponding fluorescence signal decay. When the target substance does not exist, the sensor stem-loop structure stably exists, and under the action of DNA polymerase, it is normally polymerized and extended to form a complete double-stranded sequence. The T7 RNA polymerase recognizes the T7 promoter and starts transcription to generate the RNA aptamer. After the dye is combined, the complex is excited to emit fluorescence and output signal. Therefore, the output signals are different in the presence and absence of the target substance, and finally the response of the platform is realized.

[0092] In some embodiments, the second signal output sequence contains a template sequence of Broccoli aptamer, the second promoter sequence contains a T7 promoter sequence, the second target aptamer sequence contains a DNA aptamer sequence of tyrosine, and the Locker sequence is used to form a stem-loop structure of the second aptamer sensor.

[0093] The template sequence of the Broccoli aptamer is shown in SEQ ID NO. 10, the DNA aptamer sequence of tyrosine is shown in SEQ ID NO. 11, and the length of the Locker sequence is 6 nt-11 nt.

[0094] Further, the sequence of the second aptamer sensor contains any one of the sequences shown in SEQ ID NO. 12-SEQ ID NO. 17.

[0095] Specifically:

[0096] The sequence shown in SEQ ID NO. 10 is:

[0097] GTATGTGGGAGCCCACACTCTACTCGACAGATACGAATATCTGGACCCGACCGTCTCCCACATAC;

[0098] the sequence shown as SEQ ID NO. 11:

[0099] TGTGGTGTGTGAGTGCGGTGCCC;

[0100] the sequence shown as SEQ ID NO. 12:

[0101] GTATGTGGGAGCCCACACTCTACTCGACAGATACGAATATCTGGACCCGACCGTCTCCCACATACCCC TATAGTGAGTCGTATTATGTGGTGTGTGAGTGCGGTGCCC TAATAC;

[0102] the sequence shown as SEQ ID NO. 13:

[0103] GTATGTGGGAGCCCACACTCTACTCGACAGATACGAATATCTGGACCCGACCGTCTCCCACATACCCC TATAGTGAGTCGTATTATGTGGTGTGTGAGTGCGGTGCCC TAATACG;

[0104] the sequence shown as SEQ ID NO. 14:

[0105] GTATGTGGGAGCCCACACTCTACTCGACAGATACGAATATCTGGACCCGACCGTCTCCCACATACCCC TATAGTGAGTCGTATTATGTGGTGTGTGAGTGCGGTGCCC TAATACGA;

[0106] the sequence shown as SEQ ID NO. 15:

[0107] GTATGTGGGAGCCCACACTCTACTCGACAGATACGAATATCTGGACCCGACCGTCTCCCACATACCCC TATAGTGAGTCGTATTATGTGGTGTGTGAGTGCGGTGCCC GTATGTGGGAGCCCACACTCTACTCGACAGATACGAATATCTGGACCCGACCGTCTCCCACATACCCC TATAGTGAGTCGTATTATGTGGTGTGTGAGTGCGGTGCCC TAATACGAC;

[0108] the sequence shown as SEQ ID NO. 16:

[0109] GTATGTGGGAGCCCACACTCTACTCGACAGATACGAATATCTGGACCCGACCGTCTCCCACATACCCC TATAGTGAGTCGTATTATGTGGTGTGTGAGTGCGGTGCCC GTATGTGGGAGCCCACACTCTACTCGACAGATACGAATATCTGGACCCGACCGTCTCCCACATACCCC TATAGTGAGTCGTATTATGTGGTGTGTGAGTGCGGTGCCC TAATACGACT;

[0110] the sequence shown as SEQ ID NO. 17:

[0111] Figure 2 GTATGTGGGAGCCCACACTCTACTCGACAGATACGAATATCTGGACCCGACCGTCTCCCACATACCCC TATAGTGAGTCGTATTATGTGGTGTGTGAGTGCGGTGCCC TAATACGACTC.

[0112] Note: " " in the sequences shown as SEQ ID NO. 12-SEQ ID NO. 17 represents the template sequence of Broccoli aptamer; " " represents the T7 promoter sequence; " " represents the DNA aptamer of Tyr; and the unlined represents Locker sequence.

[0113] The 5' end and 3' end bases of the aptamer of Tyr are not complementary pairing, so as shown in the following: Figure 3 ​​​As shown, the 5' end to the 3' end of the aptamer sensor is the Broccoli aptamer template chain, T7 promoter, aptamer and Locker, respectively. When Tyr is present, the stem-loop structure of the original aptamer sensor is broken, affecting normal polymerization and extension, and cannot form a complete double-stranded structure, making it a closed state. The T7 RNA polymerase fails to recognize the complete T7 promoter, and transcription cannot start, affecting the generation of Broccoli aptamer. After adding DFHBI 1T dye, the corresponding fluorescence signal attenuates. In the final signal output, the optimal excitation wavelength and the optimal emission wavelength of the RNA-dye are set to 472 nm and 505 nm, respectively, and the difference in fluorescence intensity between the presence of Tyr and the absence of Tyr is used as the standard for evaluating the response effect of the detection platform. Among them, the length of the Locker and the concentration of the aptamer sensor will affect the affinity of the aptamer sensor and Tyr, and the type of DNA polymerase will affect the polymerization effect, and finally all three will affect the signal response effect. In some embodiments, the concentration of the second aptamer sensor used is 5 nM to 250 nM; preferably, the concentration of the second aptamer sensor used is 100 nM.

[0114] In some embodiments, the universal aptamer sensor detection platform further comprises a signal output module, wherein the signal output module comprises a luminescent dye, and the luminescent dye is used to combine with the aptamer sensor module to generate a luminescent signal.

[0115] Optionally, the luminescent dye corresponding to the first aptamer sensor comprises Malachite Green (MG). The luminescent dye corresponding to the second aptamer sensor comprises DFHBI-1T dye. It should be noted that the corresponding luminescent dye can be selected according to the signal output sequence corresponding to each aptamer sensor.

[0116] On the basis of successfully constructing the 'turn-on' mode and the 'turn-off' mode, when the detection target is to realize a portable POCT, the downstream pathway needs to be changed, and a split CRISPR / Cas12a system is used to output signals by means of a test strip.

[0117] Therefore, in some embodiments, the template sequence of the Broccoli aptamer is as shown in SEQ ID NO. 18.

[0118] Further, the sequence of the second aptamer sensor comprises a sequence as shown in SEQ ID NO. 19.

[0119] Specifically:

[0120] The sequence as shown in SEQ ID NO. 18 is GTGCTGCCATATCTACTTCA.

[0121] the sequence shown as SEQ ID NO. 19:

[0122] Figure 3 TAATACGACT.

[0123] indicates the template sequence of Broccoli aptamer; " indicates the T7 promoter sequence; " indicates the DNA aptamer of Tyr; and the unlined indicates the Locker sequence. As shown in FIG. 1 (schematic diagram of the 'turn off' mode detection principle), when the target substance exists, the sensor structure changes, breaks the original stem-loop structure, hinders the normal polymerization and extension of DNA, and makes the DNA unable to extend the complete T7 promoter sequence, so that the sensor becomes the off state. After adding T7 RNA polymerase, the corresponding spacer RNA cannot be generated, so that the transcleavage activity of Cas12a is not activated, and the FAM-ssDNA-biotin probe in the surrounding environment exists stably, so that the goat anti-FAM labeled gold nanoparticles (AuNPs) are successfully captured on the T line of the test strip.

[0124] As shown in FIG. 1 (schematic diagram of the 'turn off' mode detection principle), when the target substance exists, the sensor structure changes, breaks the original stem-loop structure, hinders the normal polymerization and extension of DNA, and makes the DNA unable to extend the complete T7 promoter sequence, so that the sensor becomes the off state. After adding T7 RNA polymerase, the corresponding spacer RNA cannot be generated, so that the transcleavage activity of Cas12a is not activated, and the FAM-ssDNA-biotin probe in the surrounding environment exists stably, so that the goat anti-FAM labeled gold nanoparticles (AuNPs) are successfully captured on the T line of the test strip. Figures 4-6 Figure 4 As shown in FIG. 1 (schematic diagram of the 'turn off' mode detection principle), when the target substance exists, the sensor structure changes, breaks the original stem-loop structure, hinders the normal polymerization and extension of DNA, and makes the DNA unable to extend the complete T7 promoter sequence, so that the sensor becomes the off state. After adding T7 RNA polymerase, the corresponding spacer RNA cannot be generated, so that the transcleavage activity of Cas12a is not activated, and the FAM-ssDNA-biotin probe in the surrounding environment exists stably, so that the goat anti-FAM labeled gold nanoparticles (AuNPs) are successfully captured on the T line of the test strip.

[0125] As shown in FIG. 1 (schematic diagram of the 'turn off' mode detection principle), when the target substance exists, the sensor structure changes, breaks the original stem-loop structure, hinders the normal polymerization and extension of DNA, and makes the DNA unable to extend the complete T7 promoter sequence, so that the sensor becomes the off state. After adding T7 RNA polymerase, the corresponding spacer RNA cannot be generated, so that the transcleavage activity of Cas12a is not activated, and the FAM-ssDNA-biotin probe in the surrounding environment exists stably, so that the goat anti-FAM labeled gold nanoparticles (AuNPs) are successfully captured on the T line of the test strip.

[0126] As shown in FIG. 1 (schematic diagram of the 'turn off' mode detection principle), when the target substance exists, the sensor structure changes, breaks the original stem-loop structure, hinders the normal polymerization and extension of DNA, and makes the DNA unable to extend the complete T7 promoter sequence, so that the sensor becomes the off state. After adding T7 RNA polymerase, the corresponding spacer RNA cannot be generated, so that the transcleavage activity of Cas12a is not activated, and the FAM-ssDNA-biotin probe in the surrounding environment exists stably, so that the goat anti-FAM labeled gold nanoparticles (AuNPs) are successfully captured on the T line of the test strip.

[0127] ​​​In the portable 'turn off' mode, the universal aptamer sensor detection platform further comprises a signal output module, which comprises at least one of a fluorescent signal reporter probe and a visual signal reporter probe, and a Cas enzyme, a scaffold RNA and a dsDNA.

[0128] Further, the fluorescent group of the fluorescent signal reporter probe is FAM, and the quenching group is BHQ1; the 5' end of the visual signal reporter probe is connected with FAM, and the 3' end is connected with biotin; the Cas enzyme is Cas12a enzyme; the sequence of the scaffold RNA is shown as SEQ ID NO. 20; and the sequence of the dsDNA is shown as SEQ ID NO. 21-SEQ ID NO. 22.

[0129] Specifically,

[0130] the sequence shown as SEQ ID NO. 20: AAUUUCUACUAAGUGUAGAU;

[0131] the sequence shown as SEQ ID NO. 21:

[0132] GTGGAATTCTGCAGATTTCTGAAGTAGATATGGCAGCACTCGAGTCTAGAGGGCCCGTT;

[0133] the sequence shown as SEQ ID NO. 22:

[0134] AACGGGCCCTCTAGACTCGAGTGCTGCCATATCTACTTCAGAAATCTGCAGAATTCCAC.

[0135] In some embodiments, the polymerization reaction unit comprises a DNA polymerase, and the DNA polymerase comprises phi29 DNA polymerase. It should be noted that the DNA polymerase is not limited to comprising phi29 DNA polymerase, and can also be Taq DNA polymerase, Bst 3.0 DNA polymerase, DNA I polymerase, T4 DNA polymerase.

[0136] In some embodiments, the transcription reaction unit comprises T7 RNA polymerase.

[0137] The universal aptamer sensor detection platform of the present application can be applied to detect target substances or prepare reagents or devices for detecting target substances. The target substance is a small molecule substance. Alternatively, the small molecule substance is phenylalanine (Phe) and / or tyrosine (Tyr). It should be noted that the target substance is not limited to the above-mentioned substances, and a corresponding aptamer sensor can be designed according to the principle of the present application according to other small molecule substances.

[0138] The universal aptamer sensor detection platform of the present application is used for rapid reporting of small molecule concentration. The universal aptamer sensor proves the ability to detect multiple target molecules only by aptamer sequence by promoting or breaking the formation of stem-loop structure of the aptamer sensor after binding with small molecules. Moreover, this platform has high sensitivity (the detection limit of 'turn on' mode is 51.60 nM, and the detection limit of 'turn off' mode is 7.664 μM) and high specificity. In addition, at the sensitivity of sub-nanomolar level, the response time can be shortened to 40 minutes, fully proving the instant detection ability of this platform. In addition, by coupling the downstream pathway with the small molecule controlled polymerization-transcription process, the universal aptamer sensor detection platform can be designed as a biosensor with universality, programmability and portability.

[0139] The universal aptamer sensor detection platform can universally detect any target with known DNA aptamer sequence by using the absence and supplement of functional modules. Moreover, it is a simple and inexpensive detection method, which has potential application value in life science research.

[0140] The following is the specific embodiment part.

[0141] In the examples, reagents and instruments are used as commonly selected in the art unless otherwise specified. The experimental methods not specified in the examples are usually carried out according to conventional conditions, such as the conditions described in the literature, books or the methods recommended by the reagent kit manufacturers. The reagents used in the examples are commercially available.

[0142] Unless otherwise specified, the materials and instruments in the following examples are as follows:

[0143] 1. Experimental materials

[0144] All reagents used in the present application are purchased from commercial suppliers without further purification, as shown in Table 1. The oligonucleotide sequences, double-stranded DNA sequences and probes used are ordered from Shenguo Bioengineering Co., Ltd. (Shanghai) and Beijing Qianke Biological Technology Co., Ltd., as shown in Table 1. Other experimental consumables are shown in Table 2. Figure 5 Figure 6 ​Nucleic acid sequences associated with the 'turn on' detection platform, where red indicates the template sequence for the MG aptamer; blue indicates the T7 promoter sequence; black indicates the DNA aptamer for Phe; and purple indicates the Assistor sequence. Figure 1 Nucleic acid sequences associated with the 'turn off' detection platform, where green indicates the template sequence for the Broccoli aptamer; blue indicates the T7 promoter; black indicates the DNA aptamer for Tyr; and gold indicates the Locker sequence. Figure 1 Nucleic acid sequences associated with the portable aptamer sensor detection platform, where green indicates the template sequence for the Broccoli aptamer; blue indicates the T7 promoter; black indicates the DNA aptamer for Tyr; and gold indicates the Locker sequence.

[0145] Table 1. Reagents used in the experiments

[0146]

[0147] Table 2. Consumables used in the experiments

[0148]

[0149] 2. Experimental equipment

[0150] All equipment used in this study is shown in Table 3.

[0151] Table 3. Equipment used in the experiments

[0152]

[0153] Example 1: Construction of the 'turn-on' mode

[0154] First, the designed aptamer sensor was dissolved in PBS. Then, Phe was added to the aptamer sensor solution for target recognition at 37 °C for 1 h. After that, 10 μL of the solution containing the aptamer sensor and Phe was mixed with the polymerization buffer to 50 μL. The polymerization buffer was composed of 5 μL of 10x reaction buffer, 1.5 μL of Recombinant Albumin (20 mg / mL), 0.4 μL of ETS SB (500 μg / mL), 2 μL of dNTPs (10 mM each), 2 μL of phi29 DNA polymerase (10 U) and DEPC water. The mixture was incubated at 30 °C for 1 h for DNA polymerization, extension and formation of the complete double-stranded structure. 5 μL of the polymerized solution was mixed with the following reagents: 1.5 μL of DEPC water, 1 μL of dithiothreitol (DTT, 100 mM), 0.5 μL of recombinant RNase inhibitor (20 U), 10 μL of rNTPs (100 mM each), 2 μL of T7 RNA polymerase to form a 20 μL reaction system. It was incubated at 37 °C for 2 h for transcription. After transcription, 1 μM MG was incubated at 25 °C for 30 min in 40 mM HEPES (pH 7.4), 100 mM KCl and 1 mM MgCl2buffer, and immediately measured for fluorescence emission using an H-7100 fluorescence spectrophotometer. For the complex of MG aptamer and dye binding, the excitation wavelength was set to 616 nm and the emission spectrum was collected in the range of 635-750 nm when measuring fluorescence. Using the optimized system, the concentrations of Phe were set to 0.008, 0.08, 0.8, 8, 20, 40, 80 and 160 μM to establish the standard curve. In addition, the specificity of the 'turn-on' mode was also explored. Using the optimized system and the above experimental protocol, the concentration of Phe was set to 8 μM and the concentrations of PCPA, Tyr and Try were kept at 80 μM to perform the specificity exploration experiment.

[0155] Example 2: Time optimization experiment of 'turn-on' mode

[0156] The optimization time experiment of the 'turn-on' mode used a similar experimental procedure. According to the order of the effect on the detection effect from weak to strong, each part of the time was optimized in turn. First, using 50 nM, Assistor length of 1 nt, and other parameters being the same as before, after adding T7 RNA polymerase, the transcription time was optimized by incubating at 37°C for 10 min, 30 min, 60 min and 90 min, respectively. Subsequently, using the same system with a transcription time of 10 min, after adding phi29 DNA polymerase, the polymerization time was optimized by incubating the polymerization reaction solution at 30°C for 5 min, 10 min, 20 min, 30 min, 40 min and 60 min, respectively. Then, using the system with a transcription time of 10 min and a polymerization time of 10 min, after adding the dye MG, the RNA binding dye time was optimized by incubating at 25°C for 5 min, 10 min, 15 min, 20 min and 30 min, respectively. Finally, using the above-mentioned system with a transcription time of 10 min, a polymerization time of 10 min and a dye binding time of 10 min, after adding Phe, the target recognition time was optimized by incubating at 37°C for 10 min, 20 min, 30 min, 40 min, 50 min and 60 min, respectively. Finally, using the optimized system, the concentration of Phe was set to 0.008, 0.08, 0.8, 8, 20, 40, 80 and 160 μM. The standard curve was established, and the detection limit was calculated.

[0157] Example 3: Construction of the 'turn-off' mode

[0158] First, the designed aptamer sensor was dissolved in PBS. For the 'turn-off' mode, the aptamer sensor was pre-treated by annealing at 95 °C for 10 min and then gradually cooled to 20 °C at a rate of 1 °C / min to form a sensor with a stem-loop structure. Subsequently, the target substance Tyr was added to the aptamer sensor solution, and target recognition was performed by incubating at 37 °C for 1 h. Then, the target-recognized solution was mixed with a polymerization buffer to 50 μL. The polymerization buffer included 5 μL of 10x reaction buffer, 1.5 μL of 20 mg / mL recombinant albumin, 0.4 μL of 500 μg / mL ETS SB, 2 μL of 10 mM dNTPs, 10 U of phi29 DNA polymerase, and DEPC water. After mixing the above mixture uniformly, DNA polymerization and extension were performed by incubating at 30 °C for 1 h to form a complete double-stranded structure. After mixing 5 μL of the polymerized solution with 1.5 μL of DEPC water, 1 μL of 100 mM DTT, 20 U of recombinant RNAase inhibitor, 10 μL of 100 mM rNTPs, and 2 μL of T7 RNA polymerase uniformly, transcription was performed by incubating at 37 °C for 2 h. After the transcription, the solution was incubated with 1 μM DFHBI-1T in 40 mM HEPES (pH 7.4), 100 mM KCl, and 1 mM MgCl2buffer at 25 °C for 30 min. Finally, the fluorescence emission was immediately measured using an H-7100 fluorescence spectrophotometer. For the Broccoli aptamer and dye-bound complex, the fluorescence was tested by setting the excitation wavelength to 472 nm and collecting the emission spectrum in the range of 490-600 nm. Using the optimized system, the concentration of Tyr was set to 0.008, 0.08, 0.8, 8, 20, 40, 80, and 160 μM to establish a standard curve. In addition, the specificity of the 'turn-off' mode was also explored. Using the optimized system and the above experimental protocol, the concentration of Tyr was set to 20 μM, and the concentration of Try, PCPA, and Phe was set to 200 μM for the specificity exploration experiment.

[0159] Example 4: Construction of a portable 'turn-off' mode

[0160] The designed aptamer sensor (80 nM) was dissolved in PBS, then pretreated, annealed at an initial denaturation temperature of 95 °C for 10 min, and gradually cooled to 20 °C at a rate of 1 °C / min, finally forming an aptamer sensor with a stem-loop structure. Then, the target substance Tyr was added to the aptamer sensor solution, and incubated at 37 °C for 1 h for target recognition. Subsequently, 10 μL of the target-recognized solution was mixed with 40 μL of polymerization buffer: 5 μL of 10x reaction buffer, 1.5 μL of 20 mg / mL recombinant albumin, 0.4 μL of 500 μg / mL ETS SB, 2 μL of 10 mM dNTPs, 10 U of phi29 DNA polymerase, and DEPC water. After mixing evenly, the mixture was incubated at 30 °C for 1 h for DNA polymerization and extension, finally forming a complete double-stranded structure. Then, 5 μL of the polymerized solution was mixed with the following reagents: 1.5 μL of DEPC water, 1 μL of 100 mM DTT, 20 μ U of recombinant RNAase inhibitor, 10 μL of 100 mM rNTPs, and 2 μL of T7 RNA polymerase. After mixing evenly, the mixture was incubated at 37 °C for 2 h for transcription. 10 μL of the transcribed solution was mixed with the CRISPR / Cas12a reaction solution, and then incubated at 37 °C for 1 h for CRISPR reaction. The final reaction system was 100 μL, including 10 μL of 10x NEB buffer 2.1, 250 nM of Lba Cas12a enzyme, 500 nM of scaffold RNA, 500 nM of dsDNA, and 40 nM of FAM-ssDNA-BHQ1 probe. During the reaction, the FQD-96A real-time fluorescence PCR system was used, and the real-time fluorescence data was collected every 10 s for 1 h. Among them, the only difference when screening the optimal concentration of the aptamer sensor was that no target substance Tyr was added. Finally, the optimized system and the above experimental scheme were used to conduct exploration experiments with Tyr concentrations of 5, 20, 30, 80, 120, 160, and 200 μM.

[0161] Example 5: Lateral flow assay (LFA) experiment

[0162] The designed aptamer sensor (1.2 μM) was dissolved in PBS, and pretreatment was first performed: annealing for 10 min at an initial denaturation temperature of 95℃, and gradually cooling to 20℃ at a rate of 1℃ / min, finally forming an aptamer sensor with a stem-loop structure. Using the detection system after optimization time, target recognition, polymerization and transcription all require 10 min. Subsequently, Cas12a (250 nM), dsDNA (500 nM), scaffold RNA (500 nM) and FAM-ssDNA-biotin probe (10 nM) were mixed with 10 μL of the post-transcription solution to form a 100 μL system, which was reacted at 37℃ for 30 min. The resulting solution was added dropwise to the test strip, and the gray value was read after 15 min using Adobe Photoshop CC (2018).

[0163] Experimental results and analysis

[0164] All experimental data were analyzed and plotted using Origin (2021) and GraphPad Prism (8), where the gray value of the LFA was read using Adobe Photoshop CC (2018), and the final data graph was integrated using Adobe Illustrator (2022). Statistical significance was analyzed using GraphPad Prism (9.5) for single-factor analysis of variance (One-Way ANOVA) and multiple comparisons. Data were calculated as the mean ± standard deviation of three replicates, and P < 0.05 was considered statistically significant.

[0165] 1. The detection results of the ‘turn-on’ mode (i.e. Example 1 and Example 2) are as follows:

[0166] Construction of the ‘turn-on’ mode

[0167] As Figure 7As shown, the 'turn-on' mode consists of five parts: aptamer sensor construction, target recognition, DNA polymerization, transcription, and downstream pathway signal output. The 'turn-on' mode is selected when the 5' and 3' ends of the target aptamer are complementary. The aptamer sensor consists of four parts: the signal output (RNA aptamer template strand) at the 5' to 3' ends, the T7 promoter, the target aptamer, and the assistor. When the aptamer binds to the target, the assistor at the 3' end of the aptamer sensor promotes complementary base pairing between the 5' and 3' ends. Therefore, in the presence of the target, the aptamer sensor structure changes, forming a stem-loop structure. Under the action of phi29 DNA polymerase, it polymerizes and extends normally, forming a complete double-stranded sequence, thus turning the aptamer sensor on. Therefore, the T7 RNA polymerase recognizes the complete T7 promoter, initiating transcription and generating the RNA aptamer. This RNA aptamer can specifically bind to the corresponding dye. The resulting complex, when excited, emits fluorescence, which is then detected by the instrument and output as a signal. However, when the target substance is absent, the aptamer sensor remains in its initial state, thus failing to polymerize and transcribe normally. This ultimately affects the generation of the corresponding RNA aptamer, causing the corresponding fluorescence signal to decay.

[0168] Filtering the optimal conditions for the 'turn-on' mode

[0169] The aptamer of Phe has complementary base pairing at the 5' and 3' ends, therefore, as Figure 7 As shown, the aptamer sensor consists of the MG aptamer template strand, T7 promoter, Phe aptamer, and assistor, located from the 5' to 3' ends, respectively. In the presence of Phe, the aptamer sensor structure changes, forming a stem-loop structure. Under the action of phi29 DNA polymerase, it polymerizes and extends normally, forming a complete double-stranded structure, thus activating the aptamer. After recognizing the complete T7 promoter, T7 RNA polymerase initiates transcription, generating the corresponding MG aptamer. This aptamer binds to malachite green (MG) dye, forming a complex that emits fluorescence upon excitation, which is then detected by the instrument. For the final signal output, the optimal excitation and emission wavelengths for RNA-dye were set to 616 nm and 655 nm, respectively. The difference in fluorescence intensity between the presence and absence of Phe was used as the standard for evaluating the response of the detection platform. The length of the assistor and the concentration of the aptamer sensor affect the affinity for Phe binding, while the type of DNA polymerase affects the polymerization effect. Ultimately, all three factors influence the platform's response; therefore, it is necessary to screen for these influencing factors first. The results of filtering the optimal conditions for the 'turn-on' mode are shown in the figure below. Figure 7 As shown. Figure 7The results of screening the best conditions of the 'turn-on' mode are shown in the graphs, wherein (A) the fluorescence intensity and platform response effect of the aptamer sensor with different Assistor lengths (0, 1, 2, 3, 4, 5 nt) in the absence and presence of Phe (40 μM); (B) the fluorescence intensity and platform response effect of the aptamer sensor with different concentrations (5, 10, 25, 50, 100, 250 nM) in the absence and presence of Phe (40 μM).

[0170] As shown in (A) of FIG. 1, Figure 8 As shown in (A) of FIG. 1, Figure 8 As shown in (B) of FIG. 1,

[0171] Next, as shown in (A) of FIG. 2, Figure 9 Figure 9 As shown in (A) of FIG. 2,

[0172] Performance analysis of the 'turn-on' mode

[0173] The linear analysis and the detection results of the sensitivity are shown in (A) of FIG. 3. Figure 9 Figure 9 ​​The following are the response results of the 'turn-on' mode to different concentrations of Phe: (A) Fluorescence spectrum response of the 'turn-on' mode to different concentrations of Phe; (B) Fluorescence intensity difference result of the 'turn-on' mode response to different concentrations of Phe; (C) Linear relationship between ΔF and the logarithm of Phe concentration.

[0174] like Figure 10 As shown in (A) and (B), the fluorescence intensity gradually increases with increasing Phe concentration in the range of 0-160 μM. Figure 10 As shown in (C), within the Phe concentration range of 8 nM to 160 μM, the fluorescence intensity difference increases with increasing Phe concentration, exhibiting a regular increasing trend. Furthermore, a linear relationship is established between the logarithm of Phe concentration and the fluorescence intensity difference: Y = 160.2 * X + 124.0. R 2 = 0.9485, indicating good linearity. Furthermore, based on this linear relationship, the detection limit for the 'turn-on' mode was calculated to be 145.6 nM, indicating good sensitivity. Therefore, the 'turn-on' mode can achieve quantitative analysis of target substances at the nM level.

[0175] The results of selective and specific detection are as follows: Figure 10 As shown. Figure 11 The graph shows the fluorescence response of the 'turn-on' mode to the nonspecific target (80 μM) and Phe (8 μM). Note: "ns" indicates no significance, and **** indicates P value < 0.0001.

[0176] Building upon this, the specificities of the 'turn-on' mode were also explored, such as... Figure 11 As shown, 8 μM of Phe and 80 μM of structurally similar substances—tryptophan (Try), tyrosine (Tyr), and p-chlorophenylalanine (PCPA)—were added to this detection platform. The results showed that the platform only exhibited a response signal in the presence of phenylalanine. Therefore, the 'turn-on' mode demonstrates good selectivity and specificity.

[0177] Quickly build 'turn-on' patterns

[0178] The previously built 'turn-on' mode had a response time of 4.5 hours. Therefore, to achieve point-of-care testing (POCT), further optimization of the response time is needed. The time for each component was optimized progressively, from weakest to strongest, according to their impact on detection performance. The optimization results are as follows: Figure 11 As shown. Figure 11To optimize the detection results of the response time of the 'turn-on' mode step by step: (A) optimize the target substance recognition time of the 'turn-on' mode; (B) optimize the polymerization time of the 'turn-on' mode; (C) optimize the transcription time of the 'turn-on' mode; (D) optimize the RNA aptamer binding time of the 'turn-on' mode.

[0179] As shown in (C) of Figure 11 , the transcription time was first optimized. 50 nM, Assistor length 1 nt, and the same system parameters as before were used. After adding T7 RNA polymerase, incubate at 37°C for 10 min, 30 min, 60 min, and 90 min, respectively. The results show that under different transcription times, the response effect of the platform is quite the same, so the transcription time can be shortened to 10 min. Subsequently, as shown in (B) of Figure 11 , under the condition of 10 min transcription time, the same system was used to optimize the polymerization time. After adding phi29 DNA polymerase, incubate at 30°C for 5 min, 10 min, 20 min, 30 min, 40 min, and 60 min, respectively. The results show that under different polymerization times, the response effect of the platform is quite the same. Therefore, the polymerization time can be shortened from 1 h to 10 min. Then, as shown in (D) of Figure 12 , under the condition of 10 min transcription time and 10 min polymerization time, the same system was used to optimize the RNA aptamer binding time. After adding dye MG, incubate at 25°C for 5 min, 10 min, 15 min, 20 min, and 30 min, respectively. According to the results, the RNA aptamer binding time can be shortened from 30 min to 10 min. Finally, according to the above results, as shown in (A) of Figure 12 , the same system was used to incubate at 37°C for 10 min, 20 min, 30 min, 40 min, 50 min, and 60 min, respectively, after adding Phe. The results show that the target substance recognition time can be shortened to 10 min. Finally, the entire response time is shortened from 4.5 h to 40 min.

[0180] Performance analysis of fast 'turn-on' mode

[0181] The results of linear analysis and its sensitivity are shown in Figure 12 Figure 12 ​Response effect diagram of fast 'turn-on' mode to different concentrations of Phe: (A) fluorescence spectrum response diagram of fast 'turn-on' mode to different concentrations of Phe; (B) fluorescence intensity difference result diagram of fast 'turn-on' mode to different concentrations of Phe; (C) linear relationship diagram between ΔF and Phe concentration logarithmic value.

[0182] As shown in Figure 12 , the performance of fast 'turn-on' mode with a response time of 40 min was analyzed. As shown in Figure 12 (A), with the increase of Phe concentration from 0 to 160 μM, the corresponding fluorescence intensity gradually increased. As shown in Figure 2 (B), in the range of 8 nM to 160 μM of Phe, the fluorescence intensity difference gradually increased, showing a regular increasing trend. At the same time, as shown in Figure 2 (C), a linear relationship between Phe concentration logarithmic value and fluorescence intensity difference was established: Y = 49.47*X + 27.16, R 2 =0.9756, showing a good linear relationship. And according to this linear relationship, the detection limit of fast 'turn-on' mode was calculated as 51.60 nM, showing good sensitivity. Therefore, fast 'turn-on' mode can realize quantitative analysis of nM level target substances.

[0183] 2, the detection results of 'turn-off' mode (i.e. Example 3) are as follows:

[0184] Construction of 'turn-off' mode

[0185] As shown in Figure 13As shown, the 'turn-off' mode consists of five parts: aptamer sensor construction, target recognition, DNA polymerization, transcription, and downstream pathway signal output. The 'turn-off' mode is selected when the 5' and 3' ends of the target aptamer are not complementary. The aptamer sensor itself consists of four parts: signal output, the T7 promoter, the aptamer, and the locker, located at the 5' to 3' ends, respectively. The 3' locker ensures the sensor already possesses a stem-loop structure in its initial state. The presence of the target material alters the sensor structure, breaking the original stem-loop structure and hindering normal DNA polymerization and elongation. This prevents the DNA from extending into the complete T7 promoter sequence, turning the sensor off and affecting the generation of the corresponding RNA aptamer, thus impacting the formation of the RNA-dye complex and ultimately causing the corresponding fluorescence signal to decay. In the absence of the target material, the sensor's stem-loop structure remains stable, allowing normal polymerization and elongation under the action of phi29 DNA polymerase, forming a complete double-stranded sequence. T7 RNA polymerase recognizes the T7 promoter, initiates transcription, generates RNA aptamers, which bind to a dye, and the resulting complex is excited, emitting fluorescence and thus outputting a signal. Therefore, the presence or absence of the target substance results in different output signals, ultimately achieving the platform's response.

[0186] Filtering the optimal conditions for 'turn-off' mode

[0187] The aptamer of Tyr has unpaired 5' and 3' bases, therefore... Figure 13 As shown, the aptamer sensor consists of a Broccoli aptamer template strand, a T7 promoter, an aptamer, and a Locker, located from the 5' to the 3' end. In the presence of Tyr, the stem-loop structure of the aptamer sensor is broken, affecting normal polymerization and elongation, preventing the formation of a complete double-stranded structure and rendering it in a closed state. T7 RNA polymerase fails to recognize the complete T7 promoter, transcription cannot begin, affecting Broccoli aptamer generation, and the corresponding fluorescence signal decays upon the addition of DFHBI 1T dye. For the final signal output, the optimal excitation and emission wavelengths for RNA-dye were set to 472 nm and 505 nm, respectively, with the fluorescence intensity difference between the presence and absence of Tyr used as the standard for evaluating the detection platform's response. The Locker length and aptamer sensor concentration affect the affinity between the aptamer sensor and Tyr, while the type of DNA polymerase affects the polymerization effect. Ultimately, all three factors influence the signal response; therefore, screening of influencing factors is necessary. The detection results are as follows: Figure 13 As shown. Figure 13The results of screening the best conditions of 'turn-off' mode: (A) The fluorescence intensity and platform response effect of aptamer sensor with different Locker length (6, 7, 8, 9, 10, 11 nt) in the absence and presence of Tyr (40 μM); (B) The fluorescence intensity and platform response effect of aptamer sensor with different concentration (5, 10, 25, 50, 100, 250 nM) in the absence and presence of Tyr (40 μM).

[0188] As shown in (A) of Figure 14 , the stem-loop structure of aptamer sensor is broken in the presence of Tyr, affecting the subsequent polymerization and transcription, and thus affecting the formation of RNA-dye complex, so its fluorescence intensity is lower than that in the absence of Tyr. At the same time, with the increase of Locker length, the platform response effect decreases, because with the increase of Locker length, the stem-loop structure of aptamer sensor will be more and more stable and more and more difficult to be broken. Therefore, the best response effect of 10 nt is finally selected for subsequent exploration. Then, as shown in (B) of Figure 14 , the best concentration of aptamer sensor with Locker length of 10 nt is screened, and the results show that the platform response reaches the best effect when 100 nM is used.

[0189] Further, as shown in Figure 15 ( Figure 15 , the best DNA polymerase is screened using 100 nM aptamer sensor with Locker length of 10 nt, and the platform response reaches the best effect when phi29 DNA polymerase is used. Therefore, 100 nM aptamer sensor with Locker length of 10 nt and phi29 DNA polymerase are used for subsequent exploration experiments.

[0190] Performance analysis of 'turn-off' mode

[0191] The results of linear analysis and sensitivity detection are shown in Figure 15 . Figure 15 The response effect of 'turn-off' mode to different concentrations of Tyr: (A) The fluorescence spectrum response diagram of 'turn-off' mode to different concentrations of Tyr; (B) The fluorescence intensity difference result diagram of 'turn-off' mode response to different concentrations of Tyr; (C) The linear relationship diagram between ΔF and Tyr concentration.

[0192] As shown in Figure 16 .As shown in (A) of FIG. 1, with the increase of Tyr concentration, the stem-loop structure of aptamer sensor is broken, which affects the subsequent polymerization and transcription, and further affects the generation of RNA-dye complex, and the corresponding fluorescence intensity decreases. As shown in (B) of FIG. 1, within the range of 80 nM to 160 μM of Tyr, the fluorescence intensity difference gradually increases, showing a regular increasing trend, and a linear relationship between Tyr concentration and fluorescence intensity difference is established: Y = 39.58*X + 1586, Figure 16 As shown in (B) of FIG. 1, within the range of 80 nM to 160 μM of Tyr, the fluorescence intensity difference gradually increases, showing a regular increasing trend, and a linear relationship between Tyr concentration and fluorescence intensity difference is established: Y = 39.58*X + 1586, R 2 = 0.9023, showing good linearity. And according to this linear relationship, the detection limit of 'turn-off' mode is calculated as 7.664 μM, showing good sensitivity. Therefore, 'turn-off' mode can realize quantitative analysis of target substances at μM level.

[0193] The detection results of selectivity and specificity are shown in FIG. 2. Figure 16 . Figure 3 FIG. 2 is a fluorescence response result graph of 'turn off' mode to non-specific target (200 μM) and Tyr (20 μM). Note that "ns" means no statistical significance, and ** means P value < 0.01.

[0194] Further, 100 nM aptamer sensor with Locker length of 10 nt is used to explore the specificity of the detection platform, as shown in FIG. 3. Figure 17 As shown in FIG. 3, 20 μM of Tyr and 200 μM of structural analogs: Phe, Try and PCPA are respectively added to the platform, and the results show that this mode only responds when Tyr is present. Therefore, the selectivity and specificity of 'turn-off' mode are good.

[0195] 3, the detection results of portable 'turn off' mode (i.e. embodiment 4) are as follows:

[0196] Construction of portable 'turn off' mode

[0197] On the basis of successfully constructing 'turn-on' mode and 'turn-off' mode, when the detection target is to realize portable POCT, the downstream pathway needs to be changed, and the split CRISPR / Cas12a system is used to output the signal with the help of test strip. As shown in FIG. 4, Figure 17As shown, in the presence of the target substance, the sensor structure changes, breaking the original stem-loop structure and hindering the normal polymerization and extension of DNA. This prevents the DNA from extending to the complete T7 promoter sequence, and the sensor becomes closed. After the addition of T7 RNA polymerase, the corresponding spacer RNA cannot be generated, thus the trans-cleavage activity of Cas12a is not activated. The FAM-ssDNA-biotin probe in the surrounding environment remains stable, allowing goat anti-FAM labeled gold nanoparticles (AuNPs) to be successfully captured on the T line of the test strip. In the absence of the target substance, the sensor polymerizes and extends normally under the action of phi29 DNA polymerase. The T7 RNA polymerase recognizes the complete T7 promoter and transcribes spacer RNA. This RNA can pair complementaryly with the bases of double-stranded DNA and, together with scaffold RNA, activate the trans-cleavage activity of Cas12a, cleaving the FAM-ssDNA-biotin probe in the surrounding environment, preventing the AuNPs from being successfully captured on the T line. Ultimately, the presence or absence of the target substance corresponds to a positive or negative result in the lateral chromatographic assay (LFA).

[0198] Filtering the optimal conditions for portable 'turn off' mode

[0199] Figure 18 This is a schematic diagram illustrating the principle of portable 'turn-off' mode fluorescence assay. Before performing LFA, fluorescence spectrophotometry is first required to confirm the ability of the portable 'turn-off' mode for qualitative analysis of the target substance. Figure 18 As shown, the sensor structure changes in the presence of the target substance, disrupting the original stem-loop structure and hindering normal DNA polymerization and extension. This prevents the DNA from extending into the complete T7 promoter sequence, rendering the sensor in a closed state. Upon addition of T7 RNA polymerase, the corresponding spacer RNA cannot be generated, thus the trans-cleavage activity of Cas12a is not activated. The FAM-ssDNA-BHQ1 probe in the surrounding environment remains stable and is in a quenched state, resulting in attenuation of the corresponding fluorescence signal. However, in the absence of the target substance, the sensor polymerizes and extends normally under the action of phi29 DNA polymerase. The T7 RNA polymerase recognizes the complete T7 promoter, transcribes spacer RNA, and this RNA can pair complementaryly with the bases of double-stranded DNA. Together with scaffold RNA, this activates the trans-cleavage activity of Cas12a, cleaving the FAM-ssDNA-BHQ1 probe in the surrounding environment, restoring the probe's fluorescence and producing the corresponding fluorescence signal. Therefore, the presence or absence of the target substance results in different output signals, ultimately leading to the platform's response.

[0200] However, since the split CRISPR / Cas12a system is used as a signal output, the sensitivity is higher than the previous 'turnoff' mode, so the previously screened aptamer sensor concentration does not respond well to this mode, and therefore a suitable aptamer sensor concentration needs to be re-screened. The results are shown in Figure 18 . Figure 19 The fluorescence intensity graph of different concentrations of aptamer sensors (0, 1, 2, 5, 10, 50, and 100 nM) in the absence of Tyr.

[0201] Screening of suitable aptamer sensor concentration in the absence of Tyr, when the concentration reaches a certain concentration, the corresponding fluorescence signal will appear, and when the concentration increases to a certain value, the corresponding fluorescence intensity will reach a saturated state, so too high and too low concentrations will limit the response effect of the platform, so the aptamer sensor concentration with a final fluorescence intensity of about 80% is selected as the best concentration for this mode. As shown in Figure 19 , using real-time fluorescence PCR system to output fluorescence signal, in the absence of Tyr, aptamer sensor normal polymerization and transcription, and then activate split CRISPR / Cas12a, transcleavage probe, thereby restoring fluorescence, gradually increasing the concentration of aptamer sensor from 0 to 100 nM, the corresponding fluorescence intensity gradually increases. The results show that at 10 nM, the corresponding fluorescence intensity has reached a saturated state. Therefore, select 2 nM with a fluorescence intensity of 80% as the best aptamer sensor concentration for further study. Therefore, using 2 nM, Locker length of 10 nt aptamer sensor for further in-depth study.

[0202] Detection performance of portable 'turn off' mode

[0203] The detection results are shown in Figure 19 . Figure 20 The response effect of portable 'turn off' mode to different concentrations of Tyr: (A) Real-time fluorescence response of portable 'turn off' mode to different concentrations of Tyr; (B) Response results of portable 'turn off' mode to different concentrations of Tyr when CRISPR reaction is performed for 10 min. Note: * indicates P value <0.05.

[0204] As shown in Figure 20As shown, gradually increasing the Tyr concentration within the 0-200 μM range disrupts the stem-loop structure of the aptamer sensor, affecting subsequent polymerization and transcription. This, in turn, affects the Cas12a trans-cleavage of the probe modified with the quencher group, resulting in a gradual decrease in fluorescence intensity. Fluorescence intensity values ​​at different Tyr concentrations (0, 5, 20, 30, 80, 120, 160, and 200 μM) were read after 10 min. The results show that the fluorescence intensity gradually decreases with increasing Tyr concentration. Therefore, qualitative detection of different Tyr concentrations can be achieved using fluorescence spectrophotometry after 10 min of CRISPR reaction. This also further confirms the capability of the portable 'turn-off' mode for qualitative analysis of target substances.

[0205] 4. The detection results of lateral chromatographic assay (LFA) (i.e., Example 5) are as follows:

[0206] Test results as follows Figure 20 As shown. Figure 20 The following are the LFA results for the portable 'turn-off' mode: (A) Schematic diagram of the response results of the portable 'turn-off' mode to different concentrations of Tyr; (B) Graph showing the grayscale ratio of the T line to the C line in LFA. Note: "NC" indicates negative control. * indicates P value < 0.05.

[0207] like ​ As shown in (A), lateral chromatographic assays (LFA) were performed using the constructed portable 'turn-on' mode. The results showed that the T-line of the test strip became increasingly darker with gradually increasing Tyr concentrations (0, 1, 5, 20, 40, 80, 160, and 320 μM). This is because the presence of Tyr disrupts the stem-loop structure of the aptamer sensor, thus affecting subsequent polymerization and transcription, the generation of spacer RNA, and consequently its complementary pairing with dsDNA bases. Ultimately, this affects the activation of Cas12a's trans-cleavage activity, allowing FAM-ssDNA-biotin to capture AuNPs on the T-line, thus revealing the T-line. ​ As shown in (B), the grayscale values ​​of the C and T lines of the test strip were further read using Adobe Photoshop CC (2018), and the detection effect was accurately evaluated using the T / C ratio. The results showed that the platform began to respond when the Tyr concentration was 1 μM, and the response effect increased with the increase of Tyr concentration. Therefore, the portable 'turn on' mode can realize the qualitative analysis of target substances and achieve its portability and visualization.

[0208] In summary, a universal aptamer sensor detection platform was successfully constructed for the rapid reporting of small molecule concentrations. The universal aptamer sensor demonstrated the ability to detect multiple target molecules with only the aptamer sequence by promoting or breaking the stem-loop structure formation of the aptamer sensor after small molecule binding. This platform also has high sensitivity (51.60 nM for the 'turn on' mode and 7.664 μM for the 'turn off' mode) and high specificity. In addition, the response time can be shortened to 40 minutes at sub-nanomolar sensitivity, fully demonstrating the real-time detection capability of this platform. In addition, by coupling the downstream pathway with the polymerization-transcription process controlled by small molecules, the universal aptamer sensor detection platform can be designed as a biosensor with universality, programmability, and portability.

[0209] The above-described embodiments only express several embodiments of the present application, and the description is more specific and detailed, but it should not be understood as a limitation on the scope of the patent. It should be noted that for ordinary skilled in the art, without departing from the concept of the present application, a number of modifications and improvements can be made, which are within the scope of the present application. Therefore, the scope of protection of the present application should be subject to the appended claims.

Claims

1. A universal aptamer sensor detection platform, characterized in that, The application relates to a universal aptamer sensor detection platform. The aptamer sensor module comprises at least one of a first aptamer sensor and a second aptamer sensor, the first aptamer sensor comprises, from a 5' end to a 3' end, a first signal output sequence, a first promoter sequence, a first target aptamer sequence and an Assistor sequence; the second aptamer sensor comprises, from a 5' end to a 3' end, a second signal output sequence, a second promoter sequence, a second target aptamer sequence and a Locker sequence; The reaction regulation module comprises a polymerization reaction unit and a transcription reaction unit. The first signal output sequence is composed of a template sequence of an MG aptamer, the first promoter sequence is composed of a T7 promoter sequence, the first target aptamer sequence is composed of a DNA aptamer sequence of phenylalanine, and the Assistor sequence is used for promoting 5' end and 3' end base complementary pairing of the template sequence of the MG aptamer; the second signal output sequence is composed of a template sequence of a Broccoli aptamer, the second promoter sequence is composed of a T7 promoter sequence, the second target aptamer sequence is composed of a DNA aptamer sequence of tyrosine, and the Locker sequence is used for forming a stem loop structure of the second aptamer sensor; the template sequence of the MG aptamer is shown as SEQ ID NO. 1, the T7 promoter sequence is shown as SEQ ID NO. 2, the DNA aptamer sequence of phenylalanine is shown as SEQ ID NO. 3, and the length of the Assistor sequence is 0 nt-5 nt; the sequence of the first aptamer sensor comprises any one of sequences shown as SEQ ID NO. 4-SEQ ID NO. 9; The template sequence of the Broccoli aptamer is shown as SEQ ID NO. 10, the DNA aptamer sequence of tyrosine is shown as SEQ ID NO. 11, and the length of the Locker sequence is 6 nt-11 nt; The sequence of the second aptamer sensor comprises any one of sequences shown as SEQ ID NO. 12-SEQ ID NO. 17; The template sequence of the Broccoli aptamer is shown as SEQ ID NO. 18; The sequence of the second aptamer sensor comprises a sequence shown as SEQ ID NO.

19.

2. The universal aptamer sensor detection platform of claim 1, wherein, The use concentration of the first aptamer sensor is 5 nM-250 nM.

3. The universal aptamer sensor detection platform of claim 2, wherein, The use concentration of the first aptamer sensor is 50 nM.

4. The universal aptamer sensor detection platform of claim 1, wherein, When the aptamer sensor module is the first aptamer sensor, the response time of phenylalanine detection by using the universal aptamer sensor detection platform is 40 min to 4.5 h.

5. The universal aptamer sensor detection platform of claim 4, wherein, When the aptamer sensor module is the first aptamer sensor, the response time of phenylalanine detection by using the universal aptamer sensor detection platform is 40 min.

6. The universal aptamer sensor detection platform of claim 1, wherein, The use concentration of the second aptamer sensor is 5 nM-250 nM.

7. The universal aptamer sensor detection platform of claim 6, wherein, The use concentration of the second aptamer sensor is 100 nM.

8. The universal aptamer sensor detection platform according to any one of claims 1-7, wherein, The signal output module further comprises a luminescent dye for generating a luminescent signal in combination with the aptamer sensor module.

9. The universal aptamer sensor detection platform of claim 1, wherein, The second aptamer sensor has a concentration of 1nM-100nM.

10. The universal aptamer sensor detection platform of claim 9, wherein, The second aptamer sensor has a concentration of 2nM.

11. The universal aptamer sensor detection platform of claim 1, wherein, The signal output module further comprises at least one of a fluorescent signal reporter probe and a visual signal reporter probe, and a Cas enzyme, a scaffold RNA and a dsDNA.

12. The universal aptamer sensor detection platform of claim 11, wherein, The fluorescent signal reporter probe has a fluorescent group of FAM and a quenching group of BHQ1; the visual signal reporter probe has FAM connected to the 5' end and biotin connected to the 3' end; the Cas enzyme is a Cas12a enzyme; the sequence of the scaffold RNA is shown as SEQ ID NO. 20; and the sequence of the dsDNA is shown as SEQ ID NO. 21-SEQ ID NO.

22.

13. The universal aptamer sensor detection platform according to any one of claims 1-7, 9-12, wherein, The polymerization reaction unit comprises a DNA polymerase, and the DNA polymerase is phi29 DNA polymerase. The transcription reaction unit comprises a T7 RNA polymerase.

14. Use of the universal aptamer sensor detection platform of any one of claims 1-13 in detecting a target substance or preparing a reagent or device for detecting a target substance.

15. An aptamer sensor, characterized in that, The aptamer sensor comprises at least one of a first aptamer sensor and a second aptamer sensor, the first aptamer sensor comprising, from 5' end to 3' end, a first signal output sequence, a first promoter sequence, a first target aptamer sequence and an Assistor sequence; and the second aptamer sensor comprising, from 5' end to 3' end, a second signal output sequence, a second promoter sequence, a second target aptamer sequence and a Locker sequence. The first signal output sequence is composed of a template sequence of an MG aptamer, the first promoter sequence is composed of a T7 promoter sequence, the first target aptamer sequence is composed of a DNA aptamer sequence of phenylalanine, and the Assistor sequence is used to promote base complementary pairing between the 5' end and the 3' end of the template sequence of the MG aptamer; the second signal output sequence is composed of a template sequence of a Broccoli aptamer, the second promoter sequence is composed of a T7 promoter sequence, the second target aptamer sequence is composed of a DNA aptamer sequence of tyrosine, and the Locker sequence is used to form a stem-loop structure of the second aptamer sensor; the template sequence of the MG aptamer is shown as SEQ ID NO. 1, the T7 promoter sequence is shown as SEQ ID NO. 2, the DNA aptamer sequence of phenylalanine is shown as SEQ ID NO. 3, and the length of the Assistor sequence is 0nt-5nt; and the sequence of the first aptamer sensor comprises any one of the sequences shown as SEQ ID NO. 4-SEQ ID NO.

9. The template sequence of the Broccoli aptamer is shown as SEQ ID NO. 10, the DNA aptamer sequence of the tyrosine is shown as SEQ ID NO. 11, and the Locker sequence has a length of 6 nt-11 nt; The sequence of the second aptamer sensor comprises any one of the sequences shown as SEQ ID NO. 12-SEQ ID NO. 17; The template sequence of the Broccoli aptamer is shown as SEQ ID NO. 18; The sequence of the second aptamer sensor comprises the sequence shown as SEQ ID NO. 19.

Images