Enzyme for producing A-pilanol and delta-junicene and application of enzyme for producing A-pilanol and delta-junicene
By constructing the A-pyrone/Δ-juniperene synthase AyTPS03 through genetic engineering, the problem of low efficiency in traditional extraction methods has been solved, enabling the efficient production of Δ-juniperene and A-pyrone, and promoting their application in agriculture and fragrance fields.
Patent Information
- Application Number
- CN202511320044.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-16
- Publication Date
- 2025-12-19
AI Technical Summary
Existing technologies make it difficult to efficiently extract and commercially produce Δ-juniperene and A-pyrone from plants. Traditional extraction methods have low yields, high solvent consumption, and significant batch-to-batch variations, which limits their application in agriculture and fragrances.
The gene encoding AyTPS03, an A-pyrone/Δ-juniperene synthase, was constructed using genetic engineering methods. It was then expressed in a host bacterium using a recombinant expression vector to obtain a genetically engineered strain. This enzyme was used to catalyze the synthesis of A-pyrone and Δ-juniperene from farnesyl pyrophosphate (FPP).
It significantly improves the production efficiency and yield of Δ-juniperene and A-pyrone, promotes their application in agriculture and fragrance, and meets the requirements of green and environmentally friendly production.
Smart Images
Figure CN121160682A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of genetic engineering and biocatalysis, and particularly relates to an enzyme for producing A-bisabolenol and Δ-cadinene and application thereof. BACKGROUND
[0002] Under the background of global antibacterial agent “green transformation”, although the quality of the active compounds synthesized by chemical synthesis is controllable and the batch difference is small, the chemical antibacterial agents still have many shortcomings, for example: the early development cost (route exploration, process optimization, toxicology research) is high; complex multi-step reactions often involve heavy metal catalysts (Pd, Pt), high-toxicity solvents (DMF, DMSO) or halogen reagents, polluting the environment, and conflicting with the concept of “green and sustainable”; the synthesis derivatives belong to “new chemical entities”, and the toxicological effects, teratogenicity, carcinogenicity and metabolism research thereof need to be discussed; the single synthetic product has a concentrated action target, and long-term use can easily induce microbial mutation and produce resistance, which is not as good as the synergistic bacteriostasis of multiple components (polyphenols-terpenes-flavonoids) in plant extracts, and can reduce the generation of drug resistance.
[0003] Plant natural antibacterial agents refer to secondary metabolites isolated from plants, which have inhibitory or killing effects on bacteria, fungi and other microorganisms. Its main chemical types include alkaloids, flavones, polyphenols, terpenes, tannins and polypeptides. These active ingredients can exert broad-spectrum and mild effects through multiple pathways such as destroying microbial cell membranes, interfering with energy metabolism, chelating metal ions or binding with nucleic acids. Compared with traditional chemical antibacterial agents, plant source preparations are renewable, easily degradable, low in toxicity to humans and animals, and more in line with the expectations of modern consumers for green and safe standards. Delta-cadinene is a natural bicyclic sesquiterpene, which is widely distributed in plant essential oils such as juniper, Acanthospermum hispidum flower, and Pistacia lentiscus fruit, and has antibacterial, insecticidal, anticancer and antiproliferative activities. It has significant antibacterial activity against bacteria and Candida albicans. In cotton (Gossypium spp.), (+)-delta-cadinene is the first key intermediate in the synthesis of plant antitoxins such as gossypol and other sesquiterpenes. When pathogenic bacteria invade, plants rapidly convert farnesyl pyrophosphate (FPP) to (+)-delta-cadinene through delta-cadinene synthase (DCS), and then initiate downstream oxidation, hydroxylation, coupling and other reactions to accumulate toxic sesquiterpenes such as gossypol, thereby inhibiting the spread of pathogens. It has a spicy, lemon and woody odor and can be used as a component of spices and essences to enhance the aroma and flavor of food and beverages. A-borneol has inhibitory effect on wood-rotting fungi such as Phlebia floridiana and Polyporus sulfurinus, and can be used as a natural acaricide candidate in agriculture. At the same time, it has a herbal-woody, slightly camphor-like odor and can also be used as a fixative or modifier for woody, herbal formula. Both have broad-spectrum antibacterial and agricultural plant protection application value, and have complex woody, herbal and other aroma notes, which can be applied to spices, functional foods and other fields.
[0004] Sesquiterpenes have been continuously valued, although such compounds can be obtained by extraction from plants, but since they still belong to secondary metabolites, the content is low, at the same time, the traditional extraction yield is low, the solvent consumption is large, and the batch difference is significant, which seriously restricts commercialization. Therefore, it is challenging to obtain delta-cadinene and A-borneol by extraction from plants, which is not conducive to its application in agricultural production. SUMMARY
[0005] To solve the above technical problems, the purpose of the present application is to provide an enzyme for producing A-borneol and delta-cadinene and its application
[0006] Another purpose of the present application is to provide a new A-borneol / delta-cadinene synthase AyTPS03 encoding gene and a production strain expressing the gene.
[0007] Still another purpose of the present application is to provide the application of the gene, recombinant expression vector and genetically engineered bacteria.
[0008] The object of the present application can be achieved by the following technical solutions.
[0009] An A-amyrin / Δ-cadinene synthase AyTPS03, the amino acid sequence of which is shown as SEQ ID NO. 1.
[0010] A gene encoding the A-amyrin / Δ-cadinene synthase AyTPS03 of claim 1, the nucleotide sequence of which is shown as SEQ ID NO. 2.
[0011] The application of the A-amyrin / Δ-cadinene synthase AyTPS03 in synthesizing A-amyrin and Δ-cadinene.
[0012] The A-amyrin / Δ-cadinene synthase AyTPS03 is used to catalyze the substrate farnesyl pyrophosphate (FPP) to synthesize the products A-amyrin and Δ-cadinene.
[0013] The application of the coding gene of the A-amyrin / Δ-cadinene synthase AyTPS03 in any of the following aspects:
[0014] (1) in preparing a catalyst for catalyzing farnesyl pyrophosphate (FPP) to synthesize the products A-amyrin and Δ-cadinene;
[0015] (2) in biosynthesizing A-amyrin and Δ-cadinene.
[0016] A recombinant expression plasmid containing the coding gene of the A-amyrin / Δ-cadinene synthase AyTPS03.
[0017] A genetically engineered bacterium for producing A-amyrin / Δ-cadinene synthase AyTPS03, containing the coding gene of the A-amyrin / Δ-cadinene synthase AyTPS03.
[0018] The genetically engineered bacterium is obtained by transforming a host bacterium with the recombinant expression vector, and the host bacterium is preferably Escherichia coli BL21 (DE3), Pichia pastoris, Saccharomyces cerevisiae, or Bacillus subtilis.
[0019] The application of the recombinant expression plasmid and the genetically engineered bacterium in any of the following aspects:
[0020] (1) in preparing a catalyst for catalyzing farnesyl pyrophosphate (FPP) to synthesize the products A-amyrin and Δ-cadinene;
[0021] (2) in biosynthesizing A-amyrin and Δ-cadinene.
[0022] A method for preparing a crude enzyme solution of A-amyrin / Δ-cadinene synthase AyTPS03, wherein the genetically engineered bacteria are subjected to fermentation culture to obtain a fermentation liquor of A-amyrin / Δ-cadinene synthase AyTPS03, and after centrifugation, the A-amyrin / Δ-cadinene synthase AyTPS03 crude enzyme solution is obtained by resuspension at a ratio of 1:2-7 (w / v) and ultrasonic disruption.
[0023] A method for biosynthesizing A-amyrin and Δ-cadinene, wherein the crude enzyme solution of the genetically engineered bacteria prepared above is used as an A-amyrin / Δ-cadinene synthase AyTPS03 enzyme solution to catalyze a substrate, farnesyl pyrophosphate (FPP), to produce the products A-amyrin and Δ-cadinene, and the reaction system is 0.2-10 mL of the A-amyrin / Δ-cadinene synthase AyTPS03 enzyme solution and FPP with a final concentration of 0.2-2 mM, and the reaction condition is incubation at 16-37℃ for 1-3 h.
[0024] Preferably, the A-amyrin / Δ-cadinene synthase AyTPS03 enzyme solution is 0.2 mL, the final concentration of FPP is 0.2 mM, and the reaction condition is incubation at 16℃ for 1 h.
[0025] Beneficial effects: The present application uses A-amyrin / Δ-cadinene synthase AyTPS03 as a starting point, adopts genetic engineering, heterologous expression, biological catalysis and other methods, and provides a A-amyrin / Δ-cadinene synthase AyTPS03 producing strain and a construction method and application thereof, and by the above-mentioned scheme, the present application at least has the following advantages:
[0026] Biological catalysis plays an important role and significance in the production process of important chemicals and the like. By using the biological catalysis method to efficiently produce A-amyrin and Δ-cadinene, the yield thereof can be significantly increased, and the production efficiency thereof can be improved. The present application uses recombinant DNA technology to clone the A-amyrin / Δ-cadinene synthase AyTPS03 coding gene into an expression vector, and transform a host to obtain a recombinant strain for producing A-amyrin / Δ-cadinene synthase AyTPS03. The present application also provides the application of the above-mentioned method in preparing products containing A-amyrin and Δ-cadinene. The genetically engineered strain and method obtained by the present application can obtain A-amyrin and Δ-cadinene, and can promote the application thereof in the fields of agriculture and tobacco and the like. BRIEF DESCRIPTION OF DRAWINGS
[0027] Figure 1 PCR electrophoretogram of A-amorphous-olivetol / Δ-cadinene synthase AyTPS03 gene in Example 1;
[0028] Figure 2 Recombinant plasmid containing A-amorphous-olivetol / Δ-cadinene synthase AyTPS03 gene transformed into recombinant bacteria colony map;
[0029] Figure 3 GC-MS chart of A-amorphous-olivetol and Δ-cadinene synthesized by the engineered bacteria.
[0030] Figure 4 GC-MS molecular fragment mass spectrum chart of A-amorphous-olivetol synthesized by the engineered bacteria.
[0031] Note: (A) fermentation product; (B) database
[0032] Figure 5 GC-MS molecular fragment mass spectrum chart of Δ-cadinene synthesized by the engineered bacteria.
[0033] Note: (A) fermentation product; (B) database DETAILED DESCRIPTION
[0034] The specific embodiments of the present application will be further described in conjunction with the accompanying drawings and examples. The following examples are used to illustrate the present application, but are not used to limit the scope of the present application.
[0035] Example 1
[0036] In this example, A-amorphous-olivetol / Δ-cadinene synthase AyTPS03 was synthesized according to the analysis of agarwood transcriptome, and the gene length was 1713 bp, which could encode 570 amino acid residues. By designing primers pET28a-Ay03-F: ACTTTAAGAAGGAGATATACATGAGCGGCTTTAGCGGCCT and pET28a-Ay03-R: CTCGAGTGCGGCCGCAAGCTTTAATACGGAATCGGATGCA, homologous arms were added at both ends of AyTPS03, and the E. coli expression vector pET28a was linearized by pET28a-F: AGCTTGCGGCCGCACTCGAG and pET28a-R: GTATATCTCCTTCTTAAAGT, and then transformed into E. coli BL21 (DE3) host, coated with kanamycin resistant plate, and a large number of single colonies containing recombinant plasmid were obtained. Figure 2A recombinant strain producing A-pyrinone / Δ-juniperene synthase AyTPS03 was obtained through resistance screening and sequencing identification, and named E. coli BL21-pET28a-AyTPS03.
[0037] Example 2
[0038] In this embodiment, the production strain E. coli BL21-pET28a-AyTPS03, obtained through construction and screening and fermentation, was used in a culture medium (1% sodium chloride, 0.5% yeast extract, and 1% peptone) to express and produce A-pyrone / Δ-juniperene synthase AyTPS03. The culture conditions were: inoculum size 2%, culture temperature 30℃, shaking speed 200 rpm, induction temperature 16℃, shaking speed 110 rpm, and fermentation time 16 h.
[0039] Take 200 mL of fermentation broth, centrifuge at 8000 rpm, add 10 mL of 10 mM PBS buffer to resuspend, and sonicate to disrupt the enzyme (power: 390 W, sonication time: 10 min). Obtain crude enzyme solution of A-pyringone / Δ-juniperene synthase AyTPS03.
[0040] Example 3
[0041] In this embodiment, the crude enzyme solution of A-picolinate / Δ-juniperene synthase AyTPS03 obtained from fermentation in Example 2 was used to catalyze the production of A-picolinate and Δ-juniperene products using farnesyl pyrophosphate (FPP). The reaction system consisted of 200 μL of A-picolinate / Δ-juniperene synthase AyTPS03 enzyme solution and 0.2 mM FPP. The specific reaction conditions were: incubation at 16°C for 1 hour. 200 μL of ethyl acetate was added, mixed, and extracted. The supernatant was collected after centrifugation at 12,000 rpm, and the A-picolinate / Δ-juniperene content in the supernatant was determined by GC-MS. Figures 3-5 As shown, A-picolinol and Δ-juniperene are produced by biocatalysis of A-picolinol / Δ-juniperene synthase AyTPS03 enzyme solution.
[0042] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the technical principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. An A-pyrine-1,6-diol / Δ-juniperene synthase, AyTPS03, characterized in that, The amino acid sequence is shown in SEQ ID NO.
1.
2. The gene encoding the A-pyrine / Δ-juniperene synthase AyTPS03 as described in claim 1, characterized in that, The nucleotide sequence is shown in SEQ ID NO.
2.
3. The use of the A-picolinol / Δ-juniperene synthase AyTPS03 according to claim 1 in the synthesis of A-picolinol and Δ-juniperene.
4. The application according to claim 3, characterized in that, The products A-picolinol and Δ-juniperene are synthesized using the A-picolinol / Δ-juniperene synthase AyTPS03 described in claim 1, which catalyzes the substrate farnesyl pyrophosphate (FPP).
5. Any of the following applications of the gene described in claim 2: (1) Application in the preparation of catalysts for the synthesis of A-picolinol and Δ-juniperene from farnesyl pyrophosphate FPP; (2) Application in the biosynthesis of A-pyrinol and Δ-juniperene.
6. A recombinant expression plasmid, characterized in that, It contains the gene described in claim 2.
7. A genetically engineered bacterium for producing A-pyrine / Δ-juniperene synthase AyTPS03, characterized in that, It contains the gene described in claim 2.
8. Any one of the following applications of the recombinant expression plasmid of claim 6 and the genetically engineered bacteria of claim 7: (1) Application in the preparation of catalysts for the synthesis of A-picolinol and Δ-juniperene from farnesyl pyrophosphate FPP; (2) Application in the biosynthesis of A-pyrinol and Δ-juniperene.
9. A method for preparing α-pyrenolinol / Δ-juniperene synthase AyTPS03, characterized in that, The genetically engineered bacteria described in claim 5 or 6 are fermented and cultured. After fermentation, the bacteria are centrifuged, resuspended in a resuspension buffer at a ratio of 1:2 to 7, and then sonicated to obtain crude enzyme solution of A-pyrifoliol / Δ-juniperene synthase AyTPS03. The culture medium used consists of: sodium chloride 0.5 to 6%, yeast extract 0.5 to 3%, and peptone 0.5 to 6%. The fermentation conditions are: inoculum size 0.5 to 15%, culture temperature 16 to 35°C, shaking speed 150 to 250 rpm, fermentation time 12 to 60 h, and resuspension buffer 5-100 mM PBS buffer.
10. A method for biosynthesizing α-pyringamenol and Δ-juniperene, characterized in that, Using the crude enzyme solution prepared in claim 8 as the substrate farnesyl pyrophosphate (FPP) catalyzed by the A-picolinol / Δ-juniperene synthase AyTPS03 enzyme solution, the products A-picolinol and Δ-juniperene are produced. The reaction system consists of 0.2–10 mL of A-picolinol / Δ-juniperene synthase AyTPS03 enzyme solution and FPP with a final concentration of 0.2–2 mM. The reaction conditions are 16–37 °C for 1–3 h. Preferably, the A-picolinol / Δ-juniperene synthase AyTPS03 enzyme solution is 0.2 mL, the final concentration of FPP is 0.2 mM, and the reaction conditions are 16 °C for 1 h.