Rice single-base editor and application thereof

Abstract

The invention relates to the technical field of biotechnology and plant genetic engineering, in particular to a rice single-base editor and application thereof. The gene sequence of the rice single-base editor at least comprises: (1) a nucleotide sequence as shown in SEQ ID NO.1; (2) a nucleotide sequence which replaces one or more nucleotide sequences in the nucleotide sequence as shown in SEQ ID NO.1 and can be used for rice genome shearing; (3) a nucleotide sequence which is obtained by adding one or more nucleotide sequences into the nucleotide sequence as shown in SEQ ID NO.1 and can be used for rice genome shearing; and (4) a nucleotide sequence which is obtained by deleting one or more nucleotide sequences in the nucleotide sequence as shown in SEQ ID NO.1 and can be used for rice genome shearing. Compared with a traditional single-base editor, the rice single-base editor provided by the invention has the advantage that the editing efficiency is improved when single-base replacement of rice specific gene loci is carried out.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology and plant genetic engineering technology, and particularly relates to a rice single-base editor and application thereof. BACKGROUND

[0002] Gene editing technology is crucial for plant gene function research and biological breeding. Existing research has found that the ancestral protein of the commonly used nucleases Cas9 and Cas12a in gene editing technology is a class of IscB, TnpB nucleases derived from IS600, 605 and 700 transposon families. And this class of transposon is only 300-400 amino acids in size, much smaller than Cas9 and Cas12a, which has been engineered and developed for human cell gene editing technology and applied to gene therapy.

[0003] Among them, the IscB nuclease, as the ancestral protein of Cas9, almost has the core functional domain of Cas9 protein, including RuvC, HNH, N-terminal PLMP and C-terminal TAM and related TID functional domains, etc. But it does not contain a REC structure of about 800 bp. Structural characterization results show that IscB is almost the same as Cas9 in terms of target recognition, R-loop formation and complex assembly. The above characteristics show that IscB is a very potential tool to be developed into gene editing and series of derivative tools, such as base editing.

[0004] In terms of cells, OgeuIscB derived from human intestinal epithelial cells is used to engineer gene editing tools. Unlike Cas9, which recognizes a 20nt spacer, IscB only needs a 16nt spacer sequence and specifically recognizes the TAM sequence of NWRRNA. However, the editing efficiency of wild-type IscB is limited. Evolved IscB efficiently mediates targeted editing of animal cells, such as IscB-V3 carrying D96R / E84R / V159R mutations, IcsB* carrying E84R / H368R / S386R / S456R mutations, and enOgeuIscB carrying M102R / / F137K / V159K / N281R / Q324R / Y327K / H368R / L393K mutations, which increase the editing efficiency by about 20-30 times. At the same time, the stability of guide RNA is improved by truncating ωRNA to further improve editing efficiency. By fusing nucleic acid exonuclease T5 or DNA binding domain Sso7 and other auxiliary factors, the editing efficiency is further improved while reducing off-target.

[0005] Compact RNA-guided IscB is more suitable for developing base editing tools, for example, a high-efficiency IscB single-base editing tool is developed in animal cells, and with the help of AAV virus packaging, it is used for disease treatment in mouse models. However, there are few reports on plant IscB system, how to construct a single-base editor available in plants, and improve the editing efficiency of single-base, is a problem to be solved at present. SUMMARY

[0006] In order to solve the above technical problems, the present application provides a rice single-base editor and its application, the rice single-base editor provided by the present application constructs a plant expression vector, and then constructs a rice genome targeting vector, which causes single-base substitution of specific gene sites in rice after being introduced into rice cells, and especially realizes mutation from C / G base to T / A. Compared with traditional single-base editors, the editing efficiency is improved.

[0007] To this end, the present application provides the following technical solutions, In the first aspect, the present application provides a rice single-base editor in an optional embodiment, the gene sequence of the rice single-base editor at least includes: (1) the nucleotide sequence shown as SEQ ID NO. 1; or, (2) a nucleotide sequence capable of cutting rice genome by substituting one or more nucleotide sequences in the nucleotide sequence shown as SEQ ID NO. 1; or, (3) a nucleotide sequence capable of cutting rice genome by adding one or more nucleotide sequences in the nucleotide sequence shown as SEQ ID NO. 1; or, (4) a nucleotide sequence capable of cutting rice genome by deleting one or more nucleotide sequences in the nucleotide sequence shown as SEQ ID NO. 1.

[0008] Preferably, the gene sequence of the rice single-base editor is the nucleotide sequence shown as SEQ ID NO. 1.

[0009] Preferably, the rice single-base editor includes an enSscB gene and two tandem repeat uracil glycosylase gene inhibitor genes.

[0010] In the present application, a plurality of SscB proteins are designed and screened, and a gene sequence with high activity in plants is found, which is named enSscB. In addition, the present application fuses a plurality of tandem uracil DNA glycosylase (UDG) inhibitor (UGI) genes to the C-terminal of the enSscB-coding protein to become an enSscB-CBE single-base editor. The enSscB-CBE gene editor is integrated into an expression vector, and a corresponding targeting vector is constructed on this basis, and then specific gene editing of rice is realized through rice genetic transformation.

[0011] In a second aspect, the present application provides, in optional embodiments, an expression cassette comprising the rice single-base editor described above.

[0012] In a third aspect, the present application provides, in optional embodiments, an expression vector, characterized by comprising the rice single-base editor described above or the expression cassette described above.

[0013] Preferably, the expression vector further comprises an omega RNA sequence and an expression frame matched with the rice single-base editor.

[0014] Preferably, the nucleotide sequence of the omega RNA sequence is shown in SEQ ID NO. 2.

[0015] In a fourth aspect, the present application provides, in optional embodiments, application of the rice single-base editor described above, the expression cassette described above or the expression vector described above in rice single-base editing.

[0016] Preferably, in rice single-base editing, the rice single-base editor is used to mutate C / G bases at specific or non-specific sites in a target gene sequence into A / T bases, so as to obtain a transgenic plant or plant part containing a single-base mutation.

[0017] Preferably, the application comprises using the rice single-base editor to recognize a TAM sequence with a NAR RNA feature, cutting DNA to form a single-strand break, and under the action of a self-repairing system, obtaining a transgenic plant or plant part with a single-base mutation mutation site from C / G to T / A.

[0018] In the present application, the construction method of the expression vector of the rice single base editor is: using PstI / SacI restriction sites, cutting pHUC400 vector with PstI / SacI enzyme and recovering, because the gene sequence of the rice single base editor is added with PstI / SacI restriction sites at both ends, the rice single base editor can be connected to the pHUC400 vector by using T4 ligase to obtain the expression vector of the rice single base editor. Further, on the basis of the expression vector of the rice single base editor, the ωRNA sequence and the expression frame are designed and fused. The ωRNA expression frame is fused to the expression vector of the rice single base editor by HindIII enzyme cutting, and finally the expression vector is obtained. On the basis of the expression vector, only simple annealing, enzyme cutting and connection can obtain the targeting vector of the specific gene.

[0019] The method for introducing the targeting vector into the rice cell comprises the following steps: (1) After shelling and sterilizing the rice seeds, the embryo is separated and placed on a callus induction medium to generate secondary callus; (2) The secondary callus is transferred to a new callus induction medium for pre-culture; (3) The callus obtained in step (2) is contacted with Agrobacterium containing the targeting vector for 15 minutes; (4) The callus of step (3) is transferred to a culture dish with three sterile filter papers (2.5-3.5 mL of Agrobacterium suspension medium is added) and cultured at 21-23°C for 48 hours; (5) The callus of step (4) is placed on a pre-selection medium and cultured for 5-7 days; (6) The callus of step (5) is transferred to a selection medium to obtain resistant callus; (7) The resistant callus is transferred to a differentiation and regeneration medium to differentiate into seedlings; (8) The seedlings of step (7) are transferred to a rooting medium.

[0020] In the step (1), the seeds are mature seeds; the induction medium in steps (1) and (2) is listed in Table 1; the contact with Agrobacterium in step (3) is soaking the callus in the Agrobacterium suspension; the Agrobacterium suspension medium in step (4) is listed in Table 1; the pre-selection medium in step (5) is listed in Table 1; the selection medium in step (6) is listed in Table 1; the differentiation and regeneration medium in step (7) is listed in Table 1; and the rooting medium in step (8) is listed in Table 1.

[0021] In a preferred embodiment, wherein the rice is japonica, more preferably, the rice is japonica Nipponbare.

[0022] Table 1 Exemplary formulation of the medium Induction medium: N6 majors, MS iron salts, B5 vitamins, B5 minors, 500 mg / L glutamine, 500 mg / L proline, 500 mg / L casein enzymatic hydrolysate, 3 g / L phytagel, 2 mg / L 2,4-D, 30 g / L sucrose, PH 5.8. Sterilized. Co-culture medium: N6 majors, MS iron salts, B5 vitamins, B5 minors, 500 mg / L proline, 500 mg / L casein enzymatic hydrolysate, 2 mg / L 2,4-D, 30 g / L sucrose, 100 ul / l acetosyingone, 4 g / L phytagel, PH 5.2. Sterilized. Recovery medium: N6 majors, MS iron salts, B5 vitamins, B5 minors, 500 mg / L glutamine, 500 mg / L proline, 500 mg / L casein enzymatic hydrolysate, 3 g / L phytagel, 2 mg / L 2,4-D, 30 g / L sucrose, PH 5.8. Sterilized. 250 mg / L carbencillin. Selection medium: N6 majors, MS iron salts, B5 vitamins, B5 minors, 500 mg / L glutamine, 500 mg / L proline, 500 mg / L casein enzymatic hydrolysate, 3 g / L phytagel, 2 mg / L 2,4-D, 10 g / L sucrose, 20 g / L Mannose, PH 5.8. Sterilized. 250 mg / L carbencillin, 25 mg / L hygromycin. Differentiation medium: N6 majors, MS iron salts, B5 vitamins, B5 minors, 500 mg / L glutamine, 500 mg / L proline, 500 mg / L casein enzymatic hydrolysate, 500 mg / L MES, 2 g / L phytagel, 2 mg / L 2,4-D, 30 g / L sucrose, 30 g / L sorbitol, 2.5 mg / L CuSO4, pH 5.8. Sterilized. 0.5 mg / L KT, 250 mg / L carbencillin, 25 mg / L hygromycin, AA amino acids. Rooting medium: 1 / 2 MS basal salts (2.165 g / L), B5 vitamins, 1.0 g / L casein enzymatic hydrolysate, 20 g / L sucrose, 3.5 g / L phytagel, pH 5.8. Sterilized. 0.2 mg / L NAA, 125 mg / L carbencillin, 25 mg / L hygromycin. The "optimized N6 macroelements" mentioned in Table 1 refer to the N6 macroelements in which [NO 3- ] / [NH 4+ ] = 40 mM / 10 mM.

[0023] The nucleotide sequence of SEQ ID NO. 1 is:

[0025] The nucleotide sequence of SEQ ID NO. 2 is: GGCUCUUCCAACUUGAAAAGGUUGAAAGAGCACAGGCUGAGACAUUCGUAAGGCCGAAAGGCCGGACGCACCCUGGGAUUUCCCCAGUCCCCGGAACUGCAUAGCGGAUGUCAGUUGAUGAAAAUCAGAUAAGCCAGGGGGAACAAUCACCUCUCUGGAAACAGAGAGAG.

[0026] Compared with the prior art, the present application has one of the following beneficial effects: 1. The rice single base editor plant expression vector provided by the present application is constructed, and then a rice genome targeting vector is constructed, which causes single base substitution of a specific gene site of rice after being introduced into rice cells, and especially realizes mutation from C / G base to T / A, which improves the editing efficiency compared with traditional single base editors. BRIEF DESCRIPTION OF DRAWINGS

[0027] Figure 1 It is a vector schematic diagram of the rice single base editor in Example 1 of the present application; Figure 2 It is a schematic diagram of the base substitution efficiency of enSscB-CBE vector and hA3A-CBE vector in plants in Example 3 of the present application; Figure 3 It is a schematic diagram of the editing efficiency and genotype statistical results of enSscB-CBE vector and hA3A-CBE vector in plants in Example 3 of the present application; Figure 4 It is a schematic diagram of enSscB-CBE vector in Pita and CYP99A2 editing window in Example 3 of the present application. DETAILED DESCRIPTION

[0028] The embodiments of the present application will be described below in conjunction with the accompanying drawings. It should be noted that the following embodiments are only used to illustrate the exemplary implementation of the present application, and do not limit the present application in any way. Those skilled in the art can make certain equivalent modifications and obvious improvements to the present application.

[0029] In the absence of other specific descriptions, the operations in the following detailed description are all carried out by using the conventional operations in the art. Those skilled in the art can easily obtain the teachings about such conventional operations from the prior art. The medicinal material raw materials, reagents, materials, etc. used in the following examples, if not specifically stated, are all commercially purchased products. Example One

[0030] Splicing of rice single base editor gene The rice single base editor gene of the present application is named enSscB-CBE, and the sequence is shown as SEQ ID NO. 1.

[0031] The enSscB with high activity in plants is obtained by directed evolution of the naturally obtained nuclease of the present application, carrying E251R / D263R / V326R mutation and simultaneous mutation D227A, and the rice codon-optimized nickase enSscB sequence is obtained.

[0032] Secondly, two repeated uracil DNA glycosylase (UDG) inhibitor (UGI) genes are artificially synthesized, named eUGI, connected to the PUC57-AMP vector to form the PUC57-AMP-eUGI vector, and loaded into the E. coli XL-blue strain.

[0033] According to the Gibson splicing principle, the enSscB gene and the two tandem repeated uracil DNA glycosylase (UGI) inhibitor genes are connected together and connected to the PUC57-AMP vector. The specific operation is as follows: According to the splicing order of the enSscB gene and the eUGI gene and the sequence of the PUC57-AMP vector, the primers are synthesized as follows: enSscB HR FP1: 5'-ATGCCTAAGAAAAAGAGAAAAGTGCTGGAGGCCGTCCGTGC-3'; enSscB HR RP1: 5'-acatagaccactgccatGGAACCACCGGAGGACCCG-3'; enSscB HR FP2: 5'-atggcagtggtctatgttatctccaagagcggtaagcca-3'; enSscB HR RP2: 5'-cacgtagatctgtaggcctccattgttcctaaggtact-3'; eUGI HR FP: 5'-gaggcctacagatctacgtgccaaagaagaagcggaaggt-3'; eUGI HR RP: 5'-TCACACCTTCCTTTTCTTtTTCGGGCTGCCCCCGCTGA-3'; PCR amplification was performed with enSscB as template, primer enSscB HR FP1 and enSscB HR RP1, and the PCR product was recovered. PCR amplification was performed with enSscB as template, primer enSscB HR FP2 and enSscB HR RP2, and the PCR product was recovered. PCR amplification was performed with eUGI as template, primer eUGI HR FP and eUGI HR RP, and the PCR product was recovered. According to the principle of Gibson assembly, the three recovered fragments and the EcoRI-digested PUC57-AMP vector fragment were assembled to form a gene in which enSscB and eUGI genes were fused together, which was named as enSscB-CBE gene.

[0034] Example 2 Construction of plant targeting vector containing enSscB-CBE gene The E. coli XL-blue containing enSscB vector obtained above was used to extract plasmid with Axygen plasmid extraction kit, and the plasmid was recovered after PstI / SacI digestion and inactivation of PHUC 400 vector. The enSscB gene was ligated downstream of the ZmUBI promoter of the PHUC 400 backbone vector through a ligation reaction to form a complete expression frame mediated by base substitution. On this basis, the synthesized ωRNA expression frame was digested with HindIII, and finally PHUC enSscB-ωRNA was obtained.

[0035] The nucleotide sequence ACAACTGAGAAAATGA in the rice Pita gene (LOC_Os12g18360) and the nucleotide sequence CCGCCACAACTAGGAGAAAGAA in the CYP99A2 (LOC_Os04g09920) gene were selected as targeting sites. AAAGAA The target site sequence was fused with PHUC enSscB-ωRNA to form PHUC enSscB-ωRNA-Pita / CYP99A2. The fused plant expression vector was transformed into Agrobacterium tumefaciens EHA105 strain (preserved by Rice Research Institute of Anhui Academy of Agricultural Sciences) by freeze-thaw method for genetic transformation.

[0036] Example 3 Rice genetic transformation using PHUC enSscB-ωRNA-Pita / CYP99A2 as targeting vector and obtaining of mutants 1. Induction and pre-culture of mature embryo callus The mature seeds of Nipponbare were dehulled, and the seeds with normal appearance and no mold were selected. The seeds were shaken in 70% alcohol for 90 s, and the alcohol was discarded. The seeds were then washed in a solution of 50% sodium hypochlorite containing Tween 20 (the original solution had a chlorine concentration of more than 4%, and 1 drop of Tween 20 was added per 100 mL) for 45 min on a shaker (the rotation speed was 180 r / min). The sodium hypochlorite was discarded, and the seeds were washed with sterile water for 5-10 times until there was no smell of sodium hypochlorite. Finally, sterile water was added, and the seeds were soaked overnight at 30°C. The embryos were separated from the aleurone layer with a surgical blade, and the scutellum was placed on the induction medium (the composition is shown in Table 1) with 12 seeds per dish. The seeds were cultured at 30°C in the dark to induce callus.

[0037] After two weeks, spherical, rough, and light yellow secondary callus appeared, and pre-culture operation could be performed. That is, the secondary callus was transferred to a new callus induction medium, and the pre-culture was performed at 30°C in the dark for 5 days. After the pre-culture, the small particles with good condition and vigorous division were collected with a spoon into a 50 mL sterile centrifuge tube for Agrobacterium infection.

[0038] 2. Culture of Agrobacterium strain and preparation of suspension The Agrobacterium strain EHA105 containing the PHUC enSscB-ωRNA-Pita / CYP99A2 vector was streaked on a LB plate containing 50 mg / L kanamycin (the composition is shown in Table 1), and was cultured at 28°C in the dark. After 24 h, the activated Agrobacterium was inoculated onto a fresh LB plate containing 50 mg / L kanamycin with a sterile inoculation loop, and was activated for the second time. The second activation was performed at 28°C in the dark overnight. In a 50 mL sterile centrifuge tube, 20-30 mL of Agrobacterium suspension medium (the composition is shown in Table 1) was added, and the Agrobacterium activated for the second time was scraped off with an inoculation loop. The OD660 was adjusted to about 0.10-0.25, and the mixture was incubated at room temperature for more than 30 min.

[0039] 3. Infection and co-culture The prepared callus was added with the Agrobacterium suspension, and was soaked for 15 min with occasional gentle shaking. After the soaking, the liquid was discarded (as much as possible), and the excess Agrobacterium liquid on the surface of the callus was absorbed with sterile filter paper, and was dried with sterile air in a clean bench. Three sterile filter papers were placed on a 100x25 mm sterile disposable culture dish, 2.5 mL of Agrobacterium suspension medium was added, and the dried callus was uniformly dispersed on the filter paper. The culture was performed at 23°C in the dark for 48 h.

[0040] 4. Pre-selection and selection culture After co-cultivation, the co-cultivated calli were evenly spread on the pre-selection medium (see Table 1) and cultured at 30°C in the dark for 5 days. After the pre-selection culture, the calli were transferred to the selection medium (see Table 1), 25 calli per dish, and cultured at 30°C in the dark. After 2-3 weeks, the resistant calli grew obviously and could be differentiated and regenerated. At this time, samples were taken for NGS sequencing and efficiency analysis.

[0041] 5. Differentiation and regeneration 2-3 well-grown and fresh small particles were selected from each independent transformant and transferred to the differentiation and regeneration medium (see Table 1). 5 independent transformants were placed per dish. Cultured at 28°C under light, with a light cycle of 16h light and 8h dark, and a light intensity of 3000-6000lx.

[0042] 6. Rooting and transplanting When the differentiated shoots of the resistant calli grew to about 2cm, only one well-grown shoot was selected from each independent transformant and transferred to the rooting medium (see Table 1) and cultured at 28°C, with a light cycle of 16h light and 8h dark, and a light intensity of 3000-6000lx. After two weeks, small plants with well-developed root systems were selected, the medium was washed off with water, and the plants were transplanted into soil.

[0043] 7. Molecular identification Before transplanting, rice leaf samples were taken and DNA was extracted using the CTAB method. The obtained genomic DNA samples were used for PCR analysis. PCR primers 5'-CCACAATGGCATGTTAACTTAT-3' and 5'-AATTCTTTTTTGACCGAACAAG-3' were designed to amplify a 134bp sequence near the Pita target. CYP99A2 amplification primers were designed and amplified similarly. The PCR components were first incubated at 95°C for 5 minutes, then subjected to 35 cycles of 94°C for 30 seconds, 58°C for 30 seconds, and 72°C for 20 seconds, and finally incubated at 72°C for 10 minutes. The PCR products were sequenced and the results were compared with the wild-type sequence. At the same time, a base editing vector with a reported high efficiency, human APOBEC3A, was constructed as a control.

[0044] 8. Results and analysis The NGS sequencing results of the resistant calli showed that enSscB-CBE exhibited high single-base substitution activity, and the control vector hA3A-CBE had almost no activity at two sites; the single-base editing efficiency of enSscB-CBE at the Pita and CYP99A2 sites was 15.91% and 7.44% respectively (see Table 2). Figure 2). Further, the detection of T0 plants confirmed the results in the resistance screening. No effective edited plants were obtained for hA3A-CBE at both loci. For enSscB-CBE, 23 and 21 edits were mediated at Pita and CYP99A2 loci, respectively, with efficiencies of 47.92% and 43.75%; among them, 3 plants of Pita were double heterozygous mutations (see Table 2). Figure 3 ). The mutation window was at C4-C14, with the highest mutation efficiency at C10 (see Table 3). Figure 4 ). The mutation types were mostly single or multi-site C-to-T.

[0045] Although the principles of the present application have been described in a way of preferable embodiments thereof with reference to the accompanying drawings, it is to be understood that the embodiments are merely illustrative of and not restrictive on the principles of the present application. The details of the embodiments are not intended to limit the scope of the present application, and any obvious changes, simple substitutions, and the like based on the technical solutions of the present application, without departing from the spirit and scope of the present application, all fall within the scope of protection of the present application.

Claims

1. A rice single-base editor, characterized in that, The gene sequence of the rice single-base editor includes at least: (1) The nucleotide sequence as shown in SEQ ID NO.1; or, (2) A nucleotide sequence that replaces one or more nucleotide sequences in the nucleotide sequence shown in SEQ ID NO.1 and is capable of rice genome splicing; or, (3) A nucleotide sequence in which one or more nucleotide sequences are added to the nucleotide sequence shown in SEQ ID NO.1, and which is capable of rice genome splicing; or, (4) A nucleotide sequence that is missing one or more nucleotide sequences in the nucleotide sequence shown in SEQ ID NO.1 and is capable of rice genome splicing.

2. The rice single-base editor according to claim 1, characterized in that, The gene sequence of the rice single-base editor is the nucleotide sequence shown in SEQ ID NO.

1.

3. The rice single-base editor according to claim 1, characterized in that, The rice single-base editor includes the enSscB gene and two tandemly repeated uracil glycosylation enzyme inhibitor genes.

4. An expression box, characterized in that, Including the rice single-base editor as described in any one of claims 1-3.

5. An expression carrier, characterized in that, Includes the rice single-base editor as described in any one of claims 1-3 or the expression cassette as described in claim 4.

6. The expression vector according to claim 5, characterized in that, It also includes an ωRNA sequence and expression cassette adapted to the rice single-base editor.

7. The expression vector according to claim 6, characterized in that, The nucleotide sequence of the ωRNA sequence is shown in SEQ ID NO.

2.

8. The application of the rice single-base editor according to any one of claims 1-3, the expression cassette according to claim 4, or the expression vector according to any one of claims 5-7 in rice single-base editing.

9. The application according to claim 8, characterized in that, In rice single-base editing, the rice single-base editor is used to mutate C / G bases at specific or unspecific sites in a target gene sequence to A / T bases, thereby obtaining transgenic plants or plant parts containing single-base mutations.

10. The application according to claim 8, characterized in that, The application includes using the rice single-base editor to identify TAM sequences with NARRNA characteristics, cutting DNA to form single-strand breaks, and obtaining transgenic plants or plant parts with single-base mutation sites from C / G to T / A under the action of the self-repair system.

Images