A method for rapidly screening high-efficiency gRNA of alfalfa

Abstract

This invention belongs to the field of genetic engineering technology, and more specifically, relates to a method for rapidly screening efficient gRNAs from alfalfa. The method specifically involves: enzymatically extracting and purifying cotyledons of alfalfa seedlings to obtain protoplasts; introducing a gene-editing vector containing the gRNA to be screened into the protoplasts and culturing them for 30 hours to obtain gene-edited protoplasts; extracting genomic DNA from the gene-edited protoplasts; amplifying the nucleotide sequence of the target site of the gRNA to be screened by PCR and performing high-throughput sequencing to screen for efficient gRNAs. This method solves the problems of long evaluation cycles and low efficiency in existing gRNA target gene-editing systems.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, and more specifically, relates to a method for rapidly screening efficient gRNAs from alfalfa. Background Technology

[0002] Alfalfa, one of the world's most important legume forage crops, is widely cultivated due to its high protein content, nitrogen-fixing capacity, and environmental adaptability. However, traditional alfalfa breeding has a long cycle and high time and economic costs. In recent years, research on alfalfa gene function and gene editing has received increasing attention, leading to a greater demand for alfalfa-related research techniques.

[0003] Since the successful application of CRISPR / Cas9 technology to plants, herbaceous plants have also successively established gene editing systems and applied them to gene function research and bio-breeding. Because different species have different genomes, gene editing methods require different conditions when applied to different species. Alfalfa is a highly heterozygous autotetraploid plant with a very complex genetic background, making editing difficult. Currently, with the decoding of multiple alfalfa genomes, the CRISPR / Cas9 gene editing technology system has been gradually established. This breakthrough has laid the foundation for molecular breeding of alfalfa, enabling researchers to simultaneously introduce mutations in all four alleles of alfalfa, creating mutants with significant phenotypic changes.

[0004] The plant protoplast transient transformation system is a highly efficient tool for gene function research. It enables rapid and transient gene expression analysis by introducing exogenous DNA or RNA into cell-free plant protoplasts. It effectively avoids regeneration barriers, directly utilizing free cells for gene manipulation, and boasts advantages such as a short experimental cycle (expression validation and high-throughput screening within 24-48 hours). Numerous studies have shown that protoplasts can provide an ideal in-situ validation platform for gRNA screening. Compared to the traditional leaf disc method, the protoplast transformation cycle is shorter, requiring only 2-3 days, enabling transient expression detection and avoiding the chimerism problem in regenerated plants. Theoretically, by isolating plant protoplasts, introducing CRISPR / Cas9-gRNA complexes, and then analyzing target site editing efficiency through high-throughput sequencing, efficient gRNA sequences can be rapidly screened; however, this technique has not yet been reported in alfalfa.

[0005] Alfalfa gene editing currently faces multiple technical challenges: low genetic transformation efficiency, difficulty in multi-allelic editing, low gRNA screening efficiency, and complex genotypes in regenerated plants. Of particular note is that gRNA design and screening are the "command center" of the entire CRISPR / Cas9 system, and their efficiency directly affects the success rate of gene editing. Therefore, developing efficient gRNA screening methods is of paramount importance for advancing alfalfa gene editing breeding. Summary of the Invention

[0006] To address the aforementioned technical problems, this invention provides a method for rapidly screening efficient gRNAs from alfalfa.

[0007] The present invention specifically adopts the following technical solution:

[0008] This invention provides a method for rapidly screening efficient gRNAs from alfalfa, comprising the following steps:

[0009] S1. After sterilizing alfalfa seeds, inoculate them onto a culture medium and incubate them in the dark for 4 days after vernalization. Crush the cotyledons of the seedlings and enzymatically hydrolyze them using cellulase and cleavage enzyme. Mix the resulting products, filter, and centrifuge to purify the filtrate, obtaining protoplasts. S2. Resuspend the protoplasts to obtain a protoplast suspension with a concentration of 1×10⁻⁶. 5 g -1 FW protoplast suspension, gene editing vector solution, and PEG solution were mixed and incubated for 15 min to induce transformation. The reaction was then terminated, centrifuged, resuspended, and cultured in the dark for 30 h to obtain gene-edited protoplasts. The gene editing vector contained gRNA to be screened.

[0010] The volume ratio of the protoplast suspension, gene editing vector, and PEG solution is 10:1:11;

[0011] S3. Extract genomic DNA from gene-edited protoplasts, amplify the nucleotide sequences of the target sites of the gRNAs to be screened by PCR and perform high-throughput sequencing to analyze the editing efficiency of different gRNAs, thereby screening out the gRNAs with the highest editing efficiency.

[0012] The present invention provides a rapid method for screening efficient gRNAs in alfalfa. First, seedlings are incubated in the dark at 4°C for 1 day, followed by 4 days of dark culture. The cotyledons are then enzymatically digested at 25°C for 12 hours, and purified by centrifugation at 150g to obtain protoplasts. This step, by adjusting specific reaction temperatures and durations, yields a large number of active protoplasts. Second, the gene-editing vector MsU6-38-pRGEB31 containing the gRNA to be screened is introduced into the protoplasts, and the protoplasts are incubated in the dark at 31°C for 30 hours to obtain gene-edited protoplasts. Genomic DNA is extracted from these protoplasts, and the nucleotide sequences of the target sites of the gRNA to be screened are amplified and subjected to high-throughput sequencing, thereby screening for efficient gRNAs. This method can unbiasedly and quantitatively evaluate the editing efficiency of different gRNAs at the cellular level, significantly shortening the research cycle.

[0013] Furthermore, the dark culture temperature in S1 is 25°C.

[0014] Furthermore, the enzymatic hydrolysis conditions in S1 are 25°C for 12 hours.

[0015] Furthermore, the centrifugal force for purification in S1 is 150g.

[0016] Furthermore, the promoter of the gene editing vector in S2 is the MsU6-38 promoter derived from alfalfa, and the nucleotide sequence of the MsU6-38 promoter is shown in SEQ ID NO.1.

[0017] Furthermore, the temperature for static induction conversion in S2 is 25°C.

[0018] Furthermore, the temperature for cultivation under dark conditions in S3 is 31°C.

[0019] Furthermore, the nucleotide sequence of the gRNA with the highest editing efficiency is shown in SEQ ID NO.13.

[0020] The present invention has the following beneficial effects:

[0021] 1. This invention provides a rapid screening method for efficient gRNA editing in alfalfa based on protoplasts. This method utilizes rapid detection of fluorescent reporter signals during protoplast culture, combined with high-throughput sequencing analysis of target site editing efficiency, to unbiasedly and quantitatively assess the editing efficiency of different gRNAs at the cellular level. Experimental results show that the GFP conversion rate is as high as 70% or more, and the editing efficiency of different gRNAs can reach up to 25% or more. Multiple highly efficient gRNAs targeting endogenous genes can be successfully screened, providing a powerful tool for alfalfa gene editing.

[0022] 2. This invention can complete gRNA activity detection and efficient screening in a short time without the need for a lengthy plant regeneration process, which greatly shortens the research cycle and improves the efficiency of alfalfa gene editing research.

[0023] 3. This invention lays the foundation for efficient gene editing of alfalfa through protoplasts, and provides key technical support for subsequent research on alfalfa functional genes, molecular breeding, and mass production of superior varieties.

[0024] 4. This invention is based on practical application and has significant innovative and application value. It can be widely used in alfalfa gene function research and molecular breeding, and can also provide a reference for the establishment of protoplast-based gRNA screening systems for other plants. It has broad application prospects and potential for technology transfer. Attached Figure Description

[0025] Figure 1 The images show the cotyledon dissociation state under different combinations of cotyledon culture days and enzymatic hydrolysis time. A represents the cotyledon enzymatic hydrolysis after 11 hours of dark culture at 25℃ for 3 days; B represents the cotyledon enzymatic hydrolysis after 12 hours of dark culture at 25℃ for 3 days; C represents the cotyledon enzymatic hydrolysis after 13 hours of dark culture at 25℃ for 3 days; D represents the cotyledon enzymatic hydrolysis after 11 hours of dark culture at 25℃ for 4 days; E represents the cotyledon enzymatic hydrolysis after 12 hours of dark culture at 25℃ for 4 days; F represents the cotyledon enzymatic hydrolysis after 13 hours of dark culture at 25℃ for 4 days; G represents the cotyledon enzymatic hydrolysis after 11 hours of dark culture at 25℃ for 5 days; H represents the cotyledon enzymatic hydrolysis after 12 hours of dark culture at 25℃ for 5 days; and I represents the cotyledon enzymatic hydrolysis after 13 hours of dark culture at 25℃.

[0026] Figure 2 The images show the protoplast cell states under different combinations of cotyledon and enzymatic hydrolysis times after different culture days. A represents the protoplast cell state after enzymatic hydrolysis for 11 hours following 3 days of dark culture at 25℃; B represents the protoplast cell state after enzymatic hydrolysis for 12 hours following 3 days of dark culture at 25℃; C represents the protoplast cell state after enzymatic hydrolysis for 13 hours following 3 days of dark culture at 25℃; D represents the protoplast cell state after enzymatic hydrolysis for 11 hours following 4 days of dark culture at 25℃; E represents the protoplast cell state after enzymatic hydrolysis for 12 hours following 4 days of dark culture at 25℃; F represents the protoplast cell state after enzymatic hydrolysis for 13 hours following 4 days of dark culture at 25℃; G represents the protoplast cell state after enzymatic hydrolysis for 11 hours following 5 days of dark culture at 25℃; H represents the protoplast cell state after enzymatic hydrolysis for 12 hours following 5 days of dark culture at 25℃; I represents the protoplast cell state after enzymatic hydrolysis for 13 hours following 5 days of dark culture at 25℃; and J is a statistical graph of protoplast yield under different treatments.

[0027] Figure 3The images show the state of cotyledon enzymatic hydrolysis and protoplast cells under different centrifugal forces. Specifically, A shows the state of protoplast cells after centrifugation at 100g for 5 minutes, B shows the state of protoplast cells after centrifugation at 150g for 5 minutes, C shows the state of protoplast cells after centrifugation at 200g for 5 minutes, and D is a statistical graph of protoplast yield under different treatments.

[0028] Figure 4 This is a schematic diagram of the transient transformation vector PGD-MCS-GFP plasmid.

[0029] Figure 5 This image shows the transient conversion efficiency of GFP plasmids in protoplast cells under different reaction times and in the cotyledon enzymatic digestion state. In the image, A represents protoplast cells under bright-field conditions with a reaction time of 10 min; B represents protoplast cells under bright-field conditions with a reaction time of 15 min; C represents protoplast cells under bright-field conditions with a reaction time of 20 min; F represents protoplast cells under GFP fluorescence conditions with a reaction time of 10 min; G represents protoplast cells under GFP fluorescence conditions with a reaction time of 15 min; H represents protoplast cells under GFP fluorescence conditions with a reaction time of 20 min; and I is a statistical graph of GFP conversion rates under different treatments.

[0030] Figure 6 The values ​​represent the GFP conversion rate and morphological integrity of protoplasts at different culture temperatures. Specifically, A represents protoplast cells cultured at 25℃ under bright-field conditions after transient transformation with the GFP vector; B represents protoplast cells cultured at 28℃ under bright-field conditions after transient transformation with the GFP vector; C represents protoplast cells cultured at 31℃ under bright-field conditions after transient transformation with the GFP vector; D represents protoplast cells cultured at 25℃ under GFP fluorescence conditions after transient transformation with the GFP vector; E represents protoplast cells cultured at 28℃ under GFP fluorescence conditions after transient transformation with the GFP vector; F represents protoplast cells cultured at 31℃ under GFP fluorescence conditions after transient transformation with the GFP vector; G represents the GFP conversion rate after different treatments; and H represents the morphological integrity of protoplasts after different treatments.

[0031] Figure 7 This is a schematic diagram of the gene editing plasmid MsU6-38-FT-A-pRGEB31.

[0032] Figure 8The editing efficiencies of four gRNAs in the gene editing plasmid MsU6-38-FT-A-pRGEB31 are shown in Figure A. A represents the specific amplification bands of different gRNAs. Bands 1-4 represent positive controls, amplified by PCR using directly extracted DNA from *Amyda sinensis* protoplast DNA as a template. Band 1 shows the positive band for gRNA1, band 2 for gRNA2, band 3 for gRNA3, and band 4 for gRNA4. Band 5 represents the negative control, amplified by PCR using sterile water as a template. Band 6 shows the specific amplification bands for gRNA1, 7 for gRNA2, 8 for gRNA3, and 9 for gRNA4. Figure B shows the statistical results of different gRNA editing efficiencies under different reaction temperatures.

[0033] Figure 9 The graph shows the editing efficiency of four gRNAs at different reaction temperatures. Detailed Implementation

[0034] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments, but this should not be construed as limiting the invention. Unless otherwise specified, the technical means used in the following embodiments are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following embodiments are commercially available unless otherwise specified.

[0035] Example 1: Preparation of protoplasts of alfalfa No. 1.

[0036] 1. Preparation of explants.

[0037] (1) Seed sterilization: Wash twice with sterile water, wash for 5 minutes with 75% alcohol, wash twice with sterile water, wash for 20 minutes with 30% sodium hypochlorite solution, and wash with sterile water until clear for later use.

[0038] (2) Cotyledon culture: 40 seeds of the above-mentioned Alfalfa No. 1 were planted in each MSO culture dish. The culture conditions were as follows: the seeds were vernalized by placing them in the dark at 4℃ for 1 day, and then the culture dish was placed in an incubator at 25℃ for 4 days.

[0039] 2. Isolation and purification of protoplasts.

[0040] (1) Enzymatic hydrolysis: The seed coat of the alfalfa seedlings obtained by dark culture at 25℃ for 4 days was removed and the cotyledons were cut off. 1g of cotyledons was placed in a 6cm culture dish with 1mL of CPW9 enzymatic hydrolysis solution and chopped to 0.5mm in length with a sterile blade. Then, CPW9 enzymatic hydrolysis solution was added to 3mL. The culture dish was covered and cultured at 25℃ overnight. After enzymatic hydrolysis for 12h, the protoplasts were observed under a microscope. Some protoplasts were free and most of the plasmolyzed cells were separated. The protoplasts were intact, indicating that the dissociation effect was good and the next step of protoplast separation could be carried out.

[0041] Table 1: Preparation of CPW9 buffer solution.

[0042]

[0043] Note: After complete dissolution, adjust the pH to 5.7, bring the volume to a final volume, sterilize by 0.22μm filtration, and store at 4℃.

[0044] Table 2: Preparation of CPW9 enzymatic hydrolysate.

[0045]

[0046] Note: After complete dissolution, sterilize by 0.22μm filtration.

[0047] (2) Protoplast isolation and purification: Add 5 mL of W5 solution to the culture dish containing CPW9 enzyme hydrolysate and pipette. Transfer to a 50 mL centrifuge tube, filter out cell wall and other impurities using a 70-mesh filter, and observe 10 μL of protoplast solution under a microscope. Add another 5 mL of W5 solution to wash, centrifuge at 150 g for 5 min. Discard the supernatant, add another 5 mL of W5 solution, and repeat the washing twice. After washing, discard the supernatant, add 1 mL of W5 solution to the precipitate to resuspend, incubate on ice for at least 30 min, discard the supernatant to obtain protoplasts, add 1 mL of MMG solution to obtain a protoplast suspension.

[0048] Table 3: Preparation of W5 solution.

[0049]

[0050] Note: After complete dissolution, sterilize by 0.22μm filtration.

[0051] Table 4: Preparation of MMG solution.

[0052]

[0053] Note: After complete dissolution, sterilize by 0.22μm filtration.

[0054] Verification Example 1: The effect of different experimental treatments on protoplast yield.

[0055] 1. Effects of different culture times and enzymatic hydrolysis times on protoplast yield.

[0056] To verify the effects of different culture times and enzymatic digestion times on protoplast yield, the following experimental setup was conducted: dark culture for 3, 4, and 5 days, followed by overnight enzymatic digestion for 11, 12, and 13 hours. The remaining steps were the same as in Example 1.

[0057] Protoplast yield (×10) 6 (pieces / g) = (N×5×10000) / m.

[0058] N is the average number of protoplasts, and m is the fresh weight of the sample.

[0059] The cell wall dissociation of the hypocotyl was observed under a microscope, such as... Figure 1 As shown. The protoplast yield under different treatments was also statistically analyzed, such as... Figure 2 As shown, the highest protoplast yield was obtained when the cotyledon was cultured in the dark for 4 days and then enzymatically digested for 12 hours, which represents the optimal cotyledon culture time and enzymatic digestion time.

[0060] 2. Effects of different centrifugal forces on protoplast yield.

[0061] To verify the effect of different centrifugal forces on protoplast yield, the following experimental setup was conducted: centrifugation at 100g, 150g, and 200g for 5 min, respectively. The remaining steps were the same as in Example 1.

[0062] like Figure 3 As shown, the results indicate that the highest protoplast yield and good cell condition were achieved at a treatment level of 150g.

[0063] Example 2: Transient conversion of the GFP (green fluorescent protein) gene from protoplasts of alfalfa variety Zhongmu No. 1.

[0064] The PGD-GFP plasmid has been published in the literature “Zhu M, Chen Y, Ding XS, Webb SL, Zhou T, Nelson RS, Fan Z. Maize Elongin C interacts with the viral genome-linked protein, VPg, of Sugarcane mosaic virus and facilitates virus infection. New Phytol. 2014 Sep;203(4):1291-1304. doi:10.1111 / nph.12890. Epub 2014 Jun 20. PMID:24954157; PMCID:PMC4143955.”.

[0065] Take 200 μL of a 1×10⁻⁶ solution.5 g -1 FW alfalfa protoplasts 1 were placed in a 2 mL centrifuge tube, and 20 μg of PGD-GFP plasmid at a concentration of 1 μg / μL was added. The plasmid map is shown below. Figure 4 As shown, after adding 220 μL of PEG solution, the solution was gently tapped against the tube wall with a finger to thoroughly mix the mixture, and allowed to stand for 15 min to induce transformation. Then, 880 μL of W5 solution was added to dilute the mixture, and the tube wall was gently tapped to mix and terminate the reaction. The mixture was centrifuged at 100 g for 1 min, the supernatant was discarded, and 100 μL of W5 solution was added to resuspend the protoplasts. The transiently transformed protoplasts were then cultured horizontally in the dark at 25°C for 30 h. GFP fluorescence was observed under a fluorescence microscope, and the transformation efficiency was calculated. Transformation efficiency (%) = number of fluorescent protoplasts / total number of protoplasts × 100%. Three representative fields of view were selected for observation, and the average value was calculated.

[0066] Table 5: Preparation of PEG solution.

[0067]

[0068] Verification Example 2: Effect of different treatment conditions on the transient conversion efficiency of protoplasts to GFP.

[0069] 1. Effect of different transformation times on the instantaneous transformation efficiency of protoplasts to GFP.

[0070] To demonstrate the effect of different transformation times on the instantaneous GFP transformation efficiency of protoplasts, the following experimental treatments were performed: the static induction transformation mixture was incubated for 10 min, 15 min, and 20 min. The remaining steps were the same as in Example 2.

[0071] Observe GFP under a fluorescence upright microscope and calculate the transformation efficiency, such as Figure 5 As shown in the figure. The results indicate that the highest GFP fluorescence conversion rate in protoplasts was achieved after PEG induction, mixing, and culturing for 15 min.

[0072] 2. Effects of different culture temperatures on transient GFP transformation in protoplasts.

[0073] To demonstrate the effect of different culture temperatures on transient GFP transformation of protoplasts, the following experimental treatments were conducted: the transiently transformed protoplasts were placed horizontally and cultured at temperatures of 25°C, 28°C, and 31°C, respectively, with the remaining steps being the same as in Example 2.

[0074] GFP was observed under a fluorescence upright microscope, and the transformation efficiency and protoplast morphology integrity rate were statistically analyzed. Figure 6 As shown. Protoplast morphological integrity rate (%) = (Number of intact protoplasts ÷ Total number of protoplasts) × 100%

[0075] Number of intact protoplasts: refers to the number of protoplasts observed under a microscope that have intact cell membrane structure, regular morphology, no obvious damage, and no leakage of contents.

[0076] Total number of protoplasts: refers to the total number of protoplasts observed in the same field of view, including intact and damaged ones such as those with ruptured cell membranes, spilled contents, and irregular shapes.

[0077] The results showed that the protoplasts exhibited the highest GFP conversion rate and the highest morphological integrity rate at a culture temperature of 25℃.

[0078] Example 3: Promoter screening, gRNA design, and construction of the MsU6-38-FT-A-pRGEB31 vector.

[0079] 1. Vector Design: Vector pRGEB31 was purchased from Addgene. The OsU6 promoter in the gRNA expression module of vector pRGEB31 was replaced with the AtU6 promoter from Arabidopsis thaliana via homologous recombination; the CaMV35S promoter driving Cas9 expression was replaced with the Arabidopsis ubiquitin promoter AtUbi10; and the selection marker was replaced from hygromycin resistance to the herbicide resistance gene Bar to make it suitable for gene editing in dicotyledonous plants such as alfalfa. Finally, the gene editing vector M-pRGEB31 was obtained.

[0080] 2. MsU6 Promoter Screening: Using bioinformatics analysis, the conserved sequence of Arabidopsis U6 snRNA was searched in the alfalfa genome database and compared with the genome of the Xinjiang large-leaf alfalfa variety using BLAST. Based on the BLAST location information, the upstream and downstream 2000 bp positions were calculated, and sequences were extracted according to the extraction information codes to obtain fragments containing MsU6 RNA. Promoter sequences were found on different fragments containing MsU6 RNA. The 5′ end of the U6 promoter sequence was truncated and used for gRNA promoter modification. The Arabidopsis AtU6 promoter on the gene editing vector M-pRGEB31 was replaced with the MsU6-38 promoter, synthesized by Nanjing GenScript, to obtain the MsU6-38-pRGEB31 vector for subsequent experiments. The MsU6-38 promoter sequence is shown in SEQ ID NO.1.

[0081] SEQ ID NO.1: GAACTAGTCCAAACCCAACAAGTTGCAATGCTCTATACGTAGATTTCATAGGTTTCAACTTTGAGGAAAGATTCCTAATAATGTAAAATGAGAGCTGAGGTATCTAATTGTGTGAAGGGCACTAGACAACACAATACAGTTGATGATT TCAAAACTTTTGTATTACTTAAAGTGACAACGAAGGGAGGGAAGAGGGTTCATTTCATGTTGGTAGTAAGTGCGTTGTTTTAGTTGTGAAAATAGTCCTACATTGAAACAAACATGGAATGTTTATATTACGCTAGCGCACTTCAACTAATG.

[0082] 3. FT-A sequence design, synthesis, and vector construction: Four gRNAs were designed in the conserved region of the Sgene72216 gene using the online website http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR2 / SCORE. The FT-A sequence was synthesized according to the sequence order. The FT-A sequence order is: tRNA+gRNA1+scaffold+tRNA+gRNA2+scaffold+tRNA+gRNA3+scaffold+tRNA+gRNA4, where the tRNA sequence is shown in SEQ ID NO.2.

[0083] SEQ ID NO. 2: AACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA.

[0084] The scaffold sequence is shown in SEQ ID NO.3.

[0085] SEQ ID NO. 3: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC.

[0086] The synthesized FT-A sequence is shown in SEQ ID NO.4.

[0087]

[0088] The sequence shown in SEQ ID NO.4 was inserted into the MsU6-38-pRGEB31 vector. Bsa The MsU6-38-FT-A-pRGEB31 vector was obtained by intersecting the I restriction sites. The vector map is shown below. Figure 7 As shown, both sequence synthesis and vector construction were carried out by Shanghai Sangon Biotech Co., Ltd. The constructed vector was transformed into *E. coli* DH5α, and plasmids were extracted from positive single clones with correct sequencing results for later use.

[0089] Example 4: Evaluation of gRNA editing efficiency using the MsU6-38-FT-A-pRGEB31 vector.

[0090] Take 200 μL of a 1×10⁻⁶ solution. 5 g -1 FW's *Alfalfa No. 1* protoplast suspension was placed in 2 mL centrifuge tubes. 20 μL of MsU6-38-FT-A-pRGEB31 plasmid (1 μg / μL) and an equal volume of PEG were added. The mixture was gently mixed by pipetting, and incubated at 25°C for 15 min to induce transformation. Subsequently, 880 μL of W5 solution was added to dilute the mixture, and the tube was gently rubbed to mix and terminate the reaction. The mixture was centrifuged at 100 g for 1 min, the supernatant was discarded, and 100 μL of W5 solution was added to resuspend the protoplasts. The transiently transformed protoplasts were then cultured horizontally at 31°C in the dark for 30 h to obtain gene-edited protoplasts. Take 0.5 mL of gene-edited protoplasts, extract DNA using the CTAB method as a template, add the upstream and downstream primers listed in Table 6, and perform PCR reaction as shown in Table 7. The reaction system is as follows: 98℃ pre-denaturation for 30 s, 98℃ denaturation for 10 s, 57℃ annealing for 5 s, 72℃ extension for 5 s, 34 cycles, hold at 72℃ for 1 min, and store at 4℃. Take 6 μL of PCR product and place it in electrophoresis buffer. Run the gel at 120V for 26 min. After each gRNA shows a band, dry the remaining PCR product to 3 μL and send it to the Hi-TOM high-throughput sequencing platform for high-throughput sequencing. Analyze and statistically determine the editing efficiency of different gRNAs. Editing efficiency (%) = (number of effective reads with target mutation ÷ total number of effective reads covering the target region) × 100%. Figure 8 The results showed that gRNA2 had the highest editing efficiency.

[0091] Table 6: Upstream and downstream primers for 4 different gRNAs.

[0092]

[0093] The nucleotide sequence of gRNA2 is shown in SEQ ID NO.13. SEQ ID NO.13: AATCAACCCAGAGTGAGTGT.

[0094] Table 7: PCR amplification system.

[0095]

[0096] Validation Example 3: The effect of different culture temperatures on gRNA editing efficiency.

[0097] To verify the effect of different culture temperatures on gRNA editing efficiency, the following experimental treatments were performed: the culture temperatures under dark conditions were set to 25℃, 28℃, 31℃, 34℃, and 37℃. The remaining steps were the same as in Example 4.

[0098] Figure 9 The results showed that the editing efficiency of gRNA2 was significantly higher than that of other targets at different temperatures, with the editing efficiency of gRNA2 at 31℃ being higher than that at other temperatures.

[0099] Table 8 presents the types of mutation events detected at the target site under different reaction temperatures. Overall, base mutations occurred at all temperatures. Base substitutions and deletions were observed at 25℃, 28℃, and 37℃, while base substitutions were predominant at 31℃ and 34℃. The reaction temperature affected the type and extent of mutations.

[0100] Table 8: Statistics on base mutations.

[0101]

[0102] Note: Lowercase letters indicate base substitutions, - indicates the absence of a base, and / indicates no data.

[0103] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.

Claims

1. A method for rapid screening of efficient gRNAs from alfalfa, characterized in that, Includes the following steps: S1. After sterilizing alfalfa seeds, they were inoculated onto a culture medium and vernalized. Seedlings were obtained by dark culture at 25°C for 4 days. The cotyledons of the seedlings were crushed and enzymatically hydrolyzed with cellulase and ionizing enzyme. The resulting products were mixed, filtered, and the filtrate was obtained. The filtrate was purified by centrifugation at 150g to obtain protoplasts. The enzymatic hydrolysis conditions were 25℃ for 12 hours. S2. Resuspend the protoplasts to obtain a protoplast suspension with a concentration of 1×10⁻⁶. 5 g -1 FW protoplast suspension, gene editing vector solution, and PEG solution were mixed and incubated at 25°C for 15 min to induce transformation. The reaction was then terminated, centrifuged, resuspended, and cultured at 31°C in the dark for 30 h to obtain gene-edited protoplasts. The gene editing vector contained gRNA to be screened. The promoter of the gene editing vector is the MsU6-38 promoter derived from alfalfa, and the nucleotide sequence of the MsU6-38 promoter is shown in SEQ ID NO.1; The volume ratio of the protoplast suspension, gene editing vector, and PEG solution is 10:1:11; S3. Extract genomic DNA from gene-edited protoplasts, amplify the nucleotide sequence of the target site of the gRNA to be screened by PCR and perform high-throughput sequencing to analyze the editing efficiency of different gRNAs, thereby screening out the gRNA with the highest editing efficiency. The nucleotide sequence of the gRNA with the highest editing efficiency is shown in SEQ ID NO.13.

Images