An ompR gene mutant and its application in the fermentation production of VB5

Abstract

This application provides an ompR gene mutant and its application in the fermentation production of vitamin B5. Firstly, an engineered bacterial strain capable of increasing vitamin B5 yield is provided. The 578th base of the ompR gene in the genome of this engineered strain is mutated from A to C. The ilvG gene is integrated into the avtA site of the chromosome of this engineered strain. + The M gene enhances precursor supply and introduces a synthetic pathway through the introduction of the panBCE gene cluster. This application also provides a method for constructing this engineered strain and a method for fermenting and producing VB5. By controlling glucose feeding and pH, the VB5 yield was ultimately increased by 53.6% compared to strains without the ompR mutant gene. This application provides a solution for the efficient and green bio-production of vitamin B5 and has significant industrial application value.

Description

Technical Field

[0001] This application relates to the field of microbiology and fermentation engineering, and in particular to the application of engineered strains with the ompR mutant gene and their fermentation production of vitamin B5 in Escherichia coli. Background Technology

[0002] Vitamin B5 (VB5), also known as D-pantothenic acid, is a water-soluble vitamin and a component of coenzyme A and acyl carrier proteins. As a cofactor for more than 70 enzymes, it participates in the metabolism of carbohydrates, fats, proteins, and energy, playing a vital role in physiological metabolic regulation. VB5 is mainly used in animal feed additives, food additives, and pharmaceutical raw materials. With the discovery of new functions of VB5 and the expansion of its application areas, its market demand will continue to show a steady growth trend.

[0003] Industrial production of VB5 relies entirely on chemical synthesis. This process primarily uses isobutyraldehyde-formaldehyde-hydrocyanic acid to synthesize dl-pantolactone. dl-pantolactone is further resolved chemically or enzymatically to obtain l-pantolactone. Finally, l-pantolactone is combined with β-alanine, produced from acrylonitrile, to synthesize VB5. Chemical synthesis of VB5 uses isobutyraldehyde, formaldehyde, hydrocyanic acid, and acrylonitrile as main raw materials. The production route involves flammable, explosive, and highly toxic chemicals, and the process also generates cyanide-containing wastewater. Treating this wastewater is difficult and costly, and poses environmental safety risks, making the VB5 industry a heavily polluting industry.

[0004] Microbial fermentation for the production of vitamin B5 not only uses renewable glucose as a raw material, but also generates waste residue, wastewater, and waste gas that are easy to treat and utilize, making it an ideal alternative to chemical methods and effectively addressing the high pollution problem in the vitamin B5 industry. However, the metabolic pathways by which microorganisms synthesize vitamin B5 from glucose are subject to complex regulatory mechanisms, resulting in extremely low fermentation yields, far from being economically feasible. One key factor hindering increased fermentation yield is the toxic feedback inhibition of the product vitamin B5 on the producing strain (i.e., poor strain tolerance). Summary of the Invention

[0005] In view of the above, this application provides a method for increasing VB5 fermentation yield by improving the tolerance of engineered strains.

[0006] High concentrations of pantothenate in the culture medium severely inhibit the growth of wild-type Escherichia coli MG1655. This application describes a method to gradually increase the sodium pantothenate concentration in the culture medium from 100 g / L to 190 g / L, thereby screening for evolved strains that can tolerate high concentrations of sodium pantothenate.

[0007] Furthermore, genome sequencing revealed that the 578th base of the ompR gene in this evolved strain changed from A to C, meaning that the 193rd amino acid of the protein encoded by this gene changed from glutamic acid (GAA) to alanine (GCA).

[0008] The first aspect of this application provides a mutant of the ompR gene, wherein the nucleotide sequence of the mutant is such that the 578th base of the nucleotide sequence of the ompR gene as shown in SEQ ID NO: 1 is changed from A to C.

[0009] The second aspect of this application provides an engineered strain of *Escherichia coli* having the ompR gene mutant provided in the first aspect of this application.

[0010] In some implementations, the engineered strain also expresses ilvG derived from Escherichia coli BL21. + M gene; and / or

[0011] The L-aspartate α-decarboxylase gene panD, derived from Bacillus licheniformis, is expressed.

[0012] Preferably, the L-aspartate α-decarboxylase gene panD derived from Bacillus licheniformis has the following characteristics:

[0013] (a) A nucleotide sequence as shown in SEQ ID NO: 31; or

[0014] (b) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (a), and which has the same or similar function as the nucleotide sequence shown in (a); or

[0015] (c) A nucleotide sequence that has at least 80% homology with the nucleotide sequence shown in (a) or (b); and / or

[0016] The number of copies of the panB, panC, and / or panE genes should be increased, preferably by 1-20 copies.

[0017] In some embodiments, the plasmid contains one or more of the panB, panC, and panE genes, which can be operatively linked to the same or different promoters, respectively.

[0018] In some implementations, the promoter is the PJ23119 promoter and / or the trc promoter.

[0019] In some embodiments, the plasmid contains panB, panC, and panE genes, wherein panB and panC genes are panBC and operatively linked to the trc promoter, and the panE gene is operatively linked to the PJ23119 promoter.

[0020] In some embodiments, the engineered bacteria of this disclosure include plasmids containing one or more of the panB, panC, and / or panE genes.

[0021] In some embodiments, the panB gene encodes a ketopantoacid hydroxymethyltransferase that catalyzes the addition of a methyl group to the substrate α-ketoisovalerate to form a ketopantoacid. Non-limiting examples of the panB gene include the nucleotide sequence shown in SEQ ID NO: 46.

[0022] In some embodiments, the panE gene encodes ketopantolytic acid, which reduces ketopantolytic acid to pantolytic acid. Non-limiting examples of the panE gene include the nucleotide sequence shown in SEQ ID NO: 47.

[0023] In some embodiments, the panC gene encodes pantothenic acid synthase, which further catalyzes the condensation of pantothenic acid and β-alanine to form VB5. Non-limiting examples of the panC gene include the nucleotide sequence shown in SEQ ID NO: 48.

[0024] In some implementations, the copy number of the panB, panC, and / or panE genes is increased by 1-5, 3-8, 6-18, 7-15, or 13-20.

[0025] In some specific embodiments of this application, the engineered bacteria further includes ilvG operably linked to a strong promoter and / or a strong RBS. + M and panD genes.

[0026] In a preferred embodiment, the strong promoter is a PL promoter and / or a trc promoter, and the strong RBS is BCD2.

[0027] In a more preferred embodiment, the BCD2 has:

[0028] (A) A nucleotide sequence as shown in SEQ ID NO: 32; or

[0029] (B) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (A), and which has the same or similar function to the nucleotide sequence shown in (A); or

[0030] (C) is a nucleotide sequence that is at least 80% homologous to the nucleotide sequence shown in (A) or (B).

[0031] In some implementations, the ilvG + Both the M and panD genes are operatively linked to the trc promoter or / or the PL promoter.

[0032] In some implementations, the ilvG + The M gene is operatively linked to the trc promoter, and the panD gene is operatively linked to the PL promoter.

[0033] In some implementations, the ilvG + The M gene is operatively linked to the PL promoter, and the panD gene is operatively linked to the trc promoter.

[0034] In some implementations, the PL promoter is a nucleotide sequence of 401 nt-474 nt as shown in SEQ ID NO: 29.

[0035] In some implementations, the trc promoter includes a nucleotide sequence as shown in SEQ ID NO: 44.

[0036] In a preferred embodiment, the engineered bacteria of this disclosure are derived from Escherichia coli, preferably Escherichia coli K12, and more preferably Escherichia coli K12 MG1655 strain.

[0037] The third aspect of this application also provides the application of the engineered bacteria of this disclosure in the production of vitamin B5.

[0038] In some implementations, vitamin B5 also includes vitamin B5 derivatives, such as panthenol.

[0039] The fourth aspect of this application also provides a method for producing vitamin B5 and its derivatives, characterized in that the engineered strain provided in the second aspect is used as the fermentation strain to ferment and prepare vitamin B5.

[0040] The *E. coli* strain used in this application is K12 MG1655, whose ilvG gene is mutated and inactivated. Therefore, this application introduces the active ilvG gene from *E. coli* BL21. + The M gene increases the supply of acetolactate, a precursor of VB5. This application inserts the ilvG gene, derived from Escherichia coli BL21, into the genome of E. coli K12 MG1655. + The M gene is regulated by a strong trc promoter, and ilvG is regulated by it. + M transcription initiation, regulated by the terminator Ter, ilvG + M transcription terminates. ilvG +The M gene inserts into the coding sequence of the avtA gene at its genomic insertion site, leading to avtA inactivation, weakening valine synthesis, and thus weakening the competitive pathway of VB5, which is beneficial to the biosynthesis of VB5.

[0041] The panD gene, derived from Bacillus licheniformis, was also integrated into the avtA gene of the engineered bacteria. Transcription and translation initiation were regulated using strong promoters PL and BCD2, respectively.

[0042] The culture medium used in the fermentation production of VB5 contains a carbon source, a nitrogen source, inorganic ions, antibiotics, and other nutrients. Sugars such as glucose, lactose, and galactose can be used as carbon sources. Inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium phosphate, and ammonium chloride can be used; organic nitrogen sources such as corn steep liquor, soybean meal hydrolysate, hair powder, yeast extract, and peptone can be used. Inorganic ions include one or more of the following: iron, calcium, magnesium, manganese, molybdenum, cobalt, copper, and potassium. No additional β-alanine needs to be added to the culture medium.

[0043] Beneficial effects of the invention

[0044] This application introduces ompR A578C Site-directed mutagenesis was performed, and the mutation was verified in both wild-type and engineered VB5-producing strains to enhance the strains' tolerance to VB5. Through synergistic effects with metabolically optimized chassis strains, the yield of VB5 produced by fermentation in engineered strains was significantly increased, with a maximum increase of 53.6%. Compared to the highly polluting chemical methods of vitamin B5 production, this biological method offers advantages such as renewable raw materials and easy treatment and resource utilization of waste residue, wastewater, and exhaust gas. This application provides a novel solution to overcome the economic bottleneck of VB5 fermentation production and has significant industrial application value for the industrial production of vitamin B5. Detailed Implementation

[0045] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0046] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0047] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0048] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0049] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0050] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were all purchased from regular biochemical reagent stores. All quantitative experiments in the following examples were performed in triplicate, and the results were averaged. Unless otherwise specified, the techniques used in the following examples are conventional methods and commercially available instruments and reagents well-known to those skilled in the art. Please refer to *Molecular Cloning: A Laboratory Manual (3rd Edition)* (Science Press), *Microbiology Experiments (4th Edition)* (Higher Education Press), and the manufacturer's instructions for the corresponding instruments and reagents for reference.

[0051] In the following examples, unless otherwise specified, the nucleotide sequences in the sequence listing are written from left to right in order from the 5' to the 3' end, and the amino acid sequences are written from left to right in order from the amino terminus to the carboxyl terminus. If the sequence described in the specification is inconsistent with the sequence listing, the sequence described in the specification shall prevail.

[0052] The *E. coli* K12 MG1655 (E. coli MG1655) used in this application has ATCC number 700926. The pACYC184 plasmid was purchased from NEB, catalog number E4152S. Plasmid pcas9 was purchased from Addgene, catalog number 62225; plasmid pTargetF was purchased from Addgene, catalog number 62226; and the Q5® Site-Directed Mutagenesis Kit was purchased from NEB, catalog number E0552S.

[0053] Example 1

[0054] Establish a method for the determination of vitamin B5 by high performance liquid chromatography.

[0055] The yield of VB5 in the fermentation broth was quantitatively determined using HPLC. The specific method is as follows:

[0056] Sample pretreatment: Centrifuge the fermentation broth sample to obtain the supernatant, add purified water to dilute to an appropriate concentration (0.1 g / L-0.5 g / L) within the standard curve range of VB5 concentration, filter with a 0.22 µm filter membrane, and place in a sample bottle for testing.

[0057] The chromatographic conditions were as follows: an Agilent ZORBAX SB-Aq column (4.6 x 250 mm) was used; the column temperature was 30℃; the detection wavelength was 210 nm; the mobile phase flow rate was 1 mL / min; and the injection volume was 10 µL. The mobile phase was 3.12 g / L NaH₂PO₄·2H₂O, adjusted to pH 2.2 with phosphoric acid, filtered through a 0.45 μm filter membrane, and degassed by sonication before use.

[0058] Standard curve preparation: Calcium pantothenate (VB5) purchased from Sigma-Aldrich was used as the standard. Calcium pantothenate (VB5) was accurately weighed to prepare a stock solution. The stock solution was then serially diluted to prepare standard working solutions of calcium pantothenate with concentrations of 0.1 g / L, 0.2 g / L, 0.3 g / L, 0.4 g / L, and 0.5 g / L.

[0059] The samples were then injected and measured sequentially under the chromatographic conditions described above. A standard curve was plotted with the calcium pantothenate concentration on the x-axis and the corresponding peak area on the y-axis, and a linear regression equation was obtained. The linear correlation coefficient of this standard curve was greater than 0.999. Thus, a standard curve was prepared for determining the concentration of 0.1-0.5 g / L calcium pantothenate and its relationship to absorbance.

[0060] Example 2

[0061] The *E. coli* strain MG1655 was obtained through growth-adaptive evolution, and the mutant gene was verified.

[0062] 1. Adaptive evolution experiments

[0063] Wild-type strain E. coli MG1655 was selected for adaptive evolution, and the steps are as follows:

[0064] Streak activation of Escherichia coli strain MG1655

[0065] Bacteria were taken from glycerol culture tubes stored at -80°C and streaked onto LB solid medium. The culture was then incubated upside down overnight in a 37°C incubator.

[0066] 2. Preparation of seed culture of Escherichia coli MG1655

[0067] Bacterial growth was scraped from LB solid medium of each strain and inoculated into test tubes containing 5 mL of LB liquid medium. The test tubes were incubated in a shaker at 37°C and 200 rpm until the logarithmic growth phase, and the OD was measured. 600 .

[0068] 3. Inoculation and subculturing evolution of Escherichia coli strain MG1655

[0069] When the above strains are in the logarithmic phase, take the above seed culture and transfer it to a shake flask of evolution medium at an inoculation rate of 1% (v / v), and culture it in a shaker at 37°C and 200 rpm.

[0070] 4. Apply evolutionary pressure

[0071] After 12 hours of incubation, the OD of the culture medium was measured. 600 (Dilution factor and calculation), subculture into fresh evolution medium at an inoculum of 1% (v / v). Then, based on the OD every 12 hours... 600 The trend of OD value change was observed by gradually increasing the sodium pantothenate content in the culture medium. The initial sodium pantothenate concentration in the evolution medium was 100 g / L. If the measured OD value... 600 If the value is ≥ 2.0, the bacterial culture is transferred to fresh evolution medium with a sodium pantothenate concentration increased by 10 g / L at an inoculum rate of 1% (v / v). The sodium pantothenate concentration is gradually increased to 190 g / L using the above method. The entire evolution process lasts approximately 10 days.

[0072] The evolution medium (g / L) formula is as follows: 10 g / L tryptone, 5 g / L yeast extract, 2 g / L glucose, 100 g / L-190 g / L sodium pantothenate, autoclaved at 115℃ for 15 minutes.

[0073] 5. Retesting and validation of the tolerance of the evolved strains

[0074] After 10 days of continuous evolution, ODs that had been cultured for 12 hours were selected. 600 The evolved strain reached pH 4.0. The culture medium of this evolved strain was diluted and spread onto LB agar plates. After incubation at 37°C upside down overnight, single colonies were picked and their pantothenic acid tolerance was retested.

[0075] 6. Whole-genome sequencing and mutation site identification of evolutionary strains

[0076] Compared to the unevolved wild-type strain *E. coli* MG165, the evolved strain that recovered growth in a medium containing 190 g / L sodium pantothenate was named the *E. coli* MG1655 ALE-PAN mutant and sent to Anshengda Biotechnology Co., Ltd. for whole-genome resequencing. The sequencing results showed that, compared to the wild-type genome, the 578th base of the *ompR* gene in the evolved strain changed from A to C, meaning that the 193rd amino acid of the protein encoded by this gene changed from glutamic acid (GAA) to alanine (GCA).

[0077] 7. Functional verification of mutated genes

[0078] To verify whether this point mutation is the key cause of the pantothenic acid tolerance phenotype, the CRISPR-Cas9 gene editing system containing pCas9 and pTargetF vectors (Jiang, Y., Chen, B., Duan, CL, Sun, BB, Yang, JJ, and Yang, S. (2015) MuLtigene Editing in the Escherichiacoli Genome via the CRISPR-Cas9 System, AppL Environ Microb 81, 2506-2514.) was used to mutate position 578 of the ompR gene from A to C in the wild-type strain E. coli MG1655.

[0079] Using the NEB Q5® Site-Directed Mutagenesis Kit (catalog number E0552S), primers B219 and B220 were designed to mutate the pTargetF vector according to the kit instructions. The N20 mutation sequence in the pTargetF vector is TTGCGGAATATTCACGACCA. The original sequence of the ompR gene with the targeted point mutation is shown in SEQ ID NO:1 below. The mutated pTargetF was named pTargetF-ompR.

[0080] To introduce the ompR (A578C) point mutation, this application constructs an editing template containing homologous arms and the expected mutation. The specific steps are as follows:

[0081] Using genomic DNA from *E. coli* MG1655 as a template, primer pairs B128 and B221 were used to amplify the upstream homologous arm sequence of the target gene ompR site, and primer pairs B222 and B129 were used to amplify the downstream homologous arm sequence of the target gene ompR site, thus obtaining the upstream and downstream homologous arm fragments of the target gene site. The PCR product size was checked using 1% agarose gel electrophoresis, and the PCR products were recovered and purified. Using the purified upstream and downstream homologous arm fragments as templates, the two fragments were ligated via overlap PCR using primer pairs B128 and B129, resulting in the combined DNA fragment Donor-ompR. mut As a template for gene editing, the ompR gene undergoes a mutation at position 578, from A to C, resulting in a codon change from GAA (Glu) to GCA (Ala). Position 567 is also mutated from C to G, with no change in amino acids. The purpose of this mutation is to change CGG downstream of N20 to CGC to improve editing efficiency. Donor-ompR mut The sequence is shown in SEQ ID NO:2.

[0082] Based on the template constructed above, the target mutation is introduced into the wild-type strain through the following steps:

[0083] The pCas9 plasmid was transformed into *E. coli* MG1655 and plated onto agar plates containing 50 mg / L kanamycin. After overnight incubation at 30°C, the strain constitutively expressing Cas9 protein, *E. coli* MG1655 / pCas9, was selected for screening. *E. coli* MG1655 / pCas9 bacterial colonies were picked and inoculated into 50 mL shake flasks containing 50 mg / L kanamycin in LB medium. The culture was incubated with shaking at 30°C and 220 rpm. When the OD of the medium reached a certain level... 600 When the OD value was 0.2, L-arabinose was added to a final concentration of 10 mM to induce Cas9 protein expression. 600 Bacterial cells were collected and competent cells were prepared at a concentration of 0.45. Then, 2 μL of pTargetF-ompR plasmid (expressing sgRNA targeting ompR) and 10 μL of Donor-ompR were added. mut Template DNA was electroporated into the above-mentioned E.coli MG1655 / pCas9 competent cells. The transformed bacterial culture was plated on double-antibiotic plates containing 50 mg / L kanamycin and 50 mg / L spectinomycin and cultured at 30°C to screen for positive clones.

[0084] Then, colony PCR was performed using primers B223 (SEQ ID NO:9) and B224 (SEQ ID NO:10) to identify single colonies. Sequencing verified the correct PCR product size, and strains exhibiting homologous recombination and carrying the ompR (A578C) point mutation were screened. The selected single colonies with correctly sequenced ompR point mutations were inoculated into LB medium. Isopropyl-β-D-thiogalactopyranoside (IPTG) at a final concentration of 0.2 mM was added to induce the pTargetF-ompR plasmid to cleave itself via its self-expressed sgRNA under IPTG induction, thereby eliminating the pTargetF-ompR plasmid in the host and obtaining the recombinant strain *E. coli* MG1655ompR. mut For I / pCas, competent cells are prepared according to the aforementioned method for later use.

[0085] Recombinant E. coli MG1655ompR mut I / pCas was inoculated into antibiotic-free LB broth and cultured at 37°C with shaking for 12 hours. The bacterial culture was then diluted and plated onto LB agar plates to obtain recombinant E. coli MG1655ompR with pCas plasmid eliminated. A578C (-Strain E.coli MG1655ompR mut The primers used in this embodiment are shown in Table 1.

[0086] Table 1 Primer Information

[0087]

[0088] To verify whether the introduced gene mutation was sufficient to induce tolerance to high concentrations of pantothenic acid in the strain, the engineered strain *E. coli* MG1655ompR was subjected to [a specific treatment / test] in the aforementioned evolutionary medium containing 190 g / L sodium pantothenate. A578C Parallel growth comparison experiments were conducted with the adaptively evolved strain ALE-PAN to verify the engineered strain E. coli MG1655ompR. A578C The results showed that the engineered strain E. coli MG1655ompR... mut OD cultured for 12 hours 600 Reaching 4.0, comparable to the evolved strain E. coli MG1655 ALE-PAN, this result indicates that the ompR A578C Gene mutations are key to enabling E. coli to acquire pantothenic acid tolerance.

[0089] Example 3

[0090] Construction of engineered strains for vitamin B5 production via fermentation

[0091] 1. Constructing the recombinant plasmid pACYC184-panBCE

[0092] (1) Construction of recombinant plasmid pACYC184-panBC

[0093] Using P1 (SEQ ID NO: 11) and P2 (SEQ ID NO: 12) as primers, and genomic DNA of wild-type Escherichia coli strain K12 MG1655 as a template, a high-fidelity polymerase KAPA HiFi was used. TM HotStar was used for PCR amplification to obtain the nucleotide sequence P shown in SEQ ID NO: 13. trc The fragment was designed to contain a panBC gene, with 10-41 nt being the promoter trc, 74-868 nt being the coding sequence of the panB gene, and 880-1731 nt being the coding sequence of the panC gene. A strong promoter trc was introduced into primer P1, and BamHI and SphI restriction endonuclease sites were designed at the 5' ends of primers P1 and P2, respectively, for subsequent cloning operations. The PCR program was as follows: 98℃ denaturation for 30 seconds, 65℃ annealing for 15 seconds, and 72℃ extension for 90 seconds, for a total of 26 cycles. The result was verified by agarose gel electrophoresis, yielding a P gene of approximately 1800 bp. trc -panBC gene fragment.

[0094] P1: 5'- CGC GGATCC CAATTAATCATCCGGCTCGTATAATGTGTGGA GCACAACATCAATTTATCAGGA

[0095] (As shown in SEQ ID NO: 11, the underlined sequence is the BamHI restriction site, and the italicized sequence is the trc sequence of the promoter.)

[0096] P2: 5'- ACAT GCATGC CCTGTGTTAT GACAGATGAC -3'

[0097] (As shown in SEQ ID NO: 12, the underlined sequence is the SphI restriction site.)

[0098] P obtained from PCR amplification trc -panBC products were identified and recovered by agarose gel electrophoresis, and then P was digested with BamHI and SphI. trc-panBC product and pACYC184 plasmid. The double-digested Ptrc-panBC fragment and linearized pACYC184 plasmid were recovered by agarose gel electrophoresis, ligated using T4 DNA ligase, and the ligation product was chemically transformed into E. coli EC135 competent cells (for specific experimental methods, see: Zhang et al. Plos Genetics. 2012, 8(9): e1002987). After the transformed cells were added to SOC culture and recovered at 37°C for 1 hour, they were plated on LB agar plates containing 34 mg / ml chloramphenicol. After the plated plates were incubated at 37°C for 12 hours, single colonies were picked, passaged, and expanded. The recombinant plasmid was extracted and sequenced for verification. The correct recombinant plasmid pACYC184-panBC was obtained by sequence alignment.

[0099] (2) Construction of recombinant plasmid pACYC184-panBCE

[0100] Using genomic DNA from *Escherichia coli* K12 MG1655 as a template, and primers P3 (SEQ ID NO: 14) and P4 (SEQ ID NO: 15) as primers, the PJ23119-panE sequence shown in SEQ ID NO: 16 was amplified by PCR. The sequence consists of the PJ23119 promoter (11nt-45nt), the coding sequence of the panE gene (66nt-977nt), and the terminator sequence (988nt-1731nt). The PJ23119 promoter sequence was introduced into primer P3, and the L3S2P56 terminator sequence was introduced into primer P4. SphI and BsaBI restriction endonuclease recognition sites were introduced into the 5' ends of primers P3 and P4, respectively. Using the PCR reaction conditions described in (1) above, the PJ23119-panE product was amplified. After identification and recovery by gel electrophoresis, the PJ23119-panE product and the pACYC184-panBC plasmid were digested with SphI and BsaBI. The double-digested PJ23119-panE fragment and the linearized pACYC184-panBC plasmid were recovered by gel electrophoresis, ligated with T4 DNA ligase, and the ligation product was chemically transformed into E. coli DH5α competent cells. The transformed cells were added to SOC culture and recovered at 37°C for 1 hour, then plated on LB plates containing 34 mg / ml chloramphenicol. After the plated plates were placed in a 37°C incubator for 12 hours, single colonies were picked, passaged, and expanded. The recombinant plasmid was extracted and sequenced for verification. The correct recombinant plasmid pACYC184-panBCE was obtained after sequence alignment. The plasmid contains the genes panB, panC, and panE related to the vitamin B5 terminal synthesis pathway, thus obtaining a recombinant plasmid that overexpresses the vitamin B5 terminal synthesis pathway genes.

[0101] P3: 5'- ACAT GCATGC TTGACAGCTAGCTCAGTCCTAGGTATAATGCTAGC GTTGCGGGTGAGGAGGAACA

[0102] (As shown in SEQ ID NO: 14, the underlined sequence is the SphI restriction site, and the italicized sequence is the sequence of promoter J23119.)

[0103] P4: 5'- CTC GATTTAGATC CCAAAACGAA AAAAGACGCGCTTTTCAGC GTCTTTTTTC GAAAATT AGT CTCTTCACTA CCAGG

[0104] (As shown in SEQ ID NO: 15, the underlined sequence is the BsaBI restriction site, and the italicized sequence is the L3S2P56 terminator sequence.)

[0105] 2. Construct E. coli MG1655 avtA:panDBl-ilvG + M engineered strain

[0106] We used the previously reported CRISPR-Cas9 gene editing system, which includes pCas9 and pTargetF vectors, to edit the avtA gene site in the genome of *Escherichia coli* MG1655. (For details, see: Jiang, Y., Chen, B., Duan, CL, Sun, BB, Yang, JJ, and Yang, S. (2015) Multigene Editing in the *Escherichia coli* Genome via the CRISPR-Cas9 System, *Appl EnvironMicrob* 81, 2506-2514.)

[0107] (1) Construction of plasmid pET28a-BCD2-panDBl

[0108] First, using the NEB Q5® Site-Directed Mutagenesis Kit (catalog number E0552S), primers P5 (SEQ ID NO: 17) and P6 (SEQ ID NO: 18) were designed according to the kit instructions to mutate the pTargetF vector, changing the original N20 recognition sequence to a sequence targeting the avtA gene (SEQ ID NO: 29) CTTTCCAAGC TGGGTCTACC (SEQ ID NO: 30). The PCR reaction system and procedure were set according to the kit instructions. After amplification, the template plasmid was digested with DpnI enzyme, and the PCR product was transformed into *E. coli* DH5α competent cells and plated on LB agar plates containing kanamycin (50 mg / mL). Positive clones were screened, and plasmids were extracted. After sequence verification, the mutated recombinant plasmid was named pTargetFavtA.

[0109] P5: TGGGTCTACCG TTTTAGAGCT AGAAATAGC (as shown in SEQ ID NO: 17);

[0110] P6: GCTTGGAAAG GACTAGTATT ATACCTAGG (as shown in SEQ ID NO: 18);

[0111] P7:CG GACTGGAAGA AGATCTG (as shown in SEQ ID NO: 19);

[0112] P8:TTTCTTAGAC GTCGGAATTG AGACTCATGC ACAGCACGA (as shown in SEQ ID NO: 20);

[0113] P9:TCGTGCTGT GCATGAGT CT CAATTCCGACGTCTAAGAAAC (as shown in SEQ ID NO: 21);

[0114] P10:GATCTCCTTT TTAAGTGAAC TTGGGGTCAG TGCGTCCTGC TGAT (as shown in SEQ ID NO: 22);

[0115] P11:ATCAGCAGGACGCACTGACCCCAAGTTCACTTAAAAAGGAGATC (as shown in SEQ ID NO: 23);

[0116] P12:TGCCGTTCAT ATTGGTGATG CAAAAAACCC CTCAAGACC (as shown in SEQ ID NO: 24);

[0117] P13:GGTCTTGAGGGGTTTTTTGCATC ACCAATATGAACGGCA (as shown in SEQ ID NO: 25);

[0118] P14:GCTGATAGAG CTGCTTGGT (as shown in SEQ ID NO: 26);

[0119] P15: GGAGCTACTC ACACTGCTTG (as shown in SEQ ID NO: 27);

[0120] P16: CGCATACATT GATGCGTATG (as shown in SEQ ID NO: 28).

[0121] To achieve efficient expression of the aspartate α-decarboxylase gene from *Bacillus licheniformis* in *Escherichia coli*, the aspartate α-decarboxylase gene *panD* (as shown in SEQ ID NO: 31) from *Bacillus licheniformis* was synthesized by Suzhou Genewise Biotechnology Co., Ltd. During the custom synthesis of the *panD* gene sequence, synonymous codon substitution was used to remove the XbaI and HindIII restriction endonuclease sequences to avoid restriction enzyme interference in subsequent cloning operations. To enhance the translation efficiency of this gene, a ribosome binding site sequence BCD2 (as shown in SEQ ID NO: 32) was synthesized simultaneously before the *panD* sequence, and XbaI and HindIII restriction enzyme sites were introduced at both ends of the BCD2-panD sequence. The synthesized sequence was ligated into a vector. The synthesized BCD2-panD vector and pET28a(+) plasmid were digested with restriction endonucleases XbaI and HindIII. Gel electrophoresis was used to recover the digested BCD2-panD gene fragment and the linearized pET28a(+) vector fragment. These two fragments were then ligated using T4 DNA ligase. The ligation product was transformed into *E. coli* DH5α competent cells and screened on LB agar plates containing 50 mg / L kanamycin to obtain transformants containing the recombinant plasmid. Single transformants were picked and inoculated into LB liquid medium containing kanamycin for expansion culture. The plasmid was then extracted and sequenced to verify the correct plasmid pET28a-BCD2-panDBl.

[0122] (2) Constructing the gene-editing donor DNA fragment DonorBl

[0123] To construct homologous recombination donor DNA for editing the avtA gene site using the CRISPR-Cas9 system, four functional fragments were amplified and assembled using overlap extension PCR. The specific steps are as follows:

[0124] The upstream homologous arm sequence of the avtA gene of MG1655 was amplified using primers P7 (SEQ ID NO: 19) and P8 (SEQ ID NO: 20). The PL promoter sequence synthesized by gene synthesis was amplified using primers P9 (SEQ ID NO: 21) and P10 (SEQ ID NO: 22). The BCD2-panDBl-Ter gene fragment (containing the ribosome binding site BCD2, the coding region of the panD gene derived from Bacillus licheniformis, and the terminator sequence) was amplified using primers P11 (SEQ ID NO: 23) and P12 (SEQ ID NO: 24) as a template. The downstream homologous arm sequence of the avtA gene of MG1655 was amplified using primers P13 (SEQ ID NO: 25) and P14 (SEQ ID NO: 26) as a template. The four fragments were ligated in a predetermined order using overlap PCR to obtain the combined DNA fragment DonorBl (as shown in SEQ ID NO: 33), which serves as a template for gene editing. The template's structure is as follows: 1nt-312nt of SEQ ID NO: 5 represents the upstream homologous arm sequence of the target gene avtA; 401nt-474nt represents the PL promoter; 475nt-555nt represents the BCD2 sequence; 556nt-939nt represents the panDBl sequence; 944nt-991nt represents the Ter terminator sequence; and 992-1257nt represents the downstream homologous arm sequence of the avtA gene. During CRISPR-Cas9-mediated genome editing, this template DonorBl serves as a homologous recombination repair template, enabling the integration of the PL-BCD2-panDBl-Ter expression cassette at specific sites in the genome while simultaneously inactivating the avtA gene.

[0125] (3) Construction of engineered strain E. coli MG1655 avtA:panDBl / pCas

[0126] The pCas9 plasmid was transformed into E. coli MG1655 competent cells and plated onto LB agar plates containing 50 mg / L kanamycin. The cells were incubated at 30°C for 12 hours to obtain the recombinant strain MG1655 / pCas9. MG1655 / pCas9 bacterial colonies were picked and placed in 500 mL shake flasks containing 50 mL of LB medium with 50 mg / mL kanamycin. The culture was incubated at 30°C with shaking at 220 rpm. When the culture medium OD... 600 L-arabinose was added to a final concentration of 10 mM at an OD value of 0.2 to induce Cas9 protein expression. 600 Bacterial cells were collected at 0.45°C to prepare competent cells. 2 µL of pTargetFavtA plasmid (sgRNA expression vector targeting the avtA gene) and 10 µL LDonorBl template DNA were mixed and electroporated into MG1655 / pCas9 competent cells. After thawing, the cells were plated on double-antibiotic plates containing 50 mg / L kanamycin and 50 mg / L spectinomycin and incubated at 30°C for 24 hours.

[0127] Single colonies of the PL-BCD2-panDBl-Ter expression cassette integrated into the avtA gene using primer pairs P15 (SEQ ID NO: 27) and P16 (SEQ ID NO: 28) were validated by colony PCR. Sequencing confirmed the correct PCR product size. Positive clones with correct sequencing were selected and inoculated into LB medium containing 0.2 mM IPTG. The culture was carried out at 30°C for 12 hours to induce the elimination of the pTargetFavtA plasmid, yielding the engineered E. coli MG1655 avtA:panDBl / pCas. Competent cells were then prepared using the same method as described above for later use.

[0128] (4) Obtain the engineered strain E. coli MG1655 ΔavtA::panDBl and the integrated ilvG + M gene

[0129] The engineered strain *E. coli* MG1655 avtA:panDBl / pCas was inoculated into antibiotic-free LB broth and cultured at 37°C with shaking for 12 hours. The culture was then diluted and plated onto LB agar plates and incubated at 37°C for 16 hours. Single colonies were randomly selected and inoculated onto LB agar plates containing kanamycin (50 mg / L) and those without antibiotics for verification. Colony PCR was performed on colonies that grew only on antibiotic-free plates and not on kanamycin-containing plates to obtain the engineered strain *E. coli* MG1655ΔavtA:panDBl with pCas plasmid eliminated. Since avtA encodes alanine-valine transaminase, a key enzyme in the valine synthesis pathway, the insertion of the *panD* gene into the coding sequence of the chromosomal avtA gene inactivates avtA, effectively weakening the valine-competitive metabolic pathway that competes with vitamin B5 synthesis, thus encouraging a greater metabolic flux towards vitamin B5 synthesis.

[0130] (5) Construct ilvG + M gene integration system

[0131] Due to a mutation in the ilvG gene of wild-type *E. coli* K12 MG1655, the encoded acetolactate synthase is inactive. To enhance the synthesis of acetolactate, a vitamin B5 precursor, this application introduces the active ilvG gene from *E. coli* BL21 into the genome of *E. coli* MG1655. + The M gene enhances the synthesis of acetolactate, a precursor of VB5. This application involves the insertion of ilvG, derived from E. coli BL21, into the chromosome of E. coli K12 MG1655. + The M gene is regulated by a strong trc promoter, and ilvG is regulated by it. + M transcription initiation, regulated by the terminator Ter, ilvG + M transcription terminates. ilvG + The M gene integrates into another N20 target sequence of the avtA gene, TGTAACTACGACGGTCCACA. Using the Q5® mutation kit described above, the pTargetF vector was mutated with primers P17 (SEQ ID NO: 34) and P18 (SEQ ID NO: 35). The mutated pTargetF was named pTargetFavtA1 and was used to guide the Cas9 protein to cleave at a specific site at the avtA gene locus.

[0132] P17: ACGGTCCACAGTTTTAGAGCTAGAAATAGC (as shown in SEQ ID NO: 34);

[0133] P18: CGTAGTTACAGACTAGTATTATACCTAGG (as shown in SEQ ID NO: 35);

[0134] P19: GGCAGAAAATCAGCCAGTTC (as shown in SEQ ID NO: 36);

[0135] P20:TCCACACATTACGAGCCGGATGATTAATTGTCAAGAACTCTGTAGCAAGGAAGG (as shown in SEQ IDNO: 37);

[0136] P21:TTGACAATTAATCATCCGGCTCGTATAATGTGTGGACAAGATTCAGGACGGGGAAC (as shown in SEQ ID NO: 38);

[0137] P22:CGAAAAAAGACGCTCTAAAAGCGTCTCTTTTCTGGTATATTCCTTTTGCGCTCAG (as shown in SEQ ID NO: 39);

[0138] P23:CAGAAAAGAGACGCT TTTAG AGCGTCTTTTTTCGTTTTGGAGCTACTCACACTGCTTG (as shown in SEQ ID NO: 40);

[0139] P24:GCCAATATGCAGATGCTCA (as shown in SEQ ID NO: 41);

[0140] P25: CACGTTCGGATATGAACTG (As shown in SEQ ID NO: 42);

[0141] P26:CGTCAAGCTTCAGCAACTC (as shown in SEQ ID NO: 43).

[0142] (6) Constructing and integrating ilvG + DonorilvG, a combination of M genes + M

[0143] ilvG is integrated into the avtA locus on chromosome MG1655 of Escherichia coli. + The M gene was used to construct homologous recombination donor DNA using overlap PCR technology. The specific steps are as follows:

[0144] Using MG1655 genomic DNA as a template, the upstream homologous arm sequence of the avtA gene of MG1655 was amplified using primers P19 (SEQ ID NO: 36) and P20 (SEQ ID NO: 37). Using E. coli BL21 genomic DNA as a template, the ilvG gene of E. coli BL21 was amplified using primers P21 (SEQ ID NO: 38) and P22 (SEQ ID NO: 39). + M coding sequence. Using MG1655 genomic DNA as a template, the downstream homologous arm sequence of the avtA gene of MG1655 was amplified using primers P23 (SEQ ID NO: 40) and P24 (SEQ ID NO: 41).

[0145] Using primers P20 and P21 in ilvG + The trc promoter TTGA CAATTAATCATCCGGCTCGTATAATGTGTGGA (SEQ ID NO: 44) was introduced at the 5' end of the M gene, and then activated via primers P22 and P23 in ilvG + The terminator sequence CCAGAAAAGAGACGCT is introduced at the 3' end of the M gene. TTTAG AGCGTCTTTTTTCGTTTT. The above three fragments were ligated using overlap PCR to obtain the combinatorial DonorilvG. + M (as shown in SEQ ID NO: 45) serves as a template for gene editing. This combinatorial entity, DonorilvG... + The full-length sequence structure of M is as follows: SEQ ID NO: 45, 1-305nt is the upstream sequence of the target gene avtA, 306nt-341nt is the trc promoter, and 367nt-2013nt is the ilvG derived from E. coli BL21. + The coding sequence of the gene is as follows: 2010nt-2273nt is the coding sequence of the ilvM gene, 2274-2328 is the terminator sequence, and 2329-2629 is the downstream sequence of the avtA gene. This ensemble is DonorilvG. + M can be used in combination with plasmid pTargetFavtA1 to achieve integration of ilvG driven by the trc promoter at the avtA locus via CRISPR-Cas9 system-mediated homologous recombination repair. + The M gene expression cassette restores acetylhydroxy acid synthase activity and enhances the ability to synthesize acetyllactic acid.

[0146] (7) To enhance the acetolactate synthesis pathway, this application uses CRISPR / Cas9-mediated homologous recombination technology to specifically integrate ilvG at the avtA gene locus in the E. coli MG1655 genome.+ M expression box. The specific experimental steps are as follows:

[0147] Take 2 µL of pTargetFavtA1 plasmid (which carries an sgRNA expression cassette targeting the avtA gene) and 10 µL of DonorilvG. + M template DNA (which contains Ptrc-ilvG) + After mixing with the M-Ter expression cassette and its two homologous arms, the mixture was electroporated into E. coli MG1655 avtA:panDBl / pCas competent cells (which contain Ptrc-ilvG). + M-Ter expression cassette and its two homologous arms were used to screen competent cells on LB agar plates containing 50 mg / L kanamycin and 50 mg / L spectinomycin. The cells were incubated upside down at 30°C for 12 hours to identify transformants containing both plasmids and undergoing homologous recombination. Colony PCR amplification was then performed using primers P25 and P26, located outside the homologous arms of the avtA gene in the genome, to identify the integration of Ptrc-ilvG into the avtA gene. + Single colonies of M-Ter were sequenced to verify the correct PCR product size. From the sequenced clones, single colonies with correct sequencing were selected and inoculated into antibiotic-free LB broth containing 0.2 mM IPTG. The culture was incubated at 30°C with shaking. IPTG-induced expression activated the sgRNA on the pTargetF plasmid, which then cleaved itself to eliminate the pTargetFavtA1 plasmid. The pTargetF-eliminated bacterial culture was further inoculated into antibiotic-free LB broth and incubated at 37°C for 12 hours. The culture was then diluted and plated on LB agar plates. Utilizing the unstable replication of the pCas plasmid at 37°C, high-temperature culture and non-selective stress induced plasmid loss, ultimately yielding the engineered strain *E. coli* MG1655 avtA:panDBl-ilvG with the pCas plasmid eliminated. + M. It integrates active ilvG onto the chromosome. + The M gene, which does not contain any exogenous plasmids, relieves the feedback inhibition on the glyoxylate branched chain amino acid pathway and enhances the synthesis of acetolactate, a precursor of VB5.

[0148] 3. Engineered strain E. coli MG1655 avtA:panDBl-ilvG + MompR A578C Construction

[0149] The pTargetF-ompR vector constructed in Example 2 and the Donor-ompR homologous recombination template containing the A578C point mutation were combined. mutThe common electroconversion to E. coli MG1655 avtA:panDBl-ilvG containing pCas plasmid + M / pCas competent cells were processed using the same screening and identification steps as described above. The transformed cells were then plated on LB agar plates containing both kanamycin and spectinomycin for selection. Colony PCR and sequencing were used to identify single colonies with the A578C point mutation introduced at the ompR gene locus. Subsequently, IPTG induction and high-temperature subculturing were performed to sequentially eliminate pTargetF and pCas plasmids, ultimately yielding the engineered strain *E. coli* MG1655 avtA:panDBl-ilvG. + M ompR A578C .

[0150] To provide a complete vitamin B5 biosynthetic pathway, the plasmid vector pACYC184-panBCE containing the panB, panC, and panE genes was electroporated into the engineered strain E. coli MG1655 avtA:panDBl-ilvG. + M and E. coli MG1655 avtA:panDBl-ilvG + M ompR A578C In the process, engineered strains E. coli MG1655 avtA:panDBl-ilvG were obtained. + M / pACYC184-panBCE and E. coli MG1655 avtA:panDBl-ilvG + MompR A578C / pACYC184-panBCE is used for the fermentation production of VB5.

[0151] In summary, this embodiment integrates ilvG, which relieves feedback inhibition, into the genome. + The M gene enhances the supply of the precursor acetolactate. Then, the ompR and A578C mutations are introduced to improve cell membrane permeability. Finally, the complete synthetic pathway from precursor to vitamin B5 is provided by introducing the panBCE plasmid.

[0152] Example 4

[0153] Fermentation test of VB5 engineered bacteria

[0154] The engineered strain E. coli MG1655 avtA:panDBl-ilvG prepared in Example 3 was used. + M / pACYC184-panBCE and E. coli MG1655 avtA:panDBl-ilvG+ M ompR A578C / pACYC184-panBCE was streaked onto solid LB agar plates containing 34 mg / L chloramphenicol and incubated statically at 37°C for 12 hours. Bacterial growth from the plates was picked and inoculated into LB slant agar, and incubated statically at 37°C for 10-12 hours. Bacterial growth from the slant was then picked and inoculated into liquid LB agar containing 34 mg / L chloramphenicol, and incubated with shaking at 37°C and 220 rpm for 12 hours to obtain the fermentation seed culture. This seed culture was inoculated into fermentation medium at a rate of 3% (v / v) and incubated with shaking at 37°C and 220 rpm. Three parallel experiments were performed for each engineered strain to ensure data reliability.

[0155] The fermentation medium formula is as follows: MOPS 80 g / L, glucose 20.0 g / L, ammonium sulfate 10.0 g / L, potassium dihydrogen phosphate 2.0 g / L, magnesium sulfate heptahydrate 2.0 g / L, yeast extract 5.0 g / L, trace element mixture 5 mL / L, and the remainder is water. Trace element mixture: FeSO4·7H2O 10 g / L, CaCl2 1.35 g / L, ZnSO4·7H2O 2.25 g / L, MnSO4·4H2O 0.5 g / L, CuSO4·5H2O 1 g / L, (NH4)6Mo7O 24 ·4H2O 0.106 g / L, Na2B4O7·10H2O 0.23 g / L, CoCl2·6H2O 0.48 g / L, 35% HCl 10 mL / L, balance is water.

[0156] During the cultivation process, samples were taken every 4 hours, and the pH of the fermentation system was adjusted with ammonia to maintain it at 6.8-7.0. The glucose concentration in the fermentation broth was dynamically monitored using an SBA-40D biosensor analyzer. When the glucose concentration fell below 5 g / L, glucose was added to bring the concentration to 20 g / L, ensuring a sufficient carbon source for cell growth and product synthesis. After 36 hours of fermentation, the final sample was collected, centrifuged at 12000g for 2 minutes, and the supernatant was collected. The VB5 content in the supernatant was quantitatively analyzed using the high-performance liquid chromatography method described in Example 1, and the VB5 expression results were detected (as shown in Table 2 below).

[0157] Table 2

[0158]

[0159] The fermentation results above show that both modified engineered strains can effectively synthesize VB5. Among them, the *E. coli* strain that produces VB5 through fermentation contains the mutant ompR... A578CThis makes VB5 production comparable to E. coli MG1655avtA:panDBl-ilvG + M / pACYC184-panBCE increased by 53.6%. The engineered strain E. coli MG1655 avtA:panDBl-ilvG + M ompR A578C The VB5 production of pACYC184-panBCE was significantly higher than that of the engineered strain E. coli MG1655avtA:panDBl-ilvG. + M / pACYC184-panBCE. This result demonstrates that, based on enhanced precursor supply, mutation of the membrane protein regulator OmpR further promotes VB5 synthesis by improving cell membrane permeability, ultimately achieving a significant increase in yield.

[0160] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Application of the ompR gene mutant in the preparation of engineered bacteria for the production of vitamin B5, wherein the ompR gene mutant is formed by changing the 578th base of the nucleotide sequence of the ompR gene as shown in SEQ ID NO.1 in the sequence listing from A to C.

2. An engineered strain, characterized in that, Compared with the original strain, the engineered strain has the following characteristics: Insert an ompR gene mutant, wherein the ompR gene mutant is formed by changing the 578th base of the nucleotide sequence of the ompR gene as shown in SEQ ID NO.1 of the sequence listing from A to C; and The ilvG+M gene, derived from Escherichia coli BL21, is expressed. and The L-aspartate α-decarboxylase gene panD, derived from Bacillus licheniformis, is expressed. and It possesses 1-20 copies of the panB, panC, and panE genes; The starting strain was Escherichia coli K12 MG1655.

3. The application of the engineered strain according to claim 2 in the production of vitamin B5.

4. A method for constructing an engineered strain for producing vitamin B5, characterized in that, Includes the following steps: Provide a host strain of Escherichia coli; The 578th base of the ompR gene sequence in the host bacterium genome was mutated from A to C; The host strain of Escherichia coli is Escherichia coli K12 MG1655.

5. The method according to claim 4, characterized in that, Includes the following steps: The ilvG+M gene derived from Escherichia coli BL21 was introduced into the engineered strain. and The L-aspartate α-decarboxylase gene panD, derived from Bacillus licheniformis, is expressed. and Increase the copy number of the panB, panC, and / or panE genes.

Images