Application of TaDUF protein and its encoding gene in promoting wheat regeneration and genetic transformation

Abstract

This invention discloses the application of a TaDUF protein and its encoding gene in promoting wheat regeneration and genetic transformation, belonging to the field of plant genetic engineering technology. The amino acid sequence of the TaDUF protein of this invention is shown in SEQ ID NO.2. TaDUF The nucleotide sequence of the encoding gene is shown in SEQ ID NO.1; this invention is the first to discover that overexpression in wheat immature embryo explants... TaDUF Encoding genes can improve the regeneration efficiency of wheat embryos, thereby promoting the genetic transformation process of wheat and providing new regeneration gene resources for wheat genetic breeding, which is of great significance for promoting the genetic improvement of wheat.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, specifically to the application of a TaDUF protein and its encoding gene in promoting wheat regeneration and genetic transformation. Background Technology

[0002] wheat( Triticum aestivum Wheat (L.) is the most widely cultivated staple food crop globally, and its high and stable yields are directly related to food security and agricultural development. Currently, conventional breeding has reached a bottleneck, with a scarcity of wheat varieties possessing high yield, high quality, and multiple resistance characteristics. Coupled with global population growth and the impact of extreme weather, concerns about food security are intensifying. The optimization of transgenic technology and the application of gene editing tools have provided efficient pathways for wheat gene function research and trait improvement, while smart breeding integrating artificial intelligence and big data has become an important direction for trait improvement. However, as an allohexaploid, wheat not only exhibits complex genetic variations, but its efficient tissue culture regeneration system, upon which genetic transformation depends, is affected by multiple factors such as culture medium, genotype, and explants. In actual breeding work, most major wheat varieties (lines) are limited by their own genetic background, resulting in generally low tissue culture regeneration capabilities, specifically manifested in low callus induction rates, weak differentiation abilities, and insufficient seedling rates. This deficiency directly leads to low genetic transformation efficiency, severely restricting the widespread application of transgenic and gene editing technologies in wheat breeding, ultimately becoming a core bottleneck limiting the rapid development of wheat bio-breeding.

[0003] Existing research has shown that GRF4 - GIF1 (Debernardi) et al ., 2020;Qiu et al (2022) TaWOX5 (Wang) et al (2022) TaDOF3.4 and TaDOF5.6 (Liu) et al (., 2022) and TaLAX1 (Yu) et al Introducing genes such as those from wheat varieties (e.g., 2024) into different wheat varieties can significantly improve transformation efficiency, indicating that regeneration-related genes can effectively overcome the genotype dependence of wheat genetic transformation. However, the number of regeneration genes isolated so far is limited. Therefore, discovering new genes that can improve wheat regeneration and transformation efficiency is of great significance for breaking through breeding bottlenecks and promoting the application of biotechnology.

[0004] The DUF family (Domain of Unknown Function) may be involved in plant growth and development processes such as cell wall formation, organ development, and regulation of chlorophyll and pollen fertility. Studies have found that the Arabidopsis thaliana DUF579 transcription factor affects the integrity of xylan, a component of the hemicellulose cell wall (Henry). et al ., 2019). Rice DUF640 controls seed shape and size by regulating cell division processes and influencing the development of floral organs such as carpels or ovules (Yan et al., 2013). In terms of stress response, DUF family genes play an important role in plant resistance to pathogens and pests, particularly in rice. OsDUF500 Gene silencing can enhance rice's resistance to bacterial blight (Li et al., 2012). However, the function of wheat DUF family proteins in promoting regeneration and genetic transformation efficiency has not yet been reported. Summary of the Invention

[0005] In view of the above-mentioned prior art, the purpose of this invention is to provide an application of TaDUF protein and its encoding gene in promoting wheat regeneration and genetic transformation. This invention discovers a novel gene in the wheat genome involved in regulating the wheat regeneration process. TaDUF Encoding genes, overexpression TaDUF The encoding gene can improve the regeneration efficiency of wheat immature embryo explants and promote the genetic transformation process of wheat.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] A first aspect of the present invention provides TaDUF Application of encoding genes in promoting wheat regeneration and genetic transformation; TaDUF The gene encoding a DNA molecule is shown in either i) or ii) below:

[0008] i) The nucleotide sequence is the DNA molecule shown in SEQ ID NO.1;

[0009] ii) DNA molecules other than i) encoding the amino acid sequence shown in SEQ ID NO.2.

[0010] In the above applications, promoting wheat regeneration and genetic transformation specifically means increasing the callus differentiation rate and transformation efficiency of wheat immature embryo explants.

[0011] In the above applications, by promoting TaDUF Encoding gene expression to promote wheat regeneration and genetic transformation.

[0012] Preferred, promoting TaDUF The substance encoding gene expression is any one of the following:

[0013] C1) contains TaDUF Expression cassettes encoding genes;

[0014] C2) contains TaDUF Recombinant vectors encoding genes, or recombinant vectors containing the expression cassette described in C1);

[0015] C3) contains TaDUF Recombinant microorganisms encoding genes, or recombinant microorganisms containing the expression cassette described in C1), or recombinant microorganisms containing the recombinant vector described in C2).

[0016] Existing plant expression vectors can be used to construct structures containing... TaDUF Recombinant vectors encoding genes. These plant expression vectors include, but are not limited to, binary Agrobacterium vectors and vectors suitable for plant microbombardment. The plant expression vectors may also contain the 3' untranslated region of a foreign gene, i.e., containing a polyadenylate signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylate signal can guide the addition of polyadenylate to the 3' end of the mRNA precursor; similar functions exist for the untranslated regions transcribed at the 3' end of genes including, but not limited to, Agrobacterium crown gall-inducing (Ti) plasmid genes (such as the Nos gene for lipase synthesis) and plant genes (such as the soybean storage protein gene).

[0017] In constructing TaDUF When creating a recombinant vector encoding a gene, any type of enhanced or constitutive promoter can be added before the transcription initiation nucleotide, including but not limited to the cauliflower mosaic virus (CAMV) 35S promoter and the ubiquitin promoter of maize. These can be used alone or in combination with other plant promoters.

[0018] In some preferred embodiments of the present invention, promoting TaDUF The method for expressing encoded genes is as follows:

[0019] Will TaDUF The coding gene was ligated into an expression vector to construct a recombinant expression vector. The recombinant expression vector was then transformed into Agrobacterium competent cells to obtain Agrobacterium strains for transformation. The Agrobacterium strains were then used to infect wheat embryos.

[0020] Preferably, the expression vector is the pUbi110 vector; TaDUF The coding gene was ligated into the pUbi110 vector Sma I and Spe Between I sites.

[0021] Preferably, the Agrobacterium competent cells are Agrobacterium tumefaciens EHA105.

[0022] A second aspect of the present invention provides the application of TaDUF protein in promoting wheat regeneration and genetic transformation; said TaDUF protein is a protein as shown in (A1) or (A2) below:

[0023] (A1) A protein consisting of the amino acid sequence shown in SEQ ID NO.2 of the sequence listing;

[0024] (A2) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of the protein defined in (A1).

[0025] In the aforementioned proteins, the protein tag refers to a polypeptide or protein fused with the target protein using in vitro DNA recombination technology for expression, to facilitate the expression, detection, tracing, and / or purification of the target protein. The protein tag may be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.

[0026] This invention has led to the discovery of a novel wheat regeneration-related gene in wheat. TaDUF Encoding genes, through overexpression TaDUF Encoding genes or increasing TaDUF protein activity can effectively improve the regeneration efficiency of wheat embryos, thereby promoting the genetic transformation process of wheat.

[0027] The beneficial effects of this invention are:

[0028] This invention is the first to discover that overexpression in wheat immature embryo explants TaDUF Encoding genes can improve the regeneration efficiency of wheat embryos, thereby promoting the genetic transformation process of wheat and providing new regeneration gene resources for wheat genetic breeding, which is of great significance for promoting the genetic improvement of wheat. Attached Figure Description

[0029] Figure 1 PCR-specific amplification of candidate transgenic plants obtained by transforming the recombinant vector Ubi-TaDUF bar A schematic diagram of the gene results; 1-14 in the figure represent candidate transgenic plants transformed with “Euron”, PC represents positive plasmid, NC represents negative control, and M represents 2000 bp molecular weight marker.

[0030] Figure 2 The callus differentiation rate of young embryos of wheat variety “Euron” infected with recombinant vector Ubi-TaDUF and control vector Ubi-GUS was determined.

[0031] Figure 3 The transformation efficiency of the young embryos of wheat variety “Euron” infected with the recombinant vector Ubi-TaDUF and the control vector Ubi-GUS was determined. Detailed Implementation

[0032] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0033] As mentioned earlier, the efficiency of wheat genetic transformation is directly related to its in vitro regeneration capacity. Wheat, as an allohexaploid, presents significant challenges to genetic transformation due to its large genome and rich repetitive sequences. Low genetic transformation efficiency and genotype dependence are major obstacles to wheat gene editing research and application; callus induction and regeneration capabilities vary greatly among wheat explants of different genotypes. Studies have confirmed that overexpression of key regeneration regulatory genes can effectively enhance wheat's regeneration capacity and genetic transformation efficiency; however, currently reported resources of such functional genes are relatively scarce, thus necessitating further exploration and identification of more key regeneration regulatory genes.

[0034] CFC21_012467 (GenBank: KAF6996073.1) is a hypothetical protein of unknown function in the wheat genome, named TaDUF protein. The gene encoding TaDUF protein... TaDUF The nucleotide sequence of the encoding gene is shown in SEQ ID NO.1; the amino acid sequence of the TaDUF protein is shown in SEQ ID NO.2.

[0035] To study the function of the TaDUF protein, this invention constructed a protein containing... TaDUF A recombinant expression vector encoding the gene was transformed into *Agrobacterium tumefaciens*, and then used to infect wheat immature embryo explants. Results showed that overexpression... TaDUF The encoding gene can improve the regeneration and genetic transformation efficiency of wheat embryos. Therefore, TaDUF The coding gene can serve as a new wheat regeneration gene, hence this invention.

[0036] To enable those skilled in the art to better understand the technical solution of this application, the technical solution of this application will be described in detail below with reference to specific embodiments.

[0037] The experimental materials used in the embodiments of this invention, unless otherwise specified, are all conventional experimental materials in the art and can be purchased through commercial channels. Where specific experimental conditions and methods are not specified in the embodiments of this invention, they are generally performed under conventional conditions, such as those described in J. Sambrook et al., eds., *Molecular Cloning: A Laboratory Manual* (3rd Edition), Science Press, 2002; D.L. Spector et al., eds., *Cellular Laboratory Manual*, Science Press, 2001; or according to the conditions recommended by the manufacturer.

[0038] Example 1: TaDUF and GUS Cloning of the CDS region of a gene and construction of a recombinant vector

[0039] 1. TaDUF Cloning of the CDS region of a gene and construction of a recombinant vector

[0040] Total RNA was extracted from wheat callus using the Ultrapure RNA Kit, and then the extracted RNA was reverse transcribed into cDNA using the HiScript II Q RTSuperMix for qPCR (+gDNA wiper) kit. According to Blast... TaDUF Specific amplification primers were designed based on the coding gene sequence (SEQ ID NO.1), and the sequence was amplified using Phanta high-fidelity enzyme. The amplification primer sequences are as follows:

[0041] TaDUF-F: ATGGATTTCCATGATTGGCA; (SEQ ID NO.3)

[0042] TaDUF-R: TCAAGTACTGAATTTCACACAC. (SEQ ID NO.4)

[0043] The amplified product was ligated into the pUbi110 vector using homologous recombination and then sequenced. For single clones with correct sequencing, plasmids were extracted using the FastPure Plasmid Mini Kit to obtain the recombinant vector Ubi-TaDUF.

[0044] 2. GUS Cloning of the CDS region of a gene and construction of a recombinant vector

[0045] Using nucleotides 15108-16919 of Sequence ID MN266288.1 from the NCBI website (https: / / www.ncbi.nlm.nih.gov / ) as a template, amplification was performed using Phanta high-fidelity enzyme. The primer sequence is as follows:

[0046] GUS-F: ATGTTACGTCCTGTAGAA; (SEQ ID NO.5)

[0047] GUS-R:TCATTGTTTGCCTCCCTG. (SEQ ID NO.6)

[0048] The amplified product was ligated into the pUbi110 vector using homologous recombination and then sequenced. For single clones with correct sequencing, plasmids were extracted using the FastPure Plasmid Mini Kit to obtain the recombinant vector Ubi-GUS.

[0049] Example 2: Agrobacterium-mediated transformation of wheat immature embryos and identification of transgenic plants

[0050] 1. Agrobacterium-mediated transformation of wheat immature embryos:

[0051] The recombinant vector Ubi-TaDUF constructed in Example 1 was transformed into Agrobacterium EHA105 competent cells, and an Agrobacterium strain that could be used for transformation was obtained and named Ubi-TaDUF / EHA105.

[0052] The recombinant vector Ubi-GUS constructed in Example 1 was transformed into Agrobacterium EHA105 competent cells, and an Agrobacterium strain that could be used for transformation was obtained and named Ubi-GUS / EHA105.

[0053] The transformed Agrobacterium strain was used to infect wheat embryos. Detailed steps and methods for the Agrobacterium-mediated infection of wheat embryos are described in the method of Ishida et al. (Ishida...) et al. (2015), details are as follows:

[0054] (1) Three days before infection, Agrobacterium Ubi-TaDUF / EHA105 and Agrobacterium Ubi-GUS / EHA105 were inoculated onto YEP solid medium containing 50 mg / L kanamycin and 50 mg / L rifampicin, respectively, and incubated in the dark at 28°C for 2 days. Single colonies were picked and inoculated into YEP liquid medium containing 50 mg / L kanamycin and 50 mg / L rifampicin, and incubated overnight at 28°C with shaking speed of 220 rpm. The Agrobacterium suspension was transferred into sterile 2 ml centrifuge tubes, centrifuged at 6000 rpm for 5 minutes, the supernatant was discarded, and the precipitate was resuspended with resuspension to obtain Agrobacterium Ubi-TaDUF / EHA105 and Agrobacterium Ubi-GUS / EHA105 resuspensions, respectively.

[0055] (2) Collect the embryos of “Euronor” 14-15 days after pollination, and infect them with Agrobacterium resuspension of Ubi-TaDUF / EHA105 and Ubi-GUS / EHA105 respectively. Spread them flat on WLS-AS medium (1 / 10 MS basic medium, 1 / 10 MS vitamins, glucose 10 g / L, acetylsuccinone 100 μM, agarose 8 g / L) with the scutellaria side up, and incubate in the dark at 23°C for 2 days.

[0056] (3) Transfer the embryos cultured in step (2) to WLS-Res medium (MS basal medium, MS vitamins, 2,4-D 0.5 mg / L, picloram 2.2 mg / L, glutamine 0.5 g / L, casein 0.1 g / L, MgCl2⋅6H2O 0.75 g / L, maltose 40 g / L, AgNO3 0.85 mg / L, vitamin C 100 mg / L, carbenicillin 250 mg / L, agarose 5 g / L) and incubate in the dark at 25°C for 5 days.

[0057] (4) Transfer the callus cultured in step (3) to WLS-P5 medium (WLS-Res medium with PPT 5 mg / L added) and culture in the dark at 25°C for 2 weeks.

[0058] (5) Then transfer the callus cultured in step (4) to WLS-P10 medium (WLS-Res medium with 10 mg / L PPT added) and culture in the dark at 25°C for 3 weeks.

[0059] (6) Transfer the callus tissue cultured in step (5) to LSZ-P5 medium (MS basal medium, MS vitamins, zeatin 5 mg / L, sucrose 20 g / L, carbenicillin 250 mg / L, PPT 5 mg / L, plant gel 3 g / L) and culture in a 25°C incubator under light for 2 weeks.

[0060] (7) The regenerated resistant shoots of wheat were transferred to LSF-P5 medium (MS basal medium, MS vitamins, IBA 0.2 mg / L, sucrose 15 g / L, carbenicillin 250 mg / L, PPT 5 mg / L, plant gel 3 g / L) and cultured in a 25°C incubator under light until the roots of the regenerated shoots were about 1-2 cm long.

[0061] (5) Transplant the strong seedlings with long roots into nutrient soil to obtain candidate transgenic seedlings of Ubi-TaDUF and Ubi-GUS respectively.

[0062] 2. PCR detection of candidate transgenic plants:

[0063] Genomic DNA was extracted from wheat plants transformed with Ubi-TaDUF / EHA105 and Ubi-GUS / EHA105 vectors in generation T0 using the CTAB method (Sambrook and Russell, Molecular Cloning: A Laboratory Manual, 2001).

[0064] Using the extracted genomic DNA from candidate transgenic plants as a template, PCR amplification was performed using Taq DNA polymerase (Nanjing Novizan Biotechnology Co., Ltd., catalog number: P222). The primer sequences are as follows:

[0065] bar-F: GGCGGTCTGCACCATCGTCAACCACTAC; (SEQ ID NO.7)

[0066] bar-R: AGTCCAGCTGCCAGAAACCCACGTCATG. (SEQ ID NO.8)

[0067] Detection of glyphosate resistance genes bar Whether it exists or not, if it exists bar The gene was amplified to a fragment length of 446 bp. PCR identification results are as follows. Figure 1 As shown, candidate transgenic plants 1-14 all amplified to a length of 446 bp, and were all positive plants, with the same band length as the positive control; no 446 bp fragment was found in the negative control. Gene fragments.

[0068] 3. Statistical analysis of conversion efficiency of different wheat genotypes:

[0069] 'Euron' wheat embryos were collected 14-15 days after pollination and their number was counted. After infection with Agrobacterium-mediated transformation, callus formation was induced, and the callus was then cultured for differentiation to form resistant seedlings. The number of differentiated callus was counted on LSF-P5 medium. After PCR identification, the number of transgenic positive seedlings was counted, and the callus differentiation rate and transformation efficiency were finally calculated.

[0070] Callus differentiation rate = (number of differentiated callus tissues ÷ total number of immature embryos) × 100%;

[0071] Conversion efficiency = (Number of positive seedlings ÷ Total number of embryos) × 100%.

[0072] Significant genotypic differences exist in wheat genetic transformation efficiency, with different varieties exhibiting marked differences in transformation difficulty. Among them, the 'Euron' genotype is considered to be highly difficult to transform. In this study, 'Euron' immature embryos were used as explants, and Agrobacterium-mediated transformation was employed to transform the control vector Ubi-GUS and the Ubi-TaDUF vector, respectively. The results showed that the callus differentiation rate of the Ubi-TaDUF vector overexpression reached 95.38%, significantly higher than the 56.70% of the control vector Ubi-GUS (Figure 2); in terms of transformation efficiency, the Ubi-TaDUF vector increased to 30.00%, far exceeding the 11.34% of the control vector (Figure 3). These results confirm that overexpression... bar TaDUFThe encoding gene can effectively overcome the transformation limitations of the difficult-to-transform genotype "Euron" and indicates that this gene is a novel functional gene that can enhance the regeneration ability of wheat.

[0073] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. TaDUF Use of an encoding gene in promoting wheat regeneration and genetic transformation, characterized in that, The TaDUF The coding gene is a DNA molecule as shown in i) or ii): i) the nucleotide sequence is a DNA molecule as shown in SEQ ID NO. 1; ii) a DNA molecule other than i) encoding the amino acid sequence as shown in SEQ ID NO. 2; The promoting wheat regeneration and genetic transformation specifically refers to increasing the callus differentiation rate and transformation efficiency of wheat young embryo explants.

2. Use according to claim 1, characterized in that, by promoting TaDUF Promoting wheat regeneration and genetic transformation by promoting coding gene expression.

3. Use according to claim 2, characterized in that, promote TaDUF The substance encoding the expression of the gene is any one of the following: C1) contains TaDUF expression cassette encoding a gene; C2) comprises TaDUF a recombinant vector encoding the gene, or a recombinant vector comprising the expression cassette of C1). C3) a recombinant microorganism comprising TaDUF a recombinant microorganism comprising the expression cassette of C1), or a recombinant microorganism comprising the recombinant vector of C2).

4. Use according to claim 2, characterized in that, facilitate TaDUF Methods for encoding gene expression are: Will TaDUF The coding gene is connected into an expression vector to construct a recombinant expression vector, the recombinant expression vector is transformed into an agrobacterium competent cell to obtain an agrobacterium strain for transformation; and the agrobacterium strain is used to infect a wheat young embryo.

5. Use according to claim 4, characterized in that, The expression vector is pUbi110 vector; TaDUF The coding gene is ligated into pUbi110 vector Sma I and Spe I sites.

6. Use according to claim 4, characterized in that, The Agrobacterium competent cell is Agrobacterium tumefaciens EHA105.

7. Use of a TaDUF protein in promoting wheat regeneration and genetic transformation, characterized in that, The TaDUF protein is the protein as shown in (A1) or (A2) below: (A1) a protein consisting of the amino acid sequence as shown in SEQ ID NO. 2 in the sequence listing; (A2) a fusion protein obtained by connecting a protein tag to the N terminal and / or C terminal of the protein defined in (A1); The promoting wheat regeneration and genetic transformation specifically refers to increasing the callus differentiation rate and transformation efficiency of wheat young embryo explants.

Images