SNP (Single Nucleotide Polymorphism) molecular marker related to growth traits of Bellamya piriformis and application of SNP molecular marker
By screening SNP molecular markers at sites 131,293,660 on chromosome 131,293,660 of *Bellamya pear-shaped snail* using the XGBoost model and GWAS, designing specific primer pairs, and performing PCR amplification and Sanger sequencing, the problem of insufficient growth performance in traditional *Bellamya pear-shaped snail* farming was solved, achieving efficient molecular marker-assisted breeding and improving the level of industrialization.
Patent Information
- Application Number
- CN202511436164.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-09
- Publication Date
- 2025-12-19
- Estimated Expiration
- 2045-10-09
AI Technical Summary
Traditional cultivation of pear-shaped bell snails relies on wild populations, whose growth performance is difficult to meet the needs of industrialization. The lack of efficient molecular marker-assisted breeding methods has led to a slow industrialization process.
Using the XGBoost machine learning model combined with genome-wide association analysis (GWAS), SNP molecular markers located at chromosome 131,293,660 of *Bellamya piriformis* Chr4 were screened, and specific primer pairs were designed. Genotypes were identified by PCR amplification and Sanger sequencing, and individuals with superior growth were screened.
It enabled rapid and accurate genotyping, improved breeding efficiency, significantly enhanced the growth performance of *Bellamya pear-shaped*, and promoted the upgrading of the aquaculture industry and the stability of market supply.
Smart Images

Figure CN121160880A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular marker-assisted breeding technology, and relates to an SNP molecular marker related to the growth traits of *Bellamya pear-shaped* and its application. Background Technology
[0002] Pear-shaped ringed snail (scientific name: Bellamya purificata Commonly known as river snails, field snails, and stone snails, the pear-shaped Bellamya is the largest single-species species in the genus Bellamya. Taxonomically, it belongs to the family Viviparidae and the genus Bellamya, and is widely distributed in eastern and southern China and freshwater basins of Asia. As an aquatic organism with both ecological and economic value, the pear-shaped Bellamya is not only a natural feed ingredient, a traditional Chinese medicine resource, and a key component of freshwater ecosystems, but also a distinctive dietary source due to its high protein and low fat nutritional characteristics. The snail meat is highly favored by consumers for its tender and delicate taste. However, the traditional seasonal fresh consumption model has limitations such as a short supply cycle and low added value. Its farming scale has expanded rapidly, and due to the continuous expansion of market demand, the supply-demand gap in the industry is significant, highlighting the urgency of breeding superior varieties and innovation in large-scale farming technologies.
[0003] *Bellamya pear-shaped* snails have become the preferred species for large-scale snail farming due to their significant advantages such as high yield and rapid growth rate. Currently, the germplasm resources of artificially farmed freshwater snails largely rely on wild populations, and their growth performance is no longer sufficient to meet the demands of industrial production. Therefore, developing efficient and precise molecular markers for growth traits using the XGBoost machine learning model is of crucial significance for promoting the genetic improvement of *Bellamya pear-shaped* snails and upgrading the aquaculture industry.
[0004] In molecular biology and genetics research, single nucleotide polymorphism (SNP) markers have become a core tool for elucidating biological genetic mechanisms. As the most prevalent form of variation in the genome, SNPs are typically caused by the substitution of a single nucleotide and are characterized by their wide distribution and genetic stability. With the iterative development of genomics and bioinformatics technologies, SNP marker analysis methods combined with XGBoost machine learning models are becoming cutting-edge technologies for revealing the patterns of population genetic variation and constructing high-density genetic maps. These models, by integrating gene conservation scores, haplotype block structures, and regulatory network interaction characteristics, can accurately predict key SNP sites associated with growth traits, providing a more efficient genotype-phenotype association analysis scheme for marker-assisted breeding. Summary of the Invention
[0005] The purpose of this invention is to provide SNP molecular markers and their specific primer pairs that are significantly associated with the growth traits of *Bellamya pear-shaped*, for rapid screening of individuals with superior growth, and to realize molecular-assisted breeding of *Bellamya pear-shaped*, including population selection, parental screening and variety improvement.
[0006] To achieve the above-mentioned objectives, the technical solution adopted by the present invention is as follows: A SNP molecular marker associated with the growth traits of *Bellamya pear-shaped* is disclosed. The SNP molecular marker is located at position 131,293,660 on chromosome 131,293,660 of *Bellamya pear-shaped* Chr4, which corresponds to position 53 of the nucleotide sequence shown in SEQ ID NO.3. The base type is T / T homozygous. The allele variation at this position is T>C, where the T allele is the dominant allele associated with superior growth traits. Individuals carrying the T allele (genotype T / T or T / C) are positively correlated with growth rate and body weight.
[0007] A specific primer pair, the nucleotide sequence of the forward primer is shown in SEQ ID NO.1, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.2. The primer pair is used to amplify a DNA fragment containing the SNP molecular marker in the genomic DNA of *Bellamya pyriformis*, the nucleotide sequence of which is shown in SEQ ID NO.3.
[0008] The SNP molecular markers or primer pairs described above can be used to quickly screen individuals with superior growth, thus enabling molecular-assisted breeding of *Bellamya pear-shaped*.
[0009] This invention further provides a molecular marker-assisted breeding method for *Bellamya pear-shaped* snails, comprising the following steps: (1) Extract genomic DNA from individual individuals of the pear-shaped Bellamya species to be tested; (2) PCR amplification was performed using the primer pair to obtain a DNA fragment containing the SNP molecular marker; (3) Sequencing the DNA fragments to identify the genotypes of the SNP molecular markers; (4) Select individuals with dominant alleles as parents for breeding.
[0010] The DNA fragment sequence of the dominant allele is shown in SEQ ID NO.3.
[0011] If the identified genotype is T / T or T / C, it is judged to be a pear-shaped Bellamya variety with high body weight and good growth performance; if it is C / C, it is judged to be an individual with poor growth performance.
[0012] Preferably, the PCR amplification reaction system is as follows: 10 μL of 2×Hieff® PCRMasterMix; 1 μL of forward primer; 1 μL of reverse primer; 1 μL of template; and 20 μL of RNase-Free ddH2O.
[0013] Preferably, the PCR amplification reaction program is as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 57℃ annealing for 30 s, 72℃ extension for 12 s, for 35 cycles.
[0014] The beneficial effects of this invention are: This invention proposes a novel molecular marker method for screening pear-shaped *Bellamya przewalskii* snails with superior growth traits. Sanger sequencing technology is used to identify the genotype of parents at target SNP loci, allowing individuals with specific genotypes to be used as breeding parents. This method enables rapid and accurate genotyping during parent selection, providing a molecular-level scientific basis for breeding pear-shaped *Bellamya przewalskii* snail varieties with excellent growth traits. The application of this invention will significantly improve the breeding efficiency of pear-shaped *Bellamya przewalskii* snails, and has significant practical value in promoting quality and efficiency in aquaculture, increasing economic benefits, and ensuring market supply. Attached Figure Description
[0015] Figure 1 These are Sanger sequencing peak diagrams of a population of *Bellamya pear-shaped*. (A) is the sequencing peak diagram of the CC genotype, with an individual phenotype of slow growth; (B) is the sequencing peak diagram of the TT genotype, with an individual phenotype of excellent growth, high body weight and condition factor; (C) is the sequencing peak diagram of the TC genotype, whose growth performance indicators are between those of the TT and CC genotypes.
[0016] Figure 2 This study analyzed the mean body weight and growth rate of different genotypes of *Bellamya przewalskii* snail populations and their differences. The same letter indicates no significant difference, while different letters indicate significant differences. Detailed Implementation
[0017] The present invention will be further described in detail below with reference to specific embodiments.
[0018] To obtain SNP molecular markers associated with growth traits in *Bellamya piriformis*, the applicant constructed a cloud database containing genome sequences and multidimensional phenotypic traits. Using the PLINK2+Spark cluster computing framework, parallel genome-wide association analysis (GWAS) was performed on large-scale *Bellamya piriformis* resequencing data to preliminarily screen for SNP loci significantly associated with growth traits (p<10). -8 With a strict threshold (p<10) -8 Initial screening identified SNPs significantly associated with growth traits. Further functional enhancement screening was implemented using the XGBoost machine learning model, which, by fusing gene conservation scores (PhyloP ≥ 0.7) and chromatin interaction regulatory network characteristics, accurately predicted the genomic location and dominant genotype of key SNPs. The specific steps are as follows: (1) Whole genome resequencing was performed on individual individuals of *Bellamya pear-shaped* snails. The original data was aligned to the reference gene of *Bellamya pear-shaped* snails, and variant detection was performed using GATK4.0. After strict filtering, a high-quality SNP dataset was obtained. In addition, the growth status of *Bellamya pear-shaped* snails was continuously monitored and their weight was recorded.
[0019] (2) Genome-wide association analysis was performed using the mixed linear model (MLM) of TASSEL software. Candidate SNPs were mapped to the pear-shaped cyclops gene annotation database using BLAST+, and GO functional annotations and KEGG pathway enrichment analysis of the genes in which they were located were extracted. (3) Divide the SNP dataset: Divide the samples into training set, validation set and test set in an 8:1:1 ratio, train and optimize the XGBoost model, and screen SNPs with high growth correlation by combining the genetic differentiation index (Fst); (4) Select individuals from the 8th generation of the new variety “Lihu No. 1” of the pear-shaped ring-bellied snail and design specific primer pairs for identification targeting the SNP site.
[0020] The molecular marker was ultimately verified to be located at chromosome 131,293,660 of *Bellamya pearica* (T / T homozygous type) (https: / / www.ncbi.nlm.nih.gov / datasets / genome / GCA_028829895.1 / ). Population control experiments showed that individuals carrying the T allele (genotypes T / T and T / C) had significantly better growth performance than individuals with the C / C genotype, exhibiting a growth performance trend of T / T>T / C>C / C, demonstrating excellent value in molecular marker-assisted breeding.
[0021] Example 1 1. Laboratory animals The experimental samples of *Bellamya pear-shaped* snails were offspring produced from the 'Lihu No. 1' variety after its traits had stabilized, through eight consecutive generations of random mating. Each female parent snail was individually cultured in a net bag. After giving birth to offspring, each offspring was transferred to a separate net bag for individual rearing. A total of 320 healthy individuals (half male and half female, 200±5 days old) were randomly selected from this offspring population. All experimental individuals were cultured in a standardized recirculating aquaculture system (water temperature 25±1℃, pH 7.2±0.3) and fed the same amount of formulated feed to ensure consistent environmental conditions.
[0022] 2. Experimental Methods 2.1 Genomic DNA was extracted from the abdominal foot muscle tissue of *Bellamya piriformis* using a modified proteinase K-ammonium acetate method. The specific steps are as follows: (1) Take muscle tissue from the ventral foot of the pear-shaped ring snail and quickly place it into a 1.5 mL EP tube. During the operation, try to ensure that there is no H2O residue in the EP tube to avoid interference with subsequent experiments. (2) Add 400 μL of cell lysis buffer (TES) to the EP tube containing the tissue, followed by 6 μL of proteinase K solution. Mix thoroughly using a vortex mixer to ensure full contact between the tissue and the solution. Place the EP tube in a 65°C water bath and let it stand for 3 hours or until the tissue is completely dissolved. During digestion, gently shake the EP tube 2-3 times every 30-60 minutes to promote tissue digestion; (3) Remove the digested EP tube from the water bath and place it in a room temperature environment to cool for 5-10 minutes to allow the temperature inside the tube to drop to room temperature. (4) Add 200 μL of ammonium acetate solution to the cooled EP tube and mix thoroughly using a vortex mixer to ensure uniform distribution of the components in the solution. Place the EP tube on ice for 5-10 minutes to help further separate DNA from other components such as proteins; (5) Place the EP tube into a centrifuge and centrifuge at 12,000 rpm for 10 minutes to allow impurities and proteins in the solution to precipitate to the bottom of the tube; (6) Prepare a new 1.5mL EP tube and carefully aspirate 400-600μL of supernatant from the centrifuged solution (be careful to avoid aspirating impurities from the bottom of the tube) into the new EP tube; (7) Add an equal amount of isopropanol (400-600 μL) to a new EP tube, and gently invert and mix 10-15 times to ensure complete DNA precipitation. Then place the EP tube on ice and let it stand for 1 minute to allow the DNA to precipitate more completely. Place the EP tube in a centrifuge and centrifuge at 12000 rpm for 10 minutes to allow the DNA to precipitate to the bottom of the tube; (8) Wash with 70% ethanol, carefully discarding the supernatant. Add 500 μL of 70% ethanol to the EP tube and gently invert 5-8 times to wash away the DNA precipitate and remove residual salts and impurities. Place the EP tube in a centrifuge and centrifuge at 12000 rpm for 5 min to ensure the DNA precipitate adheres tightly to the bottom of the tube. Carefully discard the supernatant again. (9) Add 500 μL of anhydrous ethanol to the EP tube again, and centrifuge at 12000 rpm for 5 min to further wash the DNA precipitate. After centrifugation, carefully discard the supernatant; (10) DNA preservation: Place the EP tube (after discarding the supernatant) in a clean bench and allow the ethanol to evaporate naturally (usually 10-15 min). After the ethanol has completely evaporated, add 10-15 μL of ddH2O to the EP tube and gently tap the bottom of the tube 10-15 times to help dissolve the DNA; (11) Preservation and testing: The extracted DNA can be used directly for subsequent experiments. Use a spectrophotometer to determine the concentration and purity of the DNA, ensuring that the A260 / A280 value of the DNA is between 1.8 and 2.0, and the A260 / A230 value is greater than 2.0. Store the extracted DNA sample at -20℃ for later use.
[0023] 2.2 Primer Design Twenty-three SNP markers significantly associated with growth rate were screened from the *Bellamya piriformis* genome using high-throughput sequencing and genome-wide association analysis (GWAS). Further screening using Fst values revealed that the SNP Chr4:131,293,660 (T>C) had the highest index. Therefore, DNA sequences approximately 200 bp above and below this SNP site were obtained from the *Bellamya piriformis* genome. PCR primers with amplification product length between 120-200 bp and the SNP site located in the middle were designed using PrimerPremier 6.0 software. The final PCR primers for amplifying SNPChr4:131,293,660 (T>C) are as follows: F:5'-CATGTACGTCTGCCGCATTG-3' (SEQ ID NO.1); R: 5'-TTGTTTTAGCAGGGTCCGGG-3' (SEQ ID NO. 2).
[0024] The sequence of the amplified fragment is as follows (SEQ ID NO. 3): CATGTACGTCTGCCGCATTG TTCGATATTGAATTAAATTATGAAAGAATTGT (C) AACTTATGTTATCATATTTCTCCATTCCTGCAATCCATTACAAATACAGTTTAAATTATCAGTGCACTCTCTCAAATCGCTACGTTAAACTTCCAAACACGTTTGTTTAGGTCTTCTGAGTTTTCTCCTAGACTCATGT CCCGGACCCTGCTAAAACAA Note: Underlined text represents primer sequences, and bold text represents SNP sites.
[0025] 2.3 Establishing the PCR reaction system Using the extracted genomic DNA as a template, PCR amplification was performed using the primers described above. The reaction system is shown in Table 1.
[0026] Table 1 Components of the PCR reaction system
[0027] 2.4 Setting up the PCR reaction program Table 2 PCR reaction procedure
[0028] 2.5 Detection and purification of amplification products After PCR amplification, take 5-10 μL of the amplification product, add an appropriate amount of loading buffer, and perform electrophoresis on a 1.5-2% agarose gel. Observe and record the bands of the amplification product using a gel imaging system to determine whether the product size meets expectations.
[0029] For successfully amplified products, to perform subsequent high-precision analysis, the PCR products are first purified using the magnetic bead method. The specific procedure is as follows: Transfer the PCR product to a new centrifuge tube, add an appropriate amount of magnetic beads, mix gently, and incubate at room temperature for 5-10 minutes to allow the magnetic beads to fully bind to the DNA. Place the centrifuge tube on a magnetic rack, and after the magnetic beads are completely adsorbed, carefully aspirate the supernatant. Add an appropriate amount of 80% ethanol to wash the magnetic beads 2-3 times, allowing them to stand for 1-2 minutes after each wash, and then aspirate the ethanol. Dry the magnetic beads at room temperature until the ethanol has completely evaporated, add an appropriate amount of Elution Buffer to dissolve the DNA on the magnetic beads, mix gently, and incubate at room temperature for 5-10 minutes. Then remove the centrifuge tube from the magnetic rack, collect the purified PCR product, and store it at -20°C for later use.
[0030] 2.6 Sanger sequencing validation The purified PCR products are selected and sent to a professional sequencing company, which also provides the corresponding sequencing primers (which can be the same as the PCR amplification primers or specially designed sequencing primers based on the target region). The sequencing company operates according to the standard Sanger sequencing protocol. First, the PCR products are sequenced using the sequencing primers. New DNA chains are synthesized by DNA polymerase, and ddNTPs (dideoxyribonucleotides) are incorporated during the synthesis process, producing a series of DNA fragments of different lengths.
[0031] Sequencing result analysis: The peak plot files obtained from sequencing are analyzed using professional sequencing analysis software (such as APE). By comparing the sequencing results with the reference sequence, the actual base type of the SNP site is determined.
[0032] 2.7 Growth Performance Evaluation Evaluation criteria: Genomic DNA extraction, PCR amplification, sequencing of amplified products, and analysis of sequencing results from *Bellamya pearica* population samples revealed that the T allele was the dominant allele at chromosome 131,293,660. The association strength between genotype and growth performance was T / T > T / C > C / C, with individuals of the T / T and T / C genotypes showing significantly better growth performance than those of the C / C genotype.
[0033] 3. Data Analysis and Results Summary Data Analysis: Statistical analysis was performed on the genotyping results (verified by Sanger sequencing) to calculate the frequency distribution of different genotypes in the cultured population. To verify the association between different genotypes at Chr4:131,293,660 and growth traits of *Bellamya pear-shaped*, we conducted one-way ANOVA and Tukey HSD post-hoc tests on the key growth indicators in Table 3. The results showed highly significant differences in growth traits among different genotypes (p<0.001). Further intergroup comparisons indicated a significant T allele dosage effect at this locus: the T / T genotype was highly significantly superior to the C / C genotype in all growth indicators (p<0.001); the phenotypic value of the T / C genotype was between that of T / T and C / C, with no significant difference from the T / T genotype (p>0.05), but highly significantly superior to the C / C genotype (p<0.001). This result is consistent with... Figure 2 The statistical relationships revealed by the significance letter annotations a, ab, and b are consistent, further verifying the association between SNP molecular markers and growth performance. Table 4 shows the SNP locus genotypes and body condition data of some individuals of *Bellamya pear-shaped*.
[0034] Table 3 Comparison of growth performance of different genotypes
[0035] Note: The rearing cycle is 200 days. Absolute weight gain rate = Final average body weight / Number of rearing days. Relative weight gain rate (%) = (Absolute weight gain rate of a certain genotype / Absolute weight gain rate of TT genotype) × 100. The relative weight gain rate (%) is calculated based on the absolute weight gain rate of the TT genotype (100%), and is used to visually compare the relative difference between each genotype and the optimal growth performance.
[0036] Table 4. Genotypes and Condition (K) of SNP sites in *Bellamya pear-shaped*
[0037] Note: K(%) = W soft body / W shell × 100%, K represents fullness, W soft body is the dry weight of the soft body of an individual *Bellamya pear-shaped*, and W shell is the dry weight of the shell of an individual *Bellamya pear-shaped*.
[0038] In summary, this invention constructs a precision breeding technology system for the growth traits of *Bellamya pear-shaped* snails. By integrating the XGBoost machine learning model with GWAS analysis, key SNP molecular markers are efficiently mined from genomic big data. Sanger sequencing and population function validation successfully located the Chr4 locus at 131,293,660, confirming that the T allele is the dominant allele, and the association strength between its genotype and growth performance is T / T ≥ T / C > C / C. This technology system overcomes the bottlenecks of long breeding cycles and low efficiency in traditional breeding methods, providing systematic technical support for promoting the precision and intelligent upgrading of the snail farming industry.
Claims
1. A species similar to the pear-shaped annular snail ( Bellamya purificata SNP molecular markers related to growth traits, characterized by: The SNP molecular marker is located at positions 131, 293, 660 on chromosome 4 of *Bellamya pyriformis*, with a base type of T / T homozygous. The variation at this site is T>C, where the T allele is the dominant allele associated with superior growth traits.
2. A specific primer pair, characterized in that: The nucleotide sequence of the forward primer is shown in SEQ ID NO.1, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.
2. The primer pair is used to amplify the DNA fragment containing the SNP molecular marker of claim 1 in the genomic DNA of *Bellamya piriformis*.
3. The application of the SNP molecular marker as described in claim 1 or the primer pair as described in claim 2 in the assisted breeding of *Bellamya pyriformis*, for screening varieties with excellent growth traits.
4. A molecular marker-assisted breeding method for *Bellamya pear-shaped* snails, characterized in that... Includes the following steps: (1) Extract genomic DNA from individual individuals of the pear-shaped Bellamya species to be tested; (2) PCR amplification was performed using the primer pair described in claim 2 to obtain a DNA fragment containing the SNP molecular marker described in claim 1; (3) Sequencing the DNA fragments to identify the genotypes of the SNP molecular markers; (4) Select individuals with dominant alleles as parents for breeding.
5. The method as described in claim 4, characterized in that, The PCR amplification reaction system is as follows: 10 μL of 2×Hieff® PCRMasterMix; 1 μL of forward primer; 1 μL of reverse primer; 1 μL of template; and 20 μL of RNase-Free ddH2O.
6. The method as described in claim 4, characterized in that, The PCR amplification reaction program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 57℃ annealing for 30 s, 72℃ extension for 12 s, for 35 cycles.
7. The method as described in claim 4, characterized in that, If the identified genotype is T / T or T / C, it is determined to be a pear-shaped Bellamya variety with high body weight and fast growth rate.
Citation Information
Patent Citations
Amplimers for mitochondrial COI gene of Bellamya and application thereof
CN106560519A
SNP molecular marker for biomphalaria and application of SNP molecular marker in traceability
CN109337993A
Method for quickly distinguishing pomacea canaliculata lamarck based on PCR, primer and application
CN109468387A
River snail microsatellite molecular marker as well as primer and application thereof
CN117004734A
Specific DNA sequence for non-destructive identification of genetic sex of escargots in China and identification method
CN119101750A