Application of reagent for promoting expression of LECT2 gene in preparation of medicine for promoting liver regeneration

Abstract

The invention relates to the field of biological medicine, and discloses application of a reagent for promoting expression of an LECT2 gene in preparation of a medicine for promoting liver regeneration, application of the reagent for promoting expression of the LECT2 gene in preparation of the medicine for promoting liver regeneration and the medicine for promoting liver regeneration with overexpressed LECT2 as a main active component. According to the present invention, with the application of the virus vector, the liver regeneration after the liver resection can be promoted, the AAV9-Lect2 or the control (AAV9-Ctrl) is injected into the C57BL / 6J mouse body through the overexpression of the virus vector, the molding succeeds after 4 weeks, the 2 / 3 resection operation of the liver is performed on the two groups of mice, and the sample is collected after 48 h; the result shows that in the mouse treated by AAV9-Lect2, the expression of LECT2 in the liver is obviously increased. Compared with a control group, mice subjected to AAV9-Lect2 treatment show more proliferative hepatocytes, the immunohistochemical staining results of Ki67 and PCNA are more remarkable, and LECT2 has potential application value in drugs for promoting liver regeneration and treatment.

Description

Technical Field

[0001] This invention belongs to the field of biomedicine and relates to the application of reagents that promote LECT2 gene expression in the preparation of drugs that promote liver regeneration. Background Technology

[0002] Liver disease is a major global public health challenge, with liver regeneration capacity being a key determinant of disease progression and prognosis. Liver regeneration is a highly complex biological process whose mechanisms have undergone dynamic evolution at different developmental stages. Notably, the different mechanisms of liver regeneration at different developmental stages pose significant challenges to both clinical management and scientific research. Increasing evidence suggests that liver regeneration capacity varies significantly with the growth and development of living organisms. The recovery of liver function in patients depends on postoperative liver regeneration capacity; insufficient regeneration capacity severely impacts disease prognosis, and improving postoperative liver regeneration capacity plays a crucial role in promoting the recovery of patient function.

[0003] To address this issue, we performed two-thirds partial hepatectomy or sham surgery on wild-type mice aged 1, 4, 12, and 20 months, followed by liver tissue collection and transcriptome sequencing to identify conserved regulators controlling liver regeneration throughout developmental stages. Our results confirmed significant differences in regenerative capacity across different developmental stages. Furthermore, our study employed a multi-life-stage research strategy, identifying LECT2 as a regulator of liver regeneration throughout the organism's biological cycle. Previous studies have confirmed that leukocyte-derived chemokine 2 (LECT2) is a chemokine produced by leukocytes involved in various physiological and pathological processes, including inflammation, immune regulation, and tumor development. Our research team has conducted a series of studies on LECT2, demonstrating its role in regulating angiogenesis and promoting liver fibrosis during liver disease progression, as well as its impact on the progression of alcohol-related hepatitis. Existing evidence suggests that LECT2 may be involved in liver injury and repair processes, but its specific function and regulatory mechanisms in liver regeneration remain unclear.

[0004] Adeno-associated virus (AAV) is a non-pathogenic single-stranded DNA virus. Due to its high safety, low immunogenicity, long-term stable expression of exogenous genes, and broad tissue tropism, it has become one of the most commonly used viral vectors in gene therapy. AAV has multiple serotypes (such as AAV1-AAV13), among which AAV9 has attracted much attention in gene therapy research for liver diseases and neurological diseases due to its highly efficient liver targeting and ability to cross the blood-brain barrier. In liver-related research, AAV vectors have been widely used to deliver therapeutic genes, such as for the delivery of coagulation factor genes in hemophilia and enzyme replacement therapy for metabolic liver diseases. Summary of the Invention

[0005] This invention addresses the shortcomings of existing technologies by successfully establishing a severe liver injury model caused by 70% hepatectomy in mice. It is the first to use AAV9 liver-specific affinity virus to explore the potential medical value of LECT2 in the fields of liver disease and liver regeneration.

[0006] Specifically, a first aspect of the present invention provides the use of reagents that promote LECT2 gene expression and / or increase LECT2 protein activity in the preparation of a medicament for promoting liver regeneration. Furthermore, the liver regeneration-promoting medicament can promote liver regeneration after hepatectomy.

[0007] Furthermore, the reagent for promoting LECT2 gene expression is an expression vector containing the LECT2 gene, used to overexpress LECT2 mRNA or protein in target cells or target tissues.

[0008] Furthermore, the LECT2 overexpression is achieved through overexpression via a viral vector.

[0009] Furthermore, the viral vector is AAV9.

[0010] AAV9 is a small, non-pathogenic, non-enveloped icosahedral defective virus that encodes 4.7kb and can infect a variety of cells and tissues.

[0011] A liver regeneration-promoting drug that includes overexpressed LECT2.

[0012] Furthermore, the drug uses overexpressed LECT2 as its main active ingredient.

[0013] Furthermore, the subjects include patients with liver disease who have undergone liver resection, preferably including patients with liver tumors, liver trauma, liver abscesses, intrahepatic bile duct stones, or liver cysts; or the subjects include liver transplant patients.

[0014] Furthermore, the drug also includes a viral vector, wherein the viral vector is adeno-associated virus (AAV9).

[0015] Leukocyte-derived chemokine 2 belongs to the peptidase M23 family and is a protein with chemotactic activity.

[0016] This invention uses AAV9 as a delivery vector for the LECT2 gene, enabling its efficient expression in the liver via intravenous injection, thereby exploring the promoting effect of LECT2 on liver regeneration. The successful application of AAV9-LECT2 not only verifies the biological function of LECT2 but also provides experimental evidence for developing AAV-based gene therapy strategies for liver regeneration.

[0017] The beneficial effects of this invention are: This invention provides the application of LECT2 in the preparation of drugs promoting liver regeneration and a liver regeneration drug with overexpressed LECT2 as the main active ingredient. Transcriptomic sequencing analysis of mice at four different ages revealed that LECT2 was significantly enriched in the livers of mice at all ages after regeneration. This invention unexpectedly discovered that the LECT2 gene can promote liver regeneration in mice of different ages. AAV9-Lect2 or a control (AAV9-Ctrl) was injected into C57BL / 6J mice, and the model was successfully established after four weeks. Both groups of mice underwent two-thirds hepatectomy, and samples were collected 48 hours later. The results showed that in mice treated with AAV9-Lect2, LECT2 expression in the liver was significantly increased, and serum transaminase levels were elevated postoperatively. Compared with the control group, mice treated with AAV9-Lect2 showed more proliferating hepatocytes, and the immunohistochemical staining results for Ki67 and PCNA were also more significant. Attached Figure Description

[0018] The present invention will now be described in detail with reference to the accompanying drawings. Figure 1 Representative images of H&E staining in liver tissue from wild-type mouse liver regeneration models (48 h after 2 / 3 hepatectomy) at 1 month, 4 months, 12 months, and 20 months of age, along with representative immunohistochemical images and statistical results of Ki-67 and PCNA in the livers of wild-type mouse models at 1 month, 4 months, 12 months, and 20 months of age. (A) Representative images of H&E staining in liver tissue from wild-type mouse liver regeneration models (48 h after 2 / 3 hepatectomy) at 1 month, 4 months, 12 months, and 20 months of age (n=4 mice per group). Arrows indicate the liver / body ratio in wild-type mouse models of mitotic hepatocytes (B) at 1, 4, 12, and 20 months of age (n=3–4 mice per group). (C, D) Representative immunohistochemical images and statistical results of Ki-67 and PCNA in the livers of wild-type mouse models at 1, 4, 12, and 20 months of age (n=3–4 mice per group). Data are from two or three independent experiments with similar results. * (P<0.05), ** (P<0.01), and *** (P<0.001). Scale bar, 100 μm.

[0019] Figure 2Multi-stage transcriptomic analysis identified LECT2 as the primary candidate for liver regeneration. (A) Schematic diagram showing the basic procedures for partial hepatectomy (PHx) and sham surgery in wild-type mice aged 1 month, 4 months, 12 months, and 20 months. (B) Principal component analysis (PCA) results of liver tissue transcriptome sequencing data from wild-type mice aged 1 month, 4 months, 12 months, and 20 months (PHx group vs. sham surgery group). (C) Venn diagram showing the overlap of upregulated genes in liver tissue from wild-type mice in the PHx group compared to the sham surgery group in 1 month, 4 months, 12 months, and 20 months. (D) Heatmap showing the expression patterns of 48 significantly upregulated genes in liver regeneration models of different age groups. (E) Venn diagram analysis of the intersection of the 48 upregulated genes with a public liver regeneration transcriptome dataset. (F) Dynamic expression changes of 9 key candidate genes in the public dataset GSE95135 during liver regeneration. (G) Western blotting was used to detect the expression level of LECT2 in liver tissues of wild-type mice (1 month, 4 months, 12 months, and 20 months old) after partial hepatectomy. Data are expressed as mean ± standard deviation.

[0020] Figure 3 Example 1 illustrates the inhibition of liver regeneration in mice of different ages by gene knockout mice. (A) Schematic diagram of the construction process for liver regeneration models in wild-type (WT) and Lec2 gene knockout (Lect2-KO) mice at different ages (1 month, 4 months, 12 months, and 20 months). (B) Western blot (WB) analysis of LECT2 expression levels in each group of mice (n=4 per group). (C) Representative H&E staining images of liver regeneration models in WT and Lec2-KO mice of different ages (n=4 per group), with arrows indicating mitotic hepatocytes. (D) Actual liver weight / body weight ratio in WT and Lec2-KO mice of different ages 48 hours after PHx surgery (n=4 per group). (EF) Results of Ki-67 immunohistochemical (IHC) and PCNA immunohistochemical staining and quantitative analysis of liver tissue (n=4 per group). Data were obtained from two or three independent experiments with similar results. * (P<0.05), ** (P<0.01), and *** (P<0.001). Scale bar, 100 μm.

[0021] Figure 4Example 1 shows the use of AAV overexpression of LECT2 to promote liver regeneration. (A) Schematic diagram of the experimental procedure for constructing a liver regeneration model in 4-month-old and 20-month-old wild-type mice after injection of AAV overexpression of LECT2. (B) Western blot results of LECT2 protein expression levels in the livers of AAV-Lect2 group and AAV-V (virus control group) mice after hepatectomy (n=4 mice per group). (C) Actual liver weight / body weight ratio of AAV-Lect2 group and AAV-V group mice 48 hours after hepatectomy (n=4 mice per group). (D) Results of H&E staining, Ki-67 immunohistochemistry, PCNA immunohistochemistry staining, and quantitative analysis of liver tissue (arrows indicate mitotic hepatocytes, n=6 mice per group). (E) Quantitative analysis results of Ki-67 and PCNA immunohistochemistry staining of liver tissue. Data are from two or three independent experiments with similar results. * (P<0.05), ** (P<0.01), and *** (P<0.001). Scale bar, 100μm. Detailed Implementation Example 1

[0022] 1.1 Experimental Materials – Laboratory Animals and Feed The Lect2-KO mouse genotyping continuation research group's previous study (Lu et al., 2016). The aged C57BL / 6JNifdc mice and C57BL / 6J mice used in this experiment were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. The mice were housed under specific pathogen-free conditions, within a 12-hour light-dark cycle, and had free access to food and water. All experimental mice were healthy males with normal immune function, and all animal experiments were authorized by the Animal Care and Use Committee of Anhui Medical University (ethics number: LLSC20231216).

[0023] 1.2 Liver Injury Model Male animals of different ages were used as research subjects. They underwent partial hepatectomy (PHx) experiments with a 12-hour diurnal cycle and free food / water. Mice underwent 70% hepatectomy under isoflurane anesthesia. Surgeries were performed between 8:00 AM and 12:00 PM, removing the middle and left lobes, with a mortality rate of <5%. For 2 / 3 hepatectomy, mice were first anesthetized with isoflurane. After the mice were completely unconscious, approximately 70% of their liver tissue, including the left and right middle lobes and the left large lobe, was removed. Surgeries were scheduled between 8:00 AM and 12:00 PM. It was important to note that the mortality rate of mice participating in the hepatectomy should be less than 5%. During sham surgery, the liver was blunted and dissected using cotton swabs to ensure full release and exposure of each lobe, with the same exposure time as the partial hepatectomy group. After the same exposure time, the liver lobes were repositioned in their corresponding positions in the abdominal cavity and sutured. According to the experimental grouping, mice were treated at the corresponding time points from 0 to 7 days after partial hepatectomy, and serum and liver tissue were collected for later use. At the same time, the liver / body ratio (the ratio of residual liver wet weight to total body weight) of mice was calculated.

[0024] 1.3 Reverse transcription PCR and quantitative real-time PCR (1) Reverse transcription PCR: Keep the extracted total RNA on ice until needed. Take out the reverse transcription kit, add the calculated amount of RNA to the 8-tube PCR kit, reverse transcribe a maximum of 1 μg of total RNA per tube, add 2 μl of RNA reverse transcription reagent, and bring the volume to 10 μl with RNase-free water. Incubate at 37°C for 15 minutes, followed by incubation at 85°C for 5 seconds.

[0025] (2) q-PCR: Using cDNA as a template and GAPDH as an internal control, the relative expression levels of relevant indicators were detected. The reaction system was as follows: SYBR Green Premix Ex Taq II: 5 μl, PCR Forward Primer: 0.4 μl, PCR Reverse Primer: 0.4 μl, cDNA template: 2 μl, RNase-free water: 2.2 μl, Final Volume: 10 μl. The above reaction system was prepared in an enzyme-free 8-tube or 96-well plate, and after brief centrifugation, it was placed in a Roche LightCycler96 real-time quantitative PCR instrument for quantitative PCR.

[0026] Set the qPCR primers as follows: LECT2-F: CCAATGAGATCCGGACGTGT LECT2-R: TCCTGGCCCACAATCATTCC GAPDH-F: GGAGCGAGATCCCTCCAAAAT GAPDH-R: GGCTGTTGTCATACTTCTCATGG Wherein, F: Sense primer; R: Antisense primer.

[0027] 1.4 Histology Mouse liver tissue was treated with 4% glutaraldehyde solution and then embedded in paraffin. Continuous sections with a thickness of 3 mm were cut from the paraffin block and stained with hematoxylin and eosin (H&E). The stained sections were then imaged using an optical microscope.

[0028] 1.5 Immunohistochemistry Liver tissue was fixed with 4% glutaraldehyde (PFA) and embedded in paraffin for subsequent sectioning. After standard hydration, liver sections were subjected to high-pressure antigen recovery in citrate buffer. Endogenous peroxidase blocking was performed at room temperature for 10 minutes. Subsequently, sections were incubated with goat serum at 37°C for 30 minutes to prevent nonspecific binding. They were then incubated overnight at 4°C with an appropriate primary antibody, followed by incubation for 1 hour with HRP (horseradish peroxidase)-labeled rabbit or mouse antibody. Color development was performed during staining using the DAB substrate kit (PV6000). After washing with PBS, tissue sections were stained with hematoxylin and observed under a microscope. Immunofluorescence was performed using the following primary antibodies: anti-Ki67 antibody (1:50, BD, 550609) and anti-PCNA antibody (1:200, Abcam, ab29).

[0029] 1.6 LECT2 overexpression in vivo To achieve LECT2 overexpression, a custom-designed lentiviral vector carrying human LECT2 cDNA was purchased from Shanghai Hanheng Biotechnology Co., Ltd., along with a vector containing the same human control cDNA. In this experiment, adeno-associated virus (AAV) was used for in vivo overexpression of LECT2. Both the AAV virus and the control vector were provided by Hanheng Biotechnology (Shanghai) Co., Ltd. Each mouse was injected with 100 μl of the viral suspension via the tail vein, and successful modeling was confirmed approximately 28 days later. The AAV viral vector contains the green fluorescent protein gene; after modeling, the mouse liver showed green fluorescence under a fluorescence microscope, indicating effective viral infection.

[0030] 1.7 RNA-seq library preparation, sequencing, and data analysis Mouse liver samples were sent to Novogene (Beijing, China) for transcriptome sequencing. RNA totality and integrity were assessed using the RNA Nano 6000 assay kit on an Agilent Technologies 2100 system (CA, USA). mRNA was purified from total RNA using poly-T oligonucleotide-linked magnetic beads. Fragmentation was performed at high temperature using divalent cations in first-strand synthesis reaction buffer (5X). Library construction was performed using the NEBNext Ultra RNA Library Prep Kit for Illumina. The qualified libraries were sequenced 150 times at both ends on an Illumina NovaSeq 6000 platform (Illumina, USA). The raw data in fastq format was first quality-checked using FastQC software. Clean reads were obtained by removing reads containing adapters, N bases, and low-quality reads from the raw data. All downstream analyses were based on high-quality clean data. Clean reads were mapped to a reference genome (GRCm39) using HISAT2 (v2.0.5). The number of reads mapped to each gene was quantified using feature counting (v1.5.0-p3). Then, the FPKM of each gene was calculated based on the gene length and the number of reads mapped to that gene.

[0031] Gene ontology (GO) enrichment analysis was performed on aggregated genes using the gprofiler226 R package (0.2.2). GO terms with a corrected P < 0.05 were considered significant. To test for dysregulated pathways in the PHx group compared to the sham-operated group, gene set enrichment analysis (GSEA) was performed using the genekitr27 R package (version 1.1.9). Gene sets were downloaded from the MSigDB database using the Geneset R package (0.2.7). Gene set variation analysis (GSVA) ​​was performed using the GSVA28 R package (version 1.44.5) to convert the gene expression matrix into gene set enrichment scores. Example 2

[0032] LECT2 can promote liver regeneration Wild-type mice aged 4 months and 20 months were used to achieve LECT2 overexpression in vivo using the AAV9 vector. AAV9-LECT2 or a control (AAV9-Ctrl) was injected into C57BL / 6J mice, and modeling was successful 4 weeks post-injection. Both groups of mice underwent 2 / 3 resection of the liver, and samples were collected 48 hours later. Results showed that LECT2 expression was significantly increased in the livers of AAV-Lect2-treated mice. Notably, the liver / body ratio was also significantly increased in AAV-Lect2 mice, a phenomenon observed in both healthy and aged mice. Compared to the control group, hepatocytes proliferated faster in AAV-Lect2-treated mice, a finding confirmed by Ki-67 and PCNA immunohistochemical staining.

Claims

1. Use of an agent for promoting expression of a LECT2 gene in the preparation of a medicament for promoting liver regeneration.

2. The use of the agent for promoting the expression of a LECT2 gene according to claim 1 in the manufacture of a medicament for promoting liver regeneration, characterized in that, The medicament for promoting liver regeneration can promote liver regeneration in a subject after a hepatectomy.

3. Use according to claim 2, wherein the compound is ###0002### The subject includes a patient suffering from a liver disease and having undergone a hepatectomy. 4.The use of the agent for promoting the expression of a LECT2 gene according to claim 1 in the preparation of a drug for promoting liver regeneration, characterized in that, The agent for promoting expression of a LECT2 gene and / or increasing activity of a LECT2 protein is an expression vector containing a LECT2 gene; the expression vector containing a LECT2 gene is overexpressed in a target cell or a target tissue by a viral vector.

5. Use according to claim 4, characterized in that, The viral vector is AAV9.

6. A medicine for promoting liver regeneration, characterized by comprising the compound according to claim 1. The medicament includes overexpressed LECT2.

7. The liver regeneration drug according to claim 6, characterized in that, The medicament has overexpressed LECT2 as a main active ingredient.

8. The liver regeneration drug according to claim 6, characterized in that, The medicament also includes a viral vector, and the viral vector is an adeno-associated virus AAV9.

Images