Trichoderma reesei transcriptional activator ace3 mutants, encoding genes and uses thereof

Abstract

This invention discloses a mutant of the Trichoderma reesei transcription activator ACE3, its encoding gene, and its applications, relating to the field of genetic engineering technology. The amino acid sequence of this Trichoderma reesei transcription activator ACE3 mutant is shown in any one of SEQ ID NO. 2-4. Based on Trichoderma reesei ACE3, this invention mutates serine at position 705 to a basic amino acid, such as histidine, arginine, or lysine, to obtain the transcription activator ACE3 mutants ACE3S705H, ACE3S705R, and ACE3S705K, respectively. Experiments have confirmed that these mutants can significantly increase the cellulase yield of Trichoderma reesei. Under cellulose-based carbon source induction conditions, the cellulase yield of the recombinant Trichoderma reesei strain carrying the mutant encoding gene is increased by 100% compared to the starting strain, with the overall cellulase activity increasing by 1.5-2 times.

Description

Trichoderma reesei transcription activator ACE3 mutant, encoding gene and its application Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to the ACE3 transcription activator mutant of Trichoderma reesei, its encoding gene, and its applications. Background Technology

[0002] Cellulase can degrade lignocellulose into monosaccharides, which have wide applications in animal feed, textiles, and papermaking. Utilizing cellulase to convert crop residues such as straw into monosaccharides, and then producing fine chemicals or food chemicals such as ethanol, lactic acid, malic acid, and amino acids, is of great significance for mitigating the depletion of non-renewable resources such as petroleum and supporting a circular economy.

[0003] Trichoderma reesei possesses a strong ability to secrete and express cellulase. As the most important industrial cellulase-producing strain, Trichoderma reesei is a GRAS (Generally Regarded as Safe) strain, and its enzyme preparations are widely used in the fermentation industries of food and feed. Further improving the enzyme production capacity of Trichoderma reesei is of great significance for reducing the cost of using cellulase.

[0004] ACE3 is a Zn(II)2Cys6 type transcription activator, a conserved transcription factor in ascomycetes, and a key transcription activator required for cellulase expression in *Trichoderma reesei*. The ACE3 protein possesses a DNA-binding domain. In *Trichoderma reesei*, ACE3 binding sites are present on the promoters of various cellulase genes, and even the expression level of another key transcription activator, XYR1, is positively regulated by ACE3. Therefore, inactivation of the ACE3-encoding gene can completely interrupt cellulase expression. Conversely, overexpression of ACE3 can increase cellulase expression levels. However, research on ACE3 activity and mutation modification is currently scarce. Summary of the Invention

[0005] The purpose of this invention is to provide a Trichoderma reesei transcription activator ACE3 mutant, its encoding gene, and its applications, in order to solve the problems existing in the prior art. The Trichoderma reesei transcription activator ACE3 mutant provided by this invention can significantly increase the cellulase production of Trichoderma reesei.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] This invention provides a Trichoderma reesei transcription activator ACE3 mutant for enhancing cellulase expression levels, wherein the Trichoderma reesei transcription activator ACE3 mutant is any one of (1)-(3):

[0008] (1) Proteins with amino acid sequences as shown in any one of SEQ ID NO. 2~4;

[0009] (2) A protein that has a similarity of not less than 70% to the protein described in (1) and has the following conserved properties: the first and third amino acids connected to the N-terminus of serine at position 705 are arginine, and the fourth amino acid connected to the C-terminus is a hydrophobic amino acid.

[0010] (3) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of the protein described in (1) or (2).

[0011] The present invention also provides a coding gene for a Trichoderma reesei transcription activator ACE3 mutant for improving cellulase expression levels, the nucleotide sequence of which is shown in any one of SEQ ID NO. 11-13.

[0012] The present invention also provides a biomaterial, wherein the biomaterial is a recombinant plasmid or a recombinant Agrobacterium;

[0013] The recombinant plasmid includes the aforementioned encoding gene;

[0014] The recombinant Agrobacterium includes the recombinant plasmid.

[0015] The present invention also provides the application of the above-mentioned Trichoderma reesei transcription activator ACE3 mutant, encoding gene or biological material in enhancing the expression level of cellulase in Trichoderma reesei.

[0016] The present invention also provides a method for improving the cellulase expression level of Trichoderma reesei, comprising the step of mutating the original ACE3 coding gene in the genome of the Trichoderma reesei starting strain to the coding gene of the above-mentioned Trichoderma reesei transcription activator ACE3 mutant used to improve cellulase expression level, thereby constructing a recombinant Trichoderma reesei.

[0017] Furthermore, the originating strain of Trichoderma reesei is Trichoderma reesei ATCC 56765, Trichoderma reesei ATCC 66589, or a derivative thereof.

[0018] The present invention also provides a recombinant Trichoderma reesei constructed by the above method.

[0019] The present invention also provides the application of the above-mentioned recombinant Trichoderma reesei in the production of cellulase.

[0020] The present invention also provides a method for producing cellulase, comprising the step of fermenting and culturing the above-mentioned recombinant Trichoderma reesei to prepare the cellulase.

[0021] The present invention also provides a method for improving the cellulase expression ability of Trichoderma reesei transcription activator ACE3, comprising the step of mutating amino acid at position 705 of wild-type ACE3 protein to a basic amino acid;

[0022] The basic amino acid is histidine, arginine, or lysine.

[0023] The present invention discloses the following technical effects:

[0024] This invention, based on the ACE3 gene of *Trichoderma reesei*, mutates serine at position 705 to a basic amino acid, such as histidine, arginine, or lysine, to obtain the transcription activator ACE3 mutants ACE3S705H, ACE3S705R, and ACE3S705K, respectively. Experiments have confirmed that these mutants can significantly increase the cellulase yield of *Trichoderma reesei*. Under cellulose-based carbon source induction conditions, the cellulase yield of recombinant *Trichoderma reesei* strains carrying the mutant encoding genes is increased by 100% compared to the starting strain, with the overall cellulase activity increasing by 1.5 to 2 times. This invention is of great significance for large-scale production, increasing the yield of lignocellulose-degrading enzymes, and reducing production costs, and has promising applications in feed, textiles, and bioenergy enzymes. Attached Figure Description

[0025] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0026] Figure 1 is a flowchart of the construction of mutant plasmids encoding the ACE3 gene; where A: a schematic diagram of obtaining the gene fragment encoding amino acids "positions 311-734" of the ACE3 mutant through PCR and overlap extension PCR cloning; B: a schematic diagram of constructing the intermediate plasmid R-ACE3 and three ACE3 mutant plasmids M-ACE3-705H, M-ACE3-705R, and M-ACE3-705K through two-step seamless cloning.

[0027] Figure 2 is a flowchart of the construction process of the recombinant Trichoderma reesei strain;

[0028] Figure 3 shows the detection results of cellulase FPase activity of the starting strain and each recombinant Trichoderma reesei strain.

[0029] Figure 4 shows the detection results of cellulase CMCase activity of the starting strain and each recombinant Trichoderma reesei strain.

[0030] Figure 5 shows the detection results of cellulase pNPCase activity of the starting strain and each recombinant Trichoderma reesei strain.

[0031] Figure 6 shows the detection results of fermentation broth proteins of the starting strain and each recombinant Trichoderma reesei strain. Detailed Implementation

[0032] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0033] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0034] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0035] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0036] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0037] General notes:

[0038] Culture media and stock solutions used in the examples:

[0039] Sporulation medium (potato dextrose agar, PDA): Weigh 200 g of peeled potatoes, chop them, add no more than 1 L of water and boil for 30 min. Filter through 8 layers of gauze, take the filtrate, add 15 g of glucose and 5 g of sucrose, make up to 1 L, add 2% (w / v) agar powder, and sterilize at 115℃ for 30 min.

[0040] The fermentation medium consisted of: glucose 5 g / L, cellulose 50 g / L, corn steep liquor 27 g / L, yeast extract 3 g / L, KH2PO4 6 g / L, (NH4)2SO4 5 g / L, CaCl2 0.5 g / L, MgSO4·7H2O 1 g / L, FeSO4·7H2O 5 mg / L, MnSO4·H2O 1.6 mg / L, ZnSO4·7H2O 1.4 mg / L, and CoCl2·6H2O 2 mg / L.

[0041] Reagents used in the examples:

[0042] Toyobo Corporation's KOD-Plus enzyme; Nanjing Novizan Corporation's One Step Clone Kit; OMEGA Corporation's Agarose Gel Recovery Kit; Dingguo Changsheng Biotechnology Co., Ltd.'s Goldview nucleic acid dye. TM CMCNa from Shanghai Yuanye Biotechnology Co., Ltd.; p-nitrophenyl-β-cellulose disodium glycoside (pNPC) from Sigma-Aldrich. Other routine biochemical reagents were purchased from Sinopharm Chemical Reagent Co., Ltd., and other companies.

[0043] Instruments used in the examples:

[0044] Clean bench (AIRTECH), PCR instrument (BioRad), induction cooker, electrophoresis apparatus (DYY-11B), mold incubator (MJX intelligent type), stacked shaking incubator, autoclave (Deqiang Instruments), electric drying oven (GFL-125), ultra-micro spectrophotometer, microplate reader, electronic analytical balance, large refrigerated centrifuge (Eppendorf 5804R), small benchtop centrifuge (Eppendorf MiniSpin), pH meter, blue light / ultraviolet gel imaging system, blue light transmission gel cutter, etc.

[0045] In this invention, cellulase activity is mainly divided into: filter paper enzyme activity (FPase), which represents the overall activity of cellulase; cellulase endonuclease activity (CMCase), which represents the partial activity of cellulase; and cellulase exonuclease activity (pNPCase). The methods for measuring FPase, CMCase, and pNPCase are all conventional techniques in the field and are not the focus of the invention, so they will not be described in detail here.

[0046] In this invention, cellulase yield is primarily expressed as the protein concentration of the fermentation broth. This is because over 90% of the protein components in the *Trichoderma reesei* fermentation broth are cellulase. The methods for determining protein concentration are conventional techniques in the field and are not the focus of this invention; therefore, they will not be elaborated upon here.

[0047] This invention utilizes conventional techniques and methods from the fields of genetic engineering, molecular biology, and gene editing. Those skilled in the art can employ other conventional techniques, methods, and reagents based on the embodiments provided in this invention, without being limited to the specific embodiments of this invention.

[0048] The following specific embodiments illustrate a method for increasing the yield of lignocellulosic degrading enzymes by sequence mutation of ACE3 (amino acid sequence shown in SEQ ID NO. 1), a transcriptional activator protein derived from *Trichoderma reesei*. In practical applications, the sources of the key transcriptional activator protein ACE3 of cellulase are not limited to *Trichoderma reesei*, but also include *Trichoderma harzianum*, *Trichoderma viride*, *Trichoderma longibranchii*, *Trichoderma guilloché*, *Penicillium oxalicum*, *Penicillium cordiformis*, *Penicillium chrysogenum*, *Aspergillus niger*, *Aspergillus oryzae*, *Aspergillus fumigatus*, *Aspergillus echinosporum*, *Aspergillus thermophilus*, and *Pyrophyllus spp.*, etc. Their amino acid sequences have a similarity of at least 70% to the amino acid sequence shown in SEQ ID NO. 1, or possess conserved characteristics of the local sequence near serine position 705 in the amino acid sequences shown in SEQ ID NO. 1 and SEQ ID NO. 5~7. Specifically, the first and third amino acids (positions 704 and 702) connected to the N-terminus of the serine position 705 are arginine; the fourth amino acid (position 709) connected to the C-terminus of the serine position 705 is usually a hydrophobic amino acid, such as valine.

[0049] The following specific examples illustrate a method for increasing cellulase production by expressing ACE3 mutants ACE3S705H (amino acid sequence as shown in SEQ ID NO.2), ACE3S705R (amino acid sequence as shown in SEQ ID NO.3), and ACE3S705K (amino acid sequence as shown in SEQ ID NO.4) in *Trichoderma reesei*. In practical applications, the modified starting fungus is not limited to *Trichoderma reesei*, but also includes *Trichoderma harzianum*, *Trichoderma viride*, *Trichoderma longibranchii*, *Trichoderma guilloché*, *Penicillium oxalate*, *Penicillium cordiformis*, *Penicillium chrysogenum*, *Aspergillus niger*, *Aspergillus oryzae*, *Aspergillus fumigatus*, *Aspergillus echinosporum*, *Aspergillus thermophilus*, and *Pseudomonas spp.*

[0050] The ACE3 mutant ACE3S705H contains a sequence near the 705 mutation site as shown in SEQ ID NO. 5; the ACE3 mutant ACE3S705R contains a sequence near the 705 mutation site as shown in SEQ ID NO. 6; the ACE3 mutant ACE3S705K contains a sequence near the 705 mutation site as shown in SEQ ID NO. 7; the nucleotide sequence of the gene encoding the ACE3 mutant ACE3S705H with introns is shown in SEQ ID NO. 8; the nucleotide sequence of the gene encoding the ACE3 mutant ACE3S705R with introns is shown in SEQ ID NO. 9; the nucleotide sequence of the gene encoding the ACE3 mutant ACE3S705K with introns is shown in SEQ ID NO. 10; the nucleotide sequence of the gene encoding the ACE3 mutant ACE3S705H without introns is shown in SEQ ID NO. 11; the nucleotide sequence of the gene encoding the ACE3 mutant ACE3S705R without introns is shown in SEQ ID NO. 12; the nucleotide sequence of the gene encoding the ACE3 mutant ACE3S705K without introns is shown in SEQ ID NO. 11. Shown in NO.13.

[0051] The invention will now be described in detail with reference to examples.

[0052] Example 1: Construction of a partial gene fragment encoding the ACE3 mutant, a key transcriptional activator of cellulase in Trichoderma reesei.

[0053] 1. PCR of two DNA fragments, positions 311-704 and 705-734.

[0054] The ACE3 protein in *Trichoderma reesei* contains 734 amino acids, and its amino acid sequence is shown in SEQ ID NO.1. Fragments corresponding to amino acids 311-704 and 705-734 were cloned separately by PCR. When cloning the fragment corresponding to amino acids 705-734, a mutation was introduced at serine position 705 using primer pairs. Finally, the two DNA fragments at positions 311-704 and 705-734 were ligated by overlap extension PCR to form the partial coding gene fragment corresponding to amino acids 311-734 of the ACE3 mutant (Figure 1A).

[0055] (1) Using Trichoderma reesei genomic DNA as a template, the fragment corresponding to the codons of amino acids 311-704 of ACE3 was amplified using primers ace3-1 and ace3-2 to obtain the DNA fragment ACE3zh(311-704). The nucleic acid sequence of the DNA fragment ACE3zh(311-704) is shown in SEQ ID NO.14.

[0056] Amplification reaction system: 10×PCR Buffer for KOD-Plus-Neo 5 μL, 2 mM dNTPs 5 μL, 25mM MgSO4 3 μL, primers (10 μM each) 1.5 μL, genomic template (~200 ng) 1 μL, KOD-Plus-Neo (1 U / μL) 1 μL.

[0057] Reaction program: 94℃ for 2 min; 98℃ for 10 sec, 55℃ for 30 sec, 68℃ for 45 sec, run for 30 cycles; 68℃ for 5 min.

[0058] (2) Amplify the fragment from amino acid 705 to 734 of ACE3 up to the stop codon (TAA) using primers ace3-705H-3 and ace3-4. Introduce a sequence on the primer that mutates serine at position 705 to histidine to obtain the DNA fragment ACE3H.

[0059] (3) Amplify the fragment from amino acid 705 to 734 of ACE3 up to the stop codon (TAA) using primers ace3-705R-3 and ace3-4. Introduce a sequence on the primer that mutates serine at position 705 to arginine to obtain the DNA fragment ACE3R.

[0060] (4) Amplify the fragment from amino acid 705 to 734 of ACE3 up to the stop codon (TAA) using primers ace3-705K-3 and ace3-4. Introduce a sequence on the primer that mutates serine at position 705 to lysine to obtain the DNA fragment ACE3K.

[0061] The nucleic acid sequences of DNA fragments ACE3H, ACE3R, and ACE3K are shown in SEQ ID NO.15~17, respectively.

[0062] Amplification reaction system: 10×PCR Buffer for KOD-Plus-Neo 5 μL, 2 mM dNTPs 5 μL, 25mM MgSO4 3 μL, primers (10 μM each) 1.5 μL, genomic template (~200 ng) 1 μL, KOD-Plus-Neo (1 U / μL) 1 μL.

[0063] Reaction program: 94℃ for 2 min; 98℃ for 10 sec, 55℃ for 30 sec, 68℃ for 10 sec, run for 30 cycles; 68℃ for 1 min.

[0064] The primer sequences (5'-3') used in the above amplification process are as follows:

[0065] ace3-1: gattacgaattcttaatta CAACCATCGCCGCTGTCACA (SEQ ID NO.22; the lowercase part is the introduced adapter sequence used for plasmid insertion).

[0066] ace3-2: CCTGGCTCCGGTAGCCAAGG (SEQ ID NO. 23);

[0067] ace3-705H-3:ATTCACCCTTGGCTACGCGAGCCAGG cac GACTTTTCCGTGCTTTTGGATATT (SEQ ID NO.24; the lowercase part is a mutation in the amino acid sequence encoding position 705).

[0068] ace3-705R-3:ATTCACCCTTGGCTACGCGAGCCAGG cgc GACTTTTCCGTGCTTTTGGATATT (SEQ ID NO.25; the lowercase part is a mutation in the amino acid sequence encoding position 705).

[0069] ace3-705K-3:ATTCACCCTTGGCTACGCGAGCCAGG aag GACTTTTCCGTGCTTTTGGATATT (SEQ ID NO.26; the lowercase part is a mutation in the amino acid sequence encoding position 705).

[0070] ace3-4: attatacgaagttattctaga TTAGCCAACAACGGTAGTGGAC (SEQ ID NO.27; the lowercase part is the introduced adapter sequence used for plasmid insertion).

[0071] 2. Overlap extension PCR

[0072] The amplified ACE3 middle coding fragment ACE3zh was fused with the terminal coding fragments ACE3H, ACE3R, and ACE3K of ACE3 carrying sequence mutations using the overlap extension PCR method (see "Fungal Genetics and Biology 2004, 41:973-981"). This yielded partial gene fragments of ACE3 mutants ACE3zh-H, ACE3zh-R, and ACE3zh-K, which correspond to codons for amino acids 311-734.

[0073] The PCR program for fragment fusion was as follows: pre-denaturation at 94℃ for 2 min; each cycle consisted of 98℃ for 10 sec, 50℃ for 5 min, and 68℃ for 3 min, for a total of 16 cycles; and complete extension at 68℃ for 10 min. Small amounts of partial coding gene fragments of three ACE3 mutants, ACE3zh-H, ACE3zh-R, and ACE3zh-K, were amplified, each fragment being 1.3 kb in length.

[0074] Finally, using the product of overlap extension PCR as a template, a large number of partial coding gene fragments of three ACE3 mutants—ACE3zh-H, ACE3zh-R, and ACE3zh-K—were amplified using primers ace3-1 and ace3-4, each fragment being 1.3 kb in length. The amplification reaction program was: 94℃ for 2 min; 98℃ for 10 sec, 60℃ for 30 sec, 68℃ for 1 min, for 30 cycles; 68℃ for 5 min.

[0075] The nucleic acid sequences of partial coding gene fragments ACE3zh-H, ACE3zh-R and ACE3zh-K of the ACE3 mutant are shown in SEQ ID NO.18~20, respectively.

[0076] Example 2 Construction of a mutant plasmid encoding the ACE3 gene of Trichoderma reesei

[0077] 1. Termination fragment PCR

[0078] Using primers ace3-5 and ace3-6, the transcription terminator DNA fragment ACE3T (Figure 1A) of the ACE3 encoding gene was amplified using the Trichoderma reesei genome as a template. The nucleotide sequence of the ACE3T fragment is shown in SEQ ID NO.21.

[0079] Amplification reaction system: 10×PCR Buffer for KOD-Plus-Neo 5 μL, 2 mM dNTPs 5 μL, 25mM MgSO4 3 μL, primers (10 μM each) 1.5 μL, genomic template (~200 ng) 1 μL, KOD-Plus-Neo (1 U / μL) 1 μL.

[0080] Reaction program: 94℃ for 2 min; 98℃ for 10 sec, 58℃ for 30 sec, 68℃ for 45 sec, run for 30 cycles; 68℃ for 5 min.

[0081] The primer sequences (5'-3') used in the above amplification process are as follows:

[0082] ace3-5: actagtgagctcatttGTTGTTGGCTAAATGTGTGTTGGAA (SEQ ID NO.28; the lowercase part is the introduced adapter sequence used for plasmid insertion).

[0083] ace3-6: agtgccaagcttattt CTGTCTGTCTGTCTGCCTGTCT (SEQ ID NO.29; the lowercase part is the introduced adapter sequence for ligation into the plasmid).

[0084] 2. Construction of ACE3 mutant plasmid

[0085] (1) An intermediate plasmid was constructed using LML2.0a (which has been published in the literature “Zhang et al. Light-inducible genetic engineering and control of non-homologous end-joining in industrialeukaryotic microorganisms: LML 3.0 and OFN 1.0. Scientific Reports. 2016, 6:20761”) as the backbone. The existing plasmid LML2.0a was digested with the restriction endonuclease SwaI. Using the One Step Clone Kit, the ACE3T fragment was homologously recombinated with the digested LML2.0a to construct the intermediate plasmid R-ACE3 (B in Figure 1).

[0086] (2) Construct ACE3 mutant plasmids using intermediate plasmid R-ACE3 as the backbone. Double digestion of intermediate plasmid R-ACE3 with restriction endonucleases PacI / XbaI, and homologous recombination of three DNA fragments, ACE3zh-H, ACE3zh-R and ACE3zh-K, with double-digested R-ACE3 using a One Step Clone Kit to construct three ACE3 mutant plasmids M-ACE3-705H, M-ACE3-705R and M-ACE3-705K (B in Figure 1).

[0087] Example 3 Construction of recombinant Trichoderma reesei strain

[0088] The three ACE3 mutant plasmids M-ACE3-705H, M-ACE3-705R, and M-ACE3-705K constructed in Example 2 were introduced into *Trichoderma reesei* to obtain recombinant *Trichoderma reesei* strains (Figure 2). In this invention, plasmid introduction into *Trichoderma reesei* is achieved by Agrobacterium-mediated transformation followed by cloning screening. The coding gene of the ACE3 mutant replaces the original ACE3 coding gene in the *Trichoderma reesei* genome, forming recombinant *Trichoderma reesei* strains.

[0089] (1) Three ACE3 mutant plasmids, M-ACE3-705H, M-ACE3-705R, and M-ACE3-705K, were electroporated into Agrobacterium to obtain three recombinant Agrobacterium strains. These three recombinant Agrobacterium strains were then co-cultured with either the Trichoderma reesei originating strain Rut-C30 (ATCC 56765) or PC-3-7 (ATCC 66589) on IM plates (Covert et al. Agrobacterium tumefaciens-mediated transformation of Fusarium circinatum. Mycol. Res. 105(3):259-264) for Agrobacterium-mediated binding transfer. After two days of co-culture, the transformants were transferred to PDA plates containing cefotaxime (300 μg / mL) and hygromycin B (75 μg / mL) for selection until transformants appeared. The correctness of the transformants was verified by PCR.

[0090] (2) Selecting transformants for marker deletion. The marker deletion method used is described in the literature (Zhang et al. Light-inducible genetic engineering and control of non-homologous end-joining in industrial eukaryotic microorganisms: LML 3.0 and OFN 1.0. Scientific Reports. 2016, 6:20761). In summary: Trichoderma reesei transformants were inoculated into xylose PDA liquid medium (containing 20 g / L xylose, 100 g / L potato water, and no agar) to induce resistance gene deletion. After incubation at 28℃ and 200 rpm for 48 h, a small amount of mycelium was picked and spotted onto xylose PDA solid medium (containing 20 g / L xylose, 100 g / L potato water, and 20 g / L agar) plates and incubated at 28℃ for 5-7 days. Spores were then collected. The spores were diluted serially onto xylose PDA solid medium plates. After incubating at 28℃ for 48 h, an appropriate spore concentration was selected to allow *Trichoderma reesei* strains to grow as monoclonal clones from xylose PDA solid medium plates. Agar blocks containing *Trichoderma reesei* monoclonal strains were picked and placed on glucose PDA solid medium plates (containing 20 g / L glucose, 100 g / L potato syrup, and 20 g / L agar), and incubated at 28℃ for 24 h to allow the fungal hyphae in the agar blocks to spread onto the plates. These agar blocks were then transferred to resistance PDA wells (containing 20 g / L glucose, 100 g / L potato syrup, 20 g / L agar, 150 μg / ml hygromycin B, and 150 μg / ml cephalosporin), and incubated at 28℃ for 48 h to verify the success of resistance deficiency: if growth was not observed in the resistance PDA wells, resistance deficiency was confirmed. After removing the agar blocks, the PDA plates were incubated at 28°C for 4-6 days to allow the spreading mycelia to grow fully and produce spores. The spores of the resistance-deficient strains were collected. Recombinant Trichoderma reesei strains without resistance markers were obtained: RutC30::ACE3-705H, RutC30::ACE3-705R, RutC30::ACE3-705K, PC37::ACE3-705H, PC37::ACE3-705R, and PC37::ACE3-705K.

[0091] (3) The above six recombinant Trichoderma reesei strains were inoculated into 50 mL of fermentation medium in a 250 mL Erlenmeyer flask, with an inoculation amount of 10 mL / mL. 8 One spore per 50 mL of medium, cultured at 28°C and 220 rpm. Cellulase activity was measured on day 7. The *Trichoderma reesei* strains Rut-C30 and PC-3-7 were used as controls.

[0092] After 7 days of culture in cellulose medium, the filter paper enzyme activity (FPase), representing the overall cellulase activity, of the fermentation supernatant expressing the ACE3 mutant Trichoderma reesei was 1.5–2 times that of the starting strain (Figure 3). At this time, the cellulase endonuclease activity (CMCase) and cellulase exonuclease activity (pNPCase), representing partial cellulase activity, were 1.5–2.1 times (Figure 4) and 1.7–2.1 times (Figure 5) of the starting strain, respectively. These results indicate that the serine mutation at position 705 of ACE3 significantly enhances cellulase expression.

[0093] After culturing in cellulose medium for 7 days, the extracellular protein concentration in the fermentation broth of the recombinant *Trichoderma reesei* strain expressing the ACE3 mutant was approximately double that of the starting strain (Figure 6). These results indicate that the serine mutation at position 705 of ACE3 significantly increases cellulase production.

[0094] In summary, the three mutants of the key transcriptional activator ACE3 of cellulase disclosed in this invention can more efficiently activate cellulase expression in *Trichoderma reesei* compared to wild-type ACE3, significantly increasing cellulase yield. This research demonstrates for the first time that these ACE3 mutants are of great significance for large-scale production, increasing the yield of lignocellulose-degrading enzymes, and reducing production costs, and have promising application prospects in fields such as feed, textiles, and bioenergy enzymes.

[0095] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A Trichoderma reesei transcription activator ACE3 mutant for enhancing cellulase expression levels, characterized in that, The Trichoderma reesei transcription activator ACE3 mutant is any one of (1)-(2): (1) a protein with an amino acid sequence as shown in any one of SEQ ID NO.2~4; (2) a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of the protein in (1).

2. A gene encoding a mutant of Trichoderma reesei transcription activator ACE3 for enhancing cellulase expression levels, characterized in that, The nucleotide sequence of the encoding gene is shown in any one of SEQ ID NO. 11-13.

3. A biomaterial, characterized in that, The biological material is a recombinant plasmid or a recombinant Agrobacterium; the recombinant plasmid includes the coding gene as described in claim 2; the recombinant Agrobacterium includes the recombinant plasmid.

4. The application of the Trichoderma reesei transcription activator ACE3 mutant as described in claim 1, the encoding gene as described in claim 2, or the biological material as described in claim 3 in enhancing the expression level of cellulase in Trichoderma reesei.

5. A method for increasing the expression level of cellulase in Trichoderma reesei, characterized in that, The method includes the step of mutating the original ACE3 coding gene in the genome of the Trichoderma reesei originating strain to the coding gene described in claim 2, thereby constructing a recombinant Trichoderma reesei; wherein the Trichoderma reesei originating strain is Trichoderma reesei ATCC 56765 or Trichoderma reesei ATCC 66589.

6. A recombinant Trichoderma reesei constructed according to the method of claim 5.

7. The use of the recombinant Trichoderma reesei as described in claim 6 in the production of cellulase.

8. A method for producing cellulase, characterized in that, The method includes the step of fermenting and culturing the recombinant Trichoderma reesei as described in claim 6 to prepare the cellulase.

9. A method for enhancing the expression of cellulase from Trichoderma reesei transcription activator ACE3, characterized in that, The method includes the step of mutating amino acid position 705 of the wild-type ACE3 protein to a basic amino acid; the basic amino acid is histidine, arginine or lysine; the amino acid sequence of the wild-type ACE3 protein is shown in SEQ ID NO.1.

Images