Use of trichostatin a in promoting proliferation of rna viruses
By using trogostatin A to promote the -1 Ribosomal Frameshifting process of RNA viruses, the problem of low viral replication and proliferation efficiency in existing technologies has been solved, resulting in reduced vaccine production costs and shorter production cycles.
Patent Information
- Application Number
- CN202511783465.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-01
- Publication Date
- 2026-02-24
- Estimated Expiration
- 2045-12-01
AI Technical Summary
Existing technologies are unable to effectively promote the -1 Ribosomal Frameshifting process of RNA viruses, resulting in low viral replication and proliferation efficiency, which increases vaccine production costs and time.
Using trogostatin A as a promoter, it promotes ribosome frameshifting by binding to the -1 ribosomal frameshifting process of RNA viruses, thereby improving viral replication and proliferation efficiency.
It significantly promotes the -1 Ribosomal Frameshifting process of RNA viruses such as PRRSV and PEDV, reducing vaccine production costs and shortening the production cycle.
Smart Images

Figure CN121203978B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of chemical medicine, specifically relating to the application of trogostatin A in promoting the proliferation of RNA viruses. Background Technology
[0002] The "-1 Ribosomal Frameshifting" phenomenon during ribosome elongation is common in RNA viruses, not only in PRRSV (Porcine Reproductive and Respiratory Syndrome Virus), but also in viruses such as IBV (Infectious Bronchitis Virus), HIV-1 (Human Immunodeficiency Virus 1), and SARS (Severe Acute Respiratory Syndrome Coronavirus). This process consists of three steps: First, a pseudoknot structure in the mRNA forces the ribosome to stop during the elongation phase, at which point the anticodon loops of aminoacyl-tRNA at site A and peptidyl-tRNA at site P bind to the sliding sequence of the mRNA. Second, the sliding sequence causes a -1 shift in the tRNAs. Finally, the downstream mRNA pseudoknot is opened, and the ribosome continues to move forward, but the reading frame is altered. Studies have shown that the sliding sequence in PRRSV is "UUUAAAC," followed by a three-necked pseudoknot structure that mediates ribosome retreat. When the ribosome moves to the sliding sequence, the tRNA detaches from the ribosome, causing the ribosome to slide back one step, resulting in a "-1 Ribosomal Frameshifting" in the reading frame. The tRNA then re-enters its position, the peptidyl transfer center remains unaffected, the nascent polypeptide chain does not detach, and the ribosome continues translation of ORF1b. This mechanism gives viruses advantages such as a streamlined genome, rapid replication, and high efficiency in utilizing genetic material, thereby promoting rapid viral proliferation within host cells.
[0003] Inactivated and live attenuated vaccines made from viruses are currently the most important means of preventing and controlling some diseases. Therefore, if the viral Frameshifting process can be effectively promoted, viral replication can be promoted. This strategy can be used to reduce the production cost of inactivated or live attenuated vaccines and shorten the production cycle, and has broad application prospects. Summary of the Invention
[0004] Therefore, the purpose of this invention is to provide the application of trogostatin A in promoting the proliferation of RNA viruses.
[0005] The technical solution provided by this invention is as follows:
[0006] The application of trogostatin A in promoting RNA virus proliferation includes at least one of the following:
[0007] To prepare products that promote the proliferation of RNA viruses;
[0008] Prepare products for the treatment and / or prevention of diseases caused by said RNA virus infection.
[0009] Qugu antibacterial agent A is an organic compound with the chemical formula C. 17 H 22 N₂O₃, with a molecular weight of 302.37 and CAS number 58880-19-6, has the following structural formula: .
[0010] In one embodiment of this application, the preparation of a product for treating and / or preventing diseases caused by the RNA virus infection specifically includes: preparing an inactivated vaccine or a live attenuated vaccine for the RNA virus.
[0011] In one embodiment of this application, the RNA virus is one or more of PRRSV (Porcine Reproductive and Respiratory Syndrome Virus), PEDV (Porcine Epidemic Diarrhea Virus), and TGEV (Porcine Transmissible Gastroenteritis Virus).
[0012] In one embodiment of this application, the disease caused by PRRSV is porcine reproductive and respiratory syndrome;
[0013] The disease caused by PRDV is porcine epidemic diarrhea;
[0014] The disease caused by TGEV is transmissible gastroenteritis in pigs.
[0015] In one embodiment of this application, the trogostatin A can promote the -1Ribosomal Frameshifting process of the RNA virus.
[0016] In one embodiment of this application, the trogostatin A can promote the replication of progeny viruses in RNA viruses.
[0017] In one embodiment of this application, the trogostatin A promotes the replication and proliferation of the RNA virus within host cells.
[0018] Compared with the prior art, the beneficial effects of the present invention are:
[0019] This application reveals a novel use of trichostatin A in promoting the proliferation of RNA viruses, specifically RNA viruses exhibiting the -1 ribosomal frameshifting process. Trichostatin A effectively promotes the replication and proliferation of RNA viruses, and further reveals that trichostatin A effectively promotes the -1 ribosomal frameshifting process (i.e., the -1 ribosome frameshifting process) of RNA viruses.
[0020] This application discloses novel uses of trachostatin A in the preparation of products that promote the proliferation of RNA viruses, and in the preparation of products for the treatment and / or prevention of diseases caused by RNA virus infection. These RNA viruses, such as PRRSV, PEDV, and TGEV, primarily cause porcine reproductive and respiratory syndrome (PRRS), porcine epidemic diarrhea (PED), and transmissible gastroenteritis (TGEV), respectively. Trachostatin A can be used in the production of inactivated or attenuated vaccines against RNA viruses, effectively promoting RNA virus proliferation, thereby significantly reducing production costs and shortening the production cycle. This use of trachostatin A has broad application prospects and economic value. Attached Figure Description
[0021] To more clearly illustrate the technical solutions in the embodiments of this application or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0022] Figure 1 The diagram shows the design principle (a), experimental procedure (b), and experimental results (c) of quachostatin A promoting the PRRSV ribosome frameshift process in a luciferase reporter system.
[0023] Figure 2 The diagram shows the design principle (a), experimental procedure (b), and experimental results (c) of trogostatin A promoting the PRRSV ribosome frameshift process in a fluorescent protein reporter system.
[0024] Figure 3 The results of toxicity experiments on wild-type MARC-145 cells with different concentrations of trogostatin A are shown.
[0025] Figure 4 The results show the efficacy of different concentrations of trogostatin A in promoting the proliferation of intracellular PRRSV.
[0026] Figure 5 This is the result of an experiment on the proliferation of live PRRSV virus by trogostatin A.
[0027] Figure 6 The results of the experiment on the proliferation of live PEDV virus by qugustatin A are presented. Detailed Implementation
[0028] The following embodiments are used to illustrate the present invention, but are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of protection of the present invention. Unless otherwise specified, the experimental materials, reagents, instruments, etc., used in the embodiments of the present invention are commercially available; unless otherwise specified, all technical means in the embodiments of the present invention are conventional means well known to those skilled in the art.
[0029] Example 1
[0030] Evaluation of the promoting effect of trogostatin A on the -1 Ribosomal Frameshifting process of PRRSV (luciferase reporter system).
[0031] 1. Experimental Methods
[0032] The promoting effect of a drug (trigustatin A) on the -1 ribosomal frameshifting process of PRRSV was studied using in vitro cell culture. First, a lentiviral vector containing the PRRSV viral genome sliding sequence was constructed, and the drug's effect was detected in the porcine alveolar macrophage line 3D4 / 21 at a concentration of 1 μM.
[0033] 1.1. Carrier Construction:
[0034] (1) Synthesis of the PRRSV virus-1 Ribosomal Frameshifting sliding region gene sequence. The lentiviral backbone vector was double-digested with EcoRI and BamHI. Digestion conditions: 37℃ for 15 minutes. After digestion, the digestion products were recovered by nucleic acid electrophoresis. For the synthesized PRRSV virus-1 Ribosomal Frameshifting sliding region gene sequence, it was first denatured at 95℃ for 10 minutes and annealed at 72℃ for 30 seconds. Then, the annealed product and the digestion product were mixed at a ratio of annealed product: digestion product = 3:1. 10 μL of T4 ligase was added to the above mixture, and ligation was carried out in a constant temperature metal bath at 16℃ for 16 hours. Plasmid transformation of competent cells: Competent cells were removed from a -80°C freezer and thawed on ice. A lentiviral vector containing the PRRSV virus-1 Ribosomal Frameshifting gene sequence was added to every 100 μL of competent cells, mixed thoroughly, and placed on ice for 30 minutes. The mixture was then placed in 42°C water for 90 seconds for heat shock. After heat shock, the mixture was cooled on ice for 10 seconds. The cooled mixture was transferred to a solid LB agar plate, and the liquid was evenly spread on the surface of the solid LB medium using a glass rod. The plate was then inverted and incubated at 37°C for 16 hours. After incubation, single-clone plaques were picked up with a pipette tip and inoculated into liquid LB medium. After incubation at 37°C for 8 hours, the plates were sent for sequencing. Single clones with correct sequencing results were amplified and plasmids were extracted.
[0035] (2) Through homologous recombination, Renal luciferase was constructed upstream of the -1 Ribosomal Frameshifting region, and firefly luciferase was constructed downstream of the -1 Ribosomal Frameshifting region. The specific method is as follows: The Renal luciferase gene sequence was amplified by PCR, and homologous arms were added upstream and downstream of the sequence, respectively. The vector obtained in step (1) was subjected to PCR to obtain a linearized vector. The gel recovery products of Renal luciferase and linearized vector were obtained by nucleic acid electrophoresis and gel recovery. Homologous recombination: The gel recovery products of Renal luciferase and linearized vector were mixed at a mass ratio of 3:1, and 2 μL of homologous recombination enzyme was added. The mixture was reacted at 37°C for 15 minutes.
[0036] (3) Transform competent cells with plasmids, select single clones and sequence them, and amplify and extract plasmids from viral backbone vectors with correct sequencing. The transformation of competent cells and extraction steps are the same as in step (1).
[0037] 1.2. Establishing a cell screening system:
[0038] (1) The viral backbone vector containing dual luciferase and -1 Ribosomal Frameshifting region, PMD2.G, and pspax2 packaging vector were mixed with PEI (full name: Polyethylenimine) in a volume ratio of 4:2:1. 70 micrograms of PEI were added for every 35 micrograms of DNA and transfected into 293T cells.
[0039] (2) Collect the culture supernatant of 293T cells 48h and 72h after transfection with viral plasmid, centrifuge at 12000g for 10min to remove cell impurities, and then collect lentivirus particles by cesium chloride gradient centrifugation.
[0040] (3) See Figure 1 As shown in Figure b, lentiviral particles were added to 3D4 / 21 cells. Seven days after infection, positive cells were selected using Puro (puromycin selection). Cells were digested with trypsin to prepare single-cell suspensions, which were then sorted by flow cytometry.
[0041] (4) Genotyping of cultured monoclonal cells and expansion culture of positive clones to obtain 3D4 / 21 cells (CMV-Renilla-framshift-Firefly) containing the -1 Ribosomal Frameshifting region.
[0042] 1.3. Experimental steps for drug-induced ribosomal frashifting:
[0043] (1) 3D4 / 21 cells containing -1 Ribosomal Frameshifting region were cultured into 96-well plates. After 24 hours of culture, candidate compounds (control group: DMSO; experimental group: qugustatin A) were added to the plates at a concentration of 1 μM.
[0044] (2) After culturing for 8 hours, the cells were lysed, firefly luciferase substrate was added to the lysate, and the luminescence value was detected by an enzyme-linked immunosorbent assay (ELISA) reader.
[0045] (3) Add the Renaissance luciferase substrate and detect the luminescence value using an enzyme-linked immunosorbent assay (ELISA) reader.
[0046] (4) The ratio of firefly luciferase to kidney luciferase was used as a reference for the -1 Ribosomal Frameshifting efficiency. A larger ratio indicates a higher -1 Ribosomal Frameshifting efficiency, meaning that the candidate molecule can better promote the -1 Ribosomal Frameshifting process.
[0047] 2. Experimental Results
[0048] Experimental results are as follows Figure 1 As shown, Figure 1 This document presents a schematic diagram of the design principle, experimental procedure, and experimental results for the promotion of PRRSV ribosomal frameshifting by trogostatin A in a luciferase reporter system. Figure 1 In the 'a' scheme, the reporter gene is designed as follows: when ribosome frameshift occurs normally, both the reporter genes Renilla luciferase and Firefly luciferase are expressed. When ribosome frameshift is blocked, the reporter gene Renilla luciferase is expressed, but Firefly luciferase is not expressed. Conversely, when ribosome frameshift is promoted, Firefly luciferase expression increases. Figure 1 In section b, the reporter system workflow is as follows: First, the reporter vector is stably integrated into the host cells (porcine alveolar macrophage line 3D4 / 21) via a lentiviral vector. Positive monoclonal cells are then treated with compounds (control group: DMSO; experimental group: trogostatin A). The promoting effect of the compounds on the PRRSV ribosome frameshift process is determined using a dual-luciferase reporter gene assay kit and an enzyme-linked immunosorbent assay (ELISA) reader. Figure 1 In the figure, c represents the effect of 1 μM trichostatin A on the -1 Ribosomal Frameshifting process of PRRSV, while the control group was treated with 1 μM DMSO. Figure 1 As shown in Figure c, 1 μM of trichostatin A has a highly significant promoting effect on the -1 ribosomal frameshifting process of PRRSV (*** indicates P < 0.001).
[0049] Example 2
[0050] Evaluation of the promoting effect of trogostatin A on the -1 Ribosomal Frameshifting process of PRRSV (fluorescent protein reporter system).
[0051] 1. Experimental Methods
[0052] To further determine the promoting activity of trichostatin A on the -1 Ribosomal Frameshifting process of PRRSV, a reporter gene system based on short-half-life fluorescent proteins was constructed. First, ubiquitin was ligated to RFP (red fluorescent protein) to obtain UbRFP (ubiquitin-RFP). Then, Firefly luciferase and Renilla luciferase in the dual-luciferase reporter system were replaced with Ub-RFP and GFP (green fluorescent protein), respectively. The updated reporter system was: CMV-UbRFP-Frameshift-GFP (see [link to CMV-UbRFP-Frameshift-GFP]). Figure 2 (As shown in a). For the assay, CMV-UbRFP-Frameshift-GFP cells were passaged in 96-well plates 24 hours in advance, ensuring cell confluence reached 80%–90% at the time of drug addition. DMSO or 1 μM trichostatin A was added to the culture dish for 1 hour, followed by 5 μM MG-132 (a proteasome inhibitor) for another 3 hours. Each group had three replicates. The fluorescence ratio of GFP to RFP was obtained using fluorescence microscopy. A higher ratio indicates higher -1 Ribosomal Frameshifting efficiency, while a lower ratio indicates lower efficiency. A higher ratio indicates that trichostatin A promotes the -1 Ribosomal Frameshifting process more effectively.
[0053] 2. Experimental Results
[0054] Experimental results are as follows Figure 2 As shown, Figure 2 This document presents a schematic diagram of the design principle, experimental procedure, and experimental results for the use of trichostatin A in a fluorescent protein reporter system to promote the PRRSV ribosome frameshift process. Figure 2 In the design scheme of the fluorescent protein reporter system, when ribosome frameshift occurs normally, both the reporter genes GFP and RFP are expressed. When ribosome frameshift is blocked, the reporter gene GFP is expressed, but RFP is not expressed. Conversely, when ribosome frameshift is promoted, RFP expression increases. Figure 2 In section b, the workflow of the fluorescent protein reporter system is as follows: First, the reporter vector is stably integrated into the host cell (porcine alveolar macrophage line 3D4 / 21) via a lentiviral vector. Positive monoclonal cells are then treated with compounds (control group: DMSO; experimental group: qugustatin A). Fluorescence images are obtained using a high-content fluorescence microscope, and the effect of the compounds on the PRRSV ribosome frameshift process is determined by fluorescence signal analysis. Figure 2In the figure, c represents the effect of 1 μM trichostatin A on the -1 Ribosomal Frameshifting process of PRRSV, while the control group was treated with 1 μM DMSO. Figure 2 As can be seen from c, 1 μM trogostatin A also has a highly significant promoting effect on the -1 ribosomal frameshifting process of PRRSV (*** indicates P < 0.001).
[0055] Example 3
[0056] To evaluate the efficacy and toxicity of trogostatin A in promoting PRRSV-1 ribosomal frashifting.
[0057] 1. Experimental Methods
[0058] To further determine the promoting effect of trogostatin A on PRRSV virus-1 ribosomal frashifting, cytotoxicity was tested in wild-type MARC-145 cells by adding different concentrations of trogostatin A (0.001, 0.05, 0.1, 0.2, 0.5, 1, 2, 5, 10, 20 μM) to the culture supernatant of MARC-145 cells.
[0059] To determine its effectiveness, we modified MARC-145 cells and integrated the luciferase reporter gene into the MARC-145 cell genome by infection with lentivirus (the lentivirus obtained in Example 1), and added different concentrations of trichomoniasis A (0.001, 0.05, 0.1, 0.2, 0.5, 1 μM).
[0060] 2. Experimental Results
[0061] Cytotoxicity test results as follows Figure 3 As shown, the CC50 of trichomoniasis A in MARC-145 cells was 2.022 μM. That is, the half-maximal toxic concentration (CC50) of trichomoniasis A in MARC-145 cells was 2.022 μM.
[0062] The results of the effectiveness experiment are as follows Figure 4 As shown, trogostatin A promotes the -1 Ribosomal Frameshifting process of PRRSV virus, with a minimum effective concentration of 0.2 μM, and this concentration of trogostatin A is not toxic to wild-type MARC-145 cells.
[0063] Example 4
[0064] To evaluate the promoting activity of trogostatin A against live PRRSV.
[0065] 1. Experimental Methods
[0066] To further determine the promoting activity of trogostatin A against in vivo PRRSV, an in vitro culture and detection system for PRRSV was constructed. First, in a biosafety level II laboratory, MARC-145 cells were cultured at a concentration of 2 × 10⁶ cells / mL. 5 Cells were seeded at a rate of 0.1 mI / ml in 6-well plates. The NC group received no virus. After 24 hours of culture, cells were infected with 0.1 MOI of virus per well. After another 24 hours, either 0.2 μM trichostatin A or DMSO (as a positive control) was added. The negative control group (NC group) received no virus. After culturing at 37°C for 24 hours, cells were collected, total RNA was extracted using the Trizol method, cDNA was obtained using a reverse transcription kit, and the PRRSV viral copy number was detected by qPCR.
[0067] The qPCR primers are as follows:
[0068] PRRSVORF7-F AAACCAGTCCAGAGGCAAGG,
[0069] PRRSVORF7-R GCAAACTAAACTCCACAGTGTAA;
[0070] GAPDH-F GAAGGTGAAGGTCGGAGTCA,
[0071] GAPDH-R CATGTAAACCATGTAGTTGAGGTC.
[0072] 2. Experimental Results
[0073] See the experimental results. Figure 5 As shown, 0.2 μM trichostatin A has a highly significant promoting effect on the proliferation of PRRSV in vitro (*** indicates P < 0.001). This indicates that trichostatin A has a highly significant promoting effect on the proliferation of live PRRSV.
[0074] Example 5
[0075] To evaluate the promoting activity of qugustatin A against live PEDV (porcine epidemic diarrhea virus).
[0076] 1. Experimental Methods
[0077] Experiments were conducted under P2 laboratory conditions. PEDV virus (G2c strain) was cultured in Vero (African green monkey kidney) cells, and trypsin was added to promote viral adsorption. Two hours after infection, the culture medium was replaced with normal medium. Twenty-four hours later, 0.2 μM trichostatin A or DMSO (as a positive control) was added. The negative control group (NC group) did not receive any virus. After culturing at 37°C for 24 hours, cells were collected, total RNA was extracted using the Trizol method, and cDNA was obtained using a reverse transcription kit.
[0078] The qPCR primers are as follows:
[0079] PEDV MF GGTTGCTACTGGCGTACAGGTA,
[0080] PEDV MR GAAGCATTGACTGAACGACCAACA;
[0081] GAPDH-F GAAGGTGAAGGTCGGAGTCA,
[0082] GAPDH-R CATGTAAACCATGTAGTTGAGGTC.
[0083] 2. Experimental Results
[0084] See the experimental results. Figure 6 As shown, 0.2 μM trichostatin A has a highly significant promoting effect on the proliferation of PEDV cultured in vitro (*** indicates P < 0.001). This indicates that trichostatin A has a highly significant promoting effect on the proliferation of live PEDV.
[0085] In summary, trogostatin A significantly promotes the -1 ribosome frameshift process of RNA viruses such as porcine reproductive and respiratory syndrome virus (PRRSV) and porcine epidemic diarrhea virus (PEDV). The CC50 of trogostatin A in MARC-145 cells is 2.022 μM, and the lowest effective concentration of trogostatin A to promote the -1 ribosome frameshift process of PRRSV is 0.2 μM, which is not toxic to wild-type MARC-145 cells. At a concentration of 0.2 μM, trogostatin A significantly promotes the -1 ribosome frameshift process of PEDV. The results indicate that qugustatin A significantly promotes the -1 ribosomal frameshift process of porcine reproductive and respiratory syndrome virus (PRRSV) and porcine epidemic diarrhea virus (PEDV), effectively promoting the replication and proliferation of PRRSV and PEDV. Therefore, qugustatin A can be used to prepare products that promote the proliferation of PRRSV and PEDV, as well as products for the treatment and / or prevention of diseases caused by PRRSV and PEDV infection. Specifically, it can be used in the preparation of inactivated or live attenuated vaccines for PRRSV and PEDV. By promoting viral proliferation, it can reduce production costs and shorten the production cycle, demonstrating broad application prospects and value.
Claims
1. The application of trogostatin A in promoting RNA virus proliferation includes at least one of the following: To prepare products that promote the proliferation of RNA viruses; The preparation of products for preventing diseases caused by the aforementioned RNA virus infection specifically includes: Prepare an inactivated or attenuated vaccine for the RNA virus; The RNA viruses mentioned are PRRSV and PEDV; The host cell in which the trogostatin A promotes PRRSV proliferation is MARC-145 cells. The host cell in which the quabustatin A promotes PEDV proliferation is Vero cells.
2. The application of trogostatin A according to claim 1 in promoting RNA virus proliferation, characterized in that: The disease caused by PRRSV is porcine reproductive and respiratory syndrome; The disease caused by PRDV is porcine epidemic diarrhea.
3. The application of trogostatin A according to claim 1 in promoting RNA virus proliferation, characterized in that, The trogostatin A can promote the -1 Ribosomal Frameshifting process of the RNA virus.
4. The application of trogostatin A according to claim 1 in promoting RNA virus proliferation, characterized in that, The quabustatin A can promote the replication of progeny viruses in RNA viruses.
5. The application of trogostatin A according to claim 1 or 4 in promoting RNA virus proliferation, characterized in that, The quabustatin A has a promoting effect on the replication and proliferation of the RNA virus in host cells.
Citation Information
Patent Citations
Compounds accelerating duplication of herpes simplex virus and application
CN106551939A
Autologous HIV-1 proteins for the treatment of latent HIV-1 infection
US20160206689A1