Application of pepper loc107874641 gene in improving plant waterlogging tolerance

Abstract

The application provides a pepper LOC107874641 The application belongs to the technical field of genetic engineering, and relates to application of a pepper LOC107874641 The CDS sequence of the pepper LOC107874641 The application utilizes the transgenic technology of a promoter driving principle to transfer a plant overexpression vector of the pepper LOC107874641 The application finds that the transgenic Arabidopsis can improve the waterlogging tolerance of plants compared with wild-type Arabidopsis through a waterlogging stress experiment, and it is proved that the pepper

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and more particularly to chili peppers. LOC107874641 Application of genes in improving plant waterlogging tolerance. Background Technology

[0002] Waterlogging is extremely harmful to plants, severely disrupting their normal life activities. When soil moisture is excessive, air is displaced from the roots, leading to oxygen deficiency and preventing normal respiration. This results in anaerobic respiration, producing toxic substances such as alcohol and causing root rot. Simultaneously, the oxygen-deficient environment inhibits the roots' ability to absorb water and nutrients, causing drought-like wilting symptoms. Furthermore, waterlogging lowers soil temperature, slows root growth, and promotes the growth of pathogens and pests, further exacerbating root damage. Ultimately, plants suffer from stunted growth, yellowing and shedding of leaves, and in severe cases, death due to disrupted metabolism, nutrient deficiency, and disease invasion. In agricultural production, waterlogging also poses a significant threat, causing seed rot, a sharp drop in germination rates, poor seedling root development, and in mature plants, problems such as hindered pollination, reduced photosynthetic efficiency, and insufficient grain filling. Selecting plants with excellent waterlogging tolerance can reduce the impact of waterlogging on plant growth and improve plant adaptability.

[0003] LOC107874641 Gene-encoded cytokinin riboside 5'-monophosphate phosphoribohydrolase LOG4 belong LOG Gene family. LOG The LOG gene family is a key enzyme family involved in cytokinin metabolism. Their main function is to catalyze the conversion of cytokinin nucleotides into biologically active free bases. LOG proteins play a crucial role in the biosynthesis and activation of cytokinins, regulating plant growth and development, such as cell division, shoot growth, and root development. This gene family is widely found in green plants, including Arabidopsis thaliana, rice, and maize.

[0004] There is currently no direct evidence to suggest otherwise. LOC107874641 The gene itself possesses waterlogging tolerance. However, cytokinins may play an indirect role in plant responses to stresses such as waterlogging. For example, cytokinins can influence plant waterlogging tolerance by regulating plant hormone balance (such as interactions with ethylene and gibberellins). This invention will... LOC107874641 Heterologous gene transfer into Arabidopsis thaliana for overexpression and functional verification has preliminarily revealed its role in improving plant flood tolerance, filling a gap in [the study / exploration of this gene]. LOC107874641 A gap in gene function research. Summary of the Invention

[0005] The purpose of this invention is to provide chili peppers LOC107874641Application of genes in improving plant waterlogging tolerance.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0007] This invention provides chili peppers LOC107874641 The application of genes in improving the waterlogging tolerance of plants, specifically the pepper. LOC107874641 The CDS sequence of the gene is shown in SEQ ID NO.2.

[0008] Preferably, the chili pepper LOC107874641 The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0009] Preferably, the plants include Arabidopsis thaliana and pepper.

[0010] This invention provides a method for improving the waterlogging tolerance of plants, specifically by using chili peppers... LOC107874641 Genes were introduced into the target plant to obtain plants with improved waterlogging tolerance; the pepper... LOC107874641 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the CDS sequence is shown in SEQ ID NO.2.

[0011] Preferably, the plants include Arabidopsis thaliana and pepper.

[0012] Preferably, the chili peppers will be included during the import process. LOC107874641 Gene overexpression vectors are introduced into target plants.

[0013] Preferably, the vector skeleton of the plant overexpression vector is pCAMBIA2300.

[0014] Preferably, the method of introduction is the infection method.

[0015]

[0016] SEQ ID NO.2:ATGGAGAATGAAATGAAACAGTCAAAATTCAAGAATATTTGTGTGTTCTGTGGGAGTAGCACTGGAAAAAAGAGTATCTATAAGGAGGCTGCAATTGAGCTTGGAAGAGAACTAATAACTGGTGAA ACAGTAGGAGAGGTGAAGGCAGTGGCAGATATGCATCAGAGGAAAGCTGAGATGGCCAAACATTCTGATGCCTTTATTGCTTTACCTGGTGGCTATGGAACGCTAGAAGAGCTGCTTGAAGTCACTGCTTG GGCTTATCTTGGAATACATGATAAACCGGTAGGATTATTGAATGTGGATGGTTACTACAATTCCCTCTTGACATTTATTGACAAAGCAGTAGAGGAAGGATTCATCTGTTCCAACGCCCCCAAAATTTTTG TATCAGCTCCTAATGCCAAGGAACTTTTAAATAAACTCGAGGGGTACTTTCCAAGTGATGGAACTGTTGCCTCAAAACTTAATTGGGAAAACGAGGAGTTGGATTATTCCCAAGATAGTTCTACTGGCTAA

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] This invention utilizes promoter-driven transgenic technology to... LOC107874641 Transgenic material was obtained by transferring a plant overexpression vector of a gene into Arabidopsis thaliana. This invention, through flood stress experiments, found that transgenic Arabidopsis thaliana exhibited improved waterlogging tolerance compared to wild-type Arabidopsis thaliana, indicating that… LOC107874641 Genes play a crucial role in plant waterlogging tolerance. This invention fills a gap in [the understanding of this field]. LOC107874641 The lack of research on gene function provides a theoretical basis for cultivating plants with improved waterlogging tolerance, and has broad application prospects. Attached Figure Description

[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0020] Figure 1 The structural diagram of the pEGOEPubi-H-LOC107874641-GFP vector;

[0021] Figure 2 The expression levels are wild-type and the three positive strains (L1, L2, L3) with the highest expression levels.

[0022] Figure 3 Images showing the state of transgenic Arabidopsis thaliana and wild-type Arabidopsis thaliana before flooding, 2 days after flooding, and 1 day after recovery;

[0023] Figure 4 The relative electrical conductivity of transgenic Arabidopsis thaliana and wild-type Arabidopsis thaliana before flooding, 2 days after flooding, and 1 day after recovery;

[0024] Figure 5 The relative chlorophyll content of transgenic Arabidopsis thaliana and wild-type Arabidopsis thaliana before flooding, 2 days after flooding, and 1 day after recovery;

[0025] Figure 6 The POD activity of transgenic Arabidopsis thaliana and wild-type Arabidopsis thaliana was measured before flooding, 2 days after flooding, and 1 day after recovery.

[0026] Figure 7 The soluble sugar content of transgenic Arabidopsis thaliana and wild-type Arabidopsis thaliana was measured before flooding, 2 days after flooding, and 1 day after recovery. Detailed Implementation

[0027] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0028] Example 1: Obtaining Transgenic Arabidopsis

[0029] 1. Construct a structure containing chili peppers LOC107874641 Plant overexpression vector of gene and transformation of Agrobacterium

[0030] 1.1 Primer Design

[0031] LOC107874641-F (SEQ ID NO.3): ActagggtctcGcaccATGGAGAATGAAATGAAACAGTCAAAATTCA

[0032] LOC107874641-R (SEQ ID NO.4):ActagggtctcTcgccGCCAGTAGAACTATCTTGGGAATAATCC

[0033] 1.2 Amplification and Recovery of Target Fragment

[0034] Using the primer pairs described in SEQ ID NO.3 and SEQ ID NO.4 LOC107874641 The gene was amplified by PCR. The PCR reaction system is shown in Table 1, and the reaction conditions are shown in Table 2.

[0035] Table 1 PCR reaction system

[0036]

[0037] Table 2 PCR reaction conditions

[0038]

[0039] 1.3 Rubber Cutting and Recycling

[0040] The PCR products were detected by agarose gel electrophoresis. The correct electrophoretic fragments were excised and the target fragments were recovered using the agarose gel DNA recovery kit (DP209-03) from Tiangen Biotech Co., Ltd. The kit was operated according to the instructions. The enzyme digestion and ligation reaction system used is shown in Table 3, and the reaction conditions are shown in Table 4.

[0041] Table 3 Enzyme digestion-ligation reaction

[0042]

[0043] Table 4 Enzyme digestion-ligation reaction parameters

[0044]

[0045] 1.4 Transformation of Recombinant Plasmids

[0046] (1) Take a tube of 100 μL of DH5α Escherichia coli competent cells and mix it with 2-5 μL of ligation product, and incubate on ice for 30 min;

[0047] (2) Quickly place it in a 42℃ constant temperature water bath, heat shock for 90 s, then ice bath for 2 min;

[0048] (3) Add 500 μL of LB liquid culture medium and mix well;

[0049] (4) Incubate at 37℃ and 200rpm for 45min to allow the cells to return to normal growth.

[0050] (5) Spread the bacterial culture evenly on Kana-resistant LB solid medium plates;

[0051] (6) After 30 min, place in a 37℃ constant temperature incubator and incubate overnight.

[0052] 1.5 Bacterial Detection

[0053] Colony PCR was performed using UBI-F / eGFP-cx primers. Positive colonies were picked and cultured. The colony PCR detection system is shown in Table 5. Colony PCR reaction parameters: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 2 min, 25 cycles; 72℃ final extension for 5 min.

[0054] UBI-F: TTAGCCCTGCCTTCATACGC (SEQ ID NO.5)

[0055] eGFP-cx: GACACGCTGAACTTGTGG (SEQ ID NO.6)

[0056] Table 5 Colony PCR Amplification System

[0057]

[0058] 1.6 Plasmid Extraction:

[0059] (1) Pick single clones from LB solid medium plates and inoculate them into LB liquid medium with a final concentration of 50 μg / mL for kanamycin resistance, and incubate overnight at 37 °C;

[0060] (2) Take 4 mL of activated bacterial solution, centrifuge at 10000 rpm for 2 min at room temperature, and completely discard the supernatant;

[0061] (3) Take 250 μL of Solution I reagent containing ribonuclease A and thoroughly resuspend the bacterial block;

[0062] (4) Take 250 μL of Solution II reagent to lyse the bacterial block, and gently invert it several times until the bacterial cells become transparent;

[0063] (5) Take 350 μL of Solution Ⅲ reagent, invert it several times until a white, firm flocculent substance is formed;

[0064] (6) Centrifuge at 12,000 rpm for 10 min at room temperature and collect the supernatant;

[0065] (7) Remove the nucleic acid purification column from the kit and place it on the collection tube;

[0066] (8) Take the clear supernatant from step (6) above into a nucleic acid purification column, centrifuge at 12,000 rpm for 1 min at room temperature, and discard the filtrate;

[0067] (9) Add 500 μL of Buffer W1 to the nucleic acid purification column, centrifuge at 12000 rpm for 30 s at room temperature, and discard the filtrate;

[0068] (10) Add 700 μL of Buffer W2 to the nucleic acid purification column, centrifuge at 12000 rpm for 30 s at room temperature, and discard the filtrate;

[0069] (11) Repeat the above operation steps (10);

[0070] (12) Place the nucleic acid purification column on the collection tube and incubate at 12,000 rpm for 2 min at room temperature to remove as much residual liquid as possible;

[0071] (13) Discard the collection tube, place the nucleic acid purification column into a 1.5 mL EP tube, and add 50 μL of elution buffer to elute the DNA attached to the nucleic acid purification column membrane (the elution buffer should be preheated in a 65 ℃ constant temperature water bath to help elute the DNA), and let stand at room temperature for 2 min;

[0072] (14) Centrifuge at 12,000 rpm for 2 min at room temperature to wash off the DNA attached to the nucleic acid purification column membrane, and store at -40 ℃ for later use;

[0073] (15) Take a small amount of the recovered product and use 1% agarose gel electrophoresis to detect the plasmid extraction quality.

[0074] 1.7 Sequencing

[0075] The plasmid extracted from the above positive bacterial plaques was subjected to Sanger sequencing using the sequencing primers UBI-F / eGFP-cx. The sequencing results showed that the sequence matched the target fragment sequence, indicating that the overexpression vector was successfully constructed.

[0076] The constructed pEGOEPubi-H-LOC107874641-GFP vector map is shown below. Figure 1 As shown.

[0077] 1.8 Transformation of Agrobacterium

[0078] The constructed pEGOEPubi-H-LOC107874641-GFP vector was transformed into Agrobacterium competent cells (competent cells GV3101) to obtain recombinant Agrobacterium. Specific methods for transformation into Agrobacterium:

[0079] (1) Take out the competent Agrobacterium from the -80℃ freezer and thaw it on ice for about 5 minutes (until the bacterial solution becomes transparent).

[0080] (2) Under aseptic conditions, add 50 μL of competent Agrobacterium to the plasmid and gently pipette to mix.

[0081] (3) Place the centrifuge tubes in an ice-water bath, liquid nitrogen, 37°C water bath, and ice-water bath in sequence and let them stand for 5 minutes.

[0082] (4) Under aseptic conditions, add 800 μL of LB liquid culture medium into a centrifuge tube and incubate at 28°C and 180 rpm for 2.5 h with shaking.

[0083] (5) Centrifuge at 5000 rpm for 1 min, take out 700 μL of supernatant and discard it, leaving about 100 μL of supernatant. Gently blow the suspension and take 60 μL of bacterial culture for plating (solid culture medium containing kanamycin and rifampicin antibiotics). Incubate upside down in an incubator at 28℃ for 60 h.

[0084] (6) Bacterial test.

[0085] 2. Infection of Arabidopsis thaliana

[0086] Arabidopsis thaliana was infected using the inflorescence infection method. First, Agrobacterium carrying the target vector was cultured to O... =0.8~1.0, centrifuged, and resuspended in a infection solution containing 5% sucrose and 0.02% Silwet L-77; select healthy plants at the initial flowering stage (main inflorescence 3~5 cm), cut off the pod-forming parts, immerse the inflorescence in the bacterial solution for 20 seconds or add the bacterial solution dropwise to the flower buds, ensuring complete immersion; cover and keep moist for 24 hours after infection, then transfer back to normal conditions for culture (22°C, 16 h light / 8 h dark). After 4~6 weeks, harvest dried siliques, vernalize the seeds, and screen resistant seedlings on MS plates containing antibiotic (50 μg / mL Kanamycin). Transplant positive seedlings 7~10 days later, and verify successful transformation by PCR or fluorescent labeling. After the seeds mature, collect the T0 generation seeds in dry centrifuge tubes, dry the seeds, and store them at 4°C for vernalization.

[0087] 3. Obtaining Arabidopsis thaliana plants

[0088] The obtained Arabidopsis seeds were vernalized by soaking them in distilled water at 4°C for 3 days. They were then sown in a mixed nutrient soil, watered every 3 days and fertilized with Hoagland nutrient solution every 5 days, watering from the bottom until the soil surface was moist. The plants were cultured in a light-controlled incubation chamber (16 hours light / 8 hours dark, 25°C) for 30 days. Each Arabidopsis plant was labeled with a serial number, and DNA was extracted from leaves using the CTAB method and detected by PCR. A total of 13 transgenic lines were obtained. qRT-PCR was used to analyze the transgenic lines. LOC107874641 The expression levels in each strain were analyzed, and three plants with high expression levels (L1, L2, L3) were selected for subsequent analysis and plotting. Figure 2 ).

[0089] The primers used for PCR detection were UBI-F and eGFP-cx. The detection system is shown in Table 6. The PCR reaction program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 5 min.

[0090] Table 6 PCR detection system for positive strains

[0091]

[0092] The gene primers used for qRT-PCR detection are:

[0093] 4641-F: ACAGTAGGAGAGGTGAAGGCAGTG (SEQ ID NO.7)

[0094] 4641-R: CGTTCCATAGCCACCAGGTAAAGC (SEQ ID NO.8)

[0095] The internal control primers used for qRT-PCR detection are:

[0096] F: CTCCTTTGTTGCTGTTGACTAC (SEQ ID NO.9)

[0097] R: GCACAATGTTACCGTACAGATC (SEQ ID NO.10)

[0098] RNA was first extracted using the EZNA® Plant RNA Kit, and then reverse transcribed into cDNA using the Novizan kit before qRT-PCR detection. The detection system and procedure are shown in Tables 7 and 8.

[0099] Table 7 qRT-PCR detection system

[0100]

[0101] Table 8 qRT-PCR detection procedure

[0102]

[0103] Example 2

[0104] Using transgenic Arabidopsis thaliana (L1, L2, L3) and wild-type (WT) Arabidopsis thaliana seedlings as experimental materials, 30 seedlings of each variety with uniform growth and cultured for 30 days were selected and submerged (to completely submerge the soil surface). After two days of submersion, the seedlings were removed and allowed to recover. Samples were taken before submersion (0d), 2 days after submersion (2d), and 1 day after recovery (R1d) for subsequent physiological index testing.

[0105] like Figure 3 As shown, before flooding, both transgenic and wild-type Arabidopsis thaliana had green leaves, sturdy plants, and healthy overall growth, with no significant differences. Two days after flooding, most of the leaves of the wild-type Arabidopsis thaliana turned purple, became thinner, and began to curl, while the transgenic Arabidopsis thaliana showed no significant changes. One day after recovery, almost all of the wild-type Arabidopsis thaliana turned purple, with the basal leaves turning yellow and wilting, while only a very few leaves of the transgenic Arabidopsis thaliana turned yellow and curled, creating a strong contrast with the wild type. It is clear that the transgenic Arabidopsis thaliana is more tolerant to flooding stress.

[0106] like Figure 4 As shown, after two days of flooding stress, the relative conductivity of wild-type Arabidopsis thaliana increased significantly, while the overall conductivity of the transgenic Arabidopsis thaliana lines L1, L2, and L3 increased by approximately 5%. After one day of recovery, the relative conductivity of wild-type Arabidopsis thaliana decreased by approximately 5%, while the transgenic Arabidopsis thaliana showed no significant change overall. This indicates that... LOC107874641 The gene is associated with flood tolerance and can effectively alleviate the damage caused by flooding stress to Arabidopsis thaliana.

[0107] like Figure 5 As shown, before flooding, there was no significant difference in the relative chlorophyll content between wild-type and transgenic plants. After two days of flooding, the relative chlorophyll content of wild-type Arabidopsis thaliana decreased significantly by about 10%, while the overall decrease in transgenic Arabidopsis thaliana was not significant. After one day of recovery, both types showed an increase, with little change. However, the relative chlorophyll content of transgenic Arabidopsis thaliana was higher than that of wild-type.

[0108] like Figure 6 As shown, before flooding, there was no significant difference in peroxidase (POD) activity between wild-type and transgenic lines. After two days of flooding, both showed an increase, with the transgenic lines showing an increase in POD activity that was about twice that of the wild-type. One day after recovery, both wild-type and transgenic plants showed an increase in POD activity. There was no significant difference in POD activity between transgenic plants, but there was a significant difference in POD activity compared to the wild-type.

[0109] like Figure 7As shown, before flooding, the soluble sugar content of wild-type and transgenic plants was approximately 10 mg / g with no significant difference. After two days of flooding, the soluble sugar content of wild-type plants increased to approximately 12 mg / g, while that of transgenic plants increased to approximately 15 mg / g. There was no significant difference between transgenic plants, but there was a significant difference compared to wild-type plants. During the one-day recovery period, the soluble sugar content continued to increase, and the content of transgenic plants was significantly higher than that of wild-type plants.

[0110] As can be seen from the above, overexpression LOC107874641 Transgenic Arabidopsis thaliana exhibits enhanced tolerance to flooding stress, indicating that... LOC107874641 Genes play an important role in the waterlogging tolerance of plants.

[0111] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Overexpressing chili peppers LOC107874641 The application of genes in improving plant waterlogging tolerance is characterized by, The chili pepper LOC107874641 The CDS sequence of the gene is shown in SEQ ID NO.2, and the plant is Arabidopsis thaliana.

2. A method for improving the waterlogging tolerance of plants, characterized in that, chili peppers LOC107874641 Genes were introduced into the target plant to obtain plants with improved waterlogging tolerance; the pepper... LOC107874641 The CDS sequence of the gene is shown in SEQ ID NO.2, and the plant is Arabidopsis thaliana.

3. The method according to claim 2, characterized in that, The import will contain the chili peppers mentioned above. LOC107874641 Gene overexpression vectors are introduced into target plants.

4. The method according to claim 3, characterized in that, The vector backbone of the plant overexpression vector is pCAMBIA2300.

5. The method according to claim 2, characterized in that, The method used for importation is the infiltration method.

Images