Application of MYBS3 gene in regulating content of anthocyanin and luteolin in honeysuckle flower

Abstract

The application belongs to the technical field of biology and particularly relates to application of MYBS3 gene in regulating content of anthocyanin and luteolin in honeysuckle flower. The nucleotide sequence of the MYBS3 gene is shown as SEQ ID NO. 1, and the MYBS3 gene is up-regulated in expression under low-temperature stress by spraying Ca 2+ in honeysuckle flower. The recombinant plasmid containing the MYBS3 gene can obviously improve expression levels of anthocyanin synthase (ANS) and flavone synthase (FNS) in leaves. The recombinant plasmid containing the MYBS3 gene can obviously improve content of anthocyanin and luteolin in leaves of honeysuckle flower.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the application of the MYBS3 gene in regulating the content of anthocyanins and luteolin in honeysuckle. Background Technology

[0002] Honeysuckle is a plant of the Caprifoliaceae family, specifically Lonicera japonica (Lonicera japonica). Lonicera Japonica Thunb The dried buds and newly opened flowers of honeysuckle are used to derive this plant from its rich content of flavonoids, phenolic acids, volatile oils, iridoids, and other active ingredients. In traditional medicine, honeysuckle possesses significant anti-allergic, anti-inflammatory, antibacterial, and antiviral effects. Besides its medicinal value, honeysuckle is also renowned for its excellent climbing ability and adaptability to various environments, giving it unique ornamental value and making it a top choice for three-dimensional landscaping.

[0003] Recent studies have found that the bioactive components in honeysuckle leaves may have stronger pharmacological effects than those in the flowers and stems, but reports on the active components of honeysuckle leaves are still limited. Flavonoids, as the main active components of honeysuckle, have important pharmacological effects. Luteolin, as one of the important indicators of honeysuckle quality, also has significant biological value in its precursor, luteolinin. Anthocyanins, as important natural pigments, can change the color of honeysuckle leaves, enhancing their ornamental value in landscaping, while also exhibiting excellent antioxidant, anti-inflammatory, and cardiovascular protective effects in medicinal applications.

[0004] Based on the above research background, regulating the expression of epigenetics in honeysuckle through transgenic technology to increase the content of flavonoids has become a key technological direction that urgently needs to be developed in this field, which is of great significance for improving the medicinal value and industrial benefits of honeysuckle. Summary of the Invention

[0005] This invention is the first to discover that the content of anthocyanins and luteolin in honeysuckle leaves overexpressed with MYBS3 is increased, and the relative expression levels of MYBS3, ANS, and FNS are higher in the overexpressed leaves. This indicates that MYBS3 can positively regulate the content of anthocyanins and luteolin in honeysuckle. Simultaneously, it was found that spraying Ca... 2+ After cold stress was applied to honeysuckle, the expression level of MYBS3 also increased. This indicates that Ca... 2+ It has a positive regulatory effect on MYBS3.

[0006] The purpose of this invention is to provide the application of the MYBS3 gene in regulating the content of anthocyanins and luteolin in honeysuckle.

[0007] To achieve the above-mentioned technical objectives, the technical solution adopted by the present invention is as follows:

[0008] The application of the MYBS3 gene in regulating the content of anthocyanins and luteolin in honeysuckle, wherein the nucleotide sequence of the MYBS3 gene is shown in SEQ ID NO.1, and the regulation is positive regulation.

[0009] Furthermore, the expression level of MYBS3 in honeysuckle was overexpressed.

[0010] Furthermore, the expression level of MYBS3 was increased by constructing an overexpression vector.

[0011] Furthermore, the overexpression vector is the pBI121 plasmid.

[0012] This invention also provides Ca spraying under cold stress 2+ This improves the expression level of MYBS3 in honeysuckle.

[0013] Furthermore, the honeysuckle plants were first sprayed with CaCl2, and then the plants that had been sprayed with CaCl2 were placed in a cold stress growth chamber for cultivation. During the cold stress period, the spraying experiment was repeated every once in a while.

[0014] Furthermore, the honeysuckle plants were first sprayed with CaCl2, and then the plants that had been sprayed with CaCl2 were placed in a cold stress growth chamber for cultivation. During the cold stress period, the spraying experiment was repeated every once in a while.

[0015] Furthermore, honeysuckle plants were first sprayed with 10 mM CaCl2 and cultured in a growth chamber with the same conditions as above: temperature 10℃, humidity 70%, light intensity 8000 Lux, and photoperiod of 12 hours light / 12 hours dark. During the cold stress period, the spraying experiment was repeated every five days.

[0016] The present invention also provides a method for increasing the content of anthocyanins and luteolin in honeysuckle, the method comprising the following steps: (1) constructing a recombinant vector containing the MYBS3 gene, the nucleotide sequence of the MYBS3 gene being shown in SEQ ID NO.1; (2) introducing the successfully constructed recombinant vector into Agrobacterium; (3) infecting honeysuckle leaves with Agrobacterium.

[0017] This invention also provides a method for increasing the MYBS3 expression content in honeysuckle, the method comprising the following steps: spraying Ca under cold stress. 2+ Specifically, the honeysuckle plants were first sprayed with CaCl2, and then the plants that had been sprayed with CaCl2 were placed in a cold stress growth chamber for cultivation. During the cold stress period, the spraying experiment was repeated every once in a while.

[0018] The beneficial effects of this invention are as follows:

[0019] The invention discovered that in honeysuckle, the MYBS3 gene, when sprayed with Ca under low temperature stress, [is affected].2+ Expression was upregulated; expression of recombinant plasmids containing the MYBS3 gene in honeysuckle significantly increased the expression levels of anthocyanin synthase (ANS) and flavonoid synthase (FNS) in leaves; expression of recombinant plasmids containing the MYBS3 gene in honeysuckle significantly increased the content of anthocyanins and luteolin in honeysuckle leaves. Attached Figure Description

[0020] Figure 1 A graph showing the detection of anthocyanin content in leaves overexpressing MYBS3;

[0021] Figure 2 A graph showing the detection of luteolin content in leaves overexpressing MYBS3;

[0022] Figure 3 To detect Ca under cold stress 2+ The results of processing the expression level of the target gene MYBS3;

[0023] Figure 4 This is a graph showing the results of detecting the expression level of the target gene MYBS3 in this invention;

[0024] Figure 5 This is a graph showing the results of detecting ANS expression levels according to the present invention.

[0025] Figure 6 This is a graph showing the results of detecting the expression level of FNS in this invention. Detailed Implementation

[0026] Example

[0027] 1. Molecular cloning of MYBS3

[0028] 1) Total RNA extraction and cDNA synthesis

[0029] Honeysuckle seedlings of variety "Beihua No. 1" were transplanted from a nursery in Pingyi County, Linyi City (35°18′28″N, 117°34′45″E) to a greenhouse at Zhejiang University of Science and Technology in Hangzhou (30°18′54″N, 120°21′27″E). Total RNA was extracted from honeysuckle leaves using an RNA extraction kit (Accurate Biotechnology, Hunan, China), and RNA degradation and purity were assessed using a Qubit 4 fluorometer (Thermo Fisher Scientific).

[0030] cDNA was obtained using a reverse transcription kit (AG).

[0031] (1) Prepare the RNA template solution on ice according to the table below, and place it in a PCR instrument for denaturation and annealing reaction.

[0032] Reaction system (10 μl)

[0033]

[0034] Denaturation and annealing reaction conditions:

[0035]

[0036] (2) Prepare the reverse transcription reaction system and synthesize cDNA:

[0037]

[0038] cDNA synthesis reaction conditions:

[0039]

[0040] 2) Amplification of MYBS3

[0041] The cDNA sequence of MYBS3 (gene number Lj2A224G16) was obtained from the NCBI database, as shown in SEQ ID NO.1. Primers were designed based on this sequence, introducing XbaI and BamHI restriction sites upstream and downstream of the MYBS3 gene sequence, respectively: MYBS3-F: GACTGACCACCCGGGGATCCTCAACACATCATCACTTCTTCAAACTT and MYBS3-R: AGACACGGGGGACTCTAGAATGACGAGGAGGTGCT. The PCR reaction program was: 95℃ denaturation for 3 min; 95℃ for 15 s, 52℃ for 30 s, 72℃ for 1 min, 35 cycles; extension at 72℃ for 5 min; storage at 4℃. After electrophoresis, the MYBS3 gene with homologous arms was recovered using a SteadyPure DNA gel extraction kit (AG Corporation) and stored at -20℃.

[0042] 2. Construction of recombinant plasmids

[0043] The pBI121 plasmid was digested with restriction enzymes BamHI and XbaI, and the target gene was ligated to the vector pBI121 using homologous recombination.

[0044] The recombinant plasmid was introduced into E. coli using the heat shock method. Transformation steps:

[0045] (1) Add 5 μL of ligation product to 50 μL of competent Escherichia coli cells and incubate on ice for 30 min;

[0046] (2) Heat shock at 42℃ for 30 seconds, then immediately insert into ice and let stand for 2-3 minutes;

[0047] (3) Add 1 mL of LB liquid medium without resistance to the centrifuge tube and incubate at 37°C and 200 rpm for 60 min on a shaker.

[0048] (4) Centrifuge at 6000 rpm for 3 min, discard the supernatant, spread on Kana (50 mg / L) resistance medium plates, incubate upside down at 37℃ for 12-16 h, and then pick out the resistant colonies.

[0049] PCR-positive transformants were selected and cultured in a culture medium to extract plasmids. Simultaneously, the amplification products were sent for sequencing. The amplification and sequencing primers were vector sequences inserted flanking the target gene, as follows:

[0050] PBI121-F:GTTCCAACCACGTCTTCAAAGC

[0051] PBI121-R: CGAATATCTGCATCGGCGAACT

[0052] After bacterial culture PCR amplification, electrophoresis, and sequencing, a recombinant plasmid containing the target gene was obtained, and the nucleotide sequence is shown in SEQ ID NO.2.

[0053] The successfully constructed recombinant vector was introduced into Agrobacterium GV3101.

[0054] (1) Take the competent Agrobacterium cells stored at -80℃ and let them partially melt at room temperature or in the palm of your hand. When they are in an ice-water mixture, insert them into ice.

[0055] (2) Add 5 μL of plasmid DNA to every 50 μL of competent cells, mix by hand by tapping the bottom of the tube, and incubate on ice for 5 minutes, in liquid nitrogen for 5 minutes, in a 37°C water bath for 5 minutes, and in an ice bath for 5 minutes.

[0056] (3) Add 700 μL of antibiotic-free LB liquid medium and incubate at 28°C with shaking for 2-3 hours.

[0057] (4) Centrifuge at 6000 rpm for one minute to collect the bacteria. Take about 100 μL of supernatant, gently blow and resuspend the bacterial block, spread it on LB plates containing Kana, and invert it in an incubator at 28℃ for 2-3 days.

[0058] (5) Pick resistant colonies; culture at 28℃ for 1 day at 200 rpm.

[0059] (6) Take 1 μL of bacterial culture for PCR positive detection.

[0060] 3. Agrobacterium infection of honeysuckle leaves

[0061] (1) Take 300 μl of bacterial culture into 30 ml of LB liquid medium containing 30 μl of Kana, and incubate at 28℃ and 200 rpm until OD600 = 0.6~0.8;

[0062] (2) Pour the cultured Agrobacterium into a 50ml centrifuge tube, centrifuge at 8000rpm for 10min at room temperature, discard the waste liquid, and resuspend in osmotic medium;

[0063] (3) Resuspend the bacterial cells to OD600=0.6~0.8, let them stand at room temperature for 3 hours, inject them into honeysuckle leaves, and culture them in the dark for 12 hours before transferring them to normal culture. Take samples at five sampling points at 0H, 24H, 36H, 48H, and 72H (denoted as T0, T24, T36, T48, and T72), freeze the samples with liquid nitrogen, and store them at -80℃.

[0064] Osmotic medium: 1000ml ddH2O, 4.74g MS, 10mM MES (2-(N-morpholino)ethanesulfonic acid), 10mM MgCl2 and 100μM AC (acetylsyl syringone).

[0065] 4. Spraying Ca under cold stress 2+

[0066] Select 3 pots of honeysuckle cuttings and spray them with 10 mM CaCl2 (Ca 2+ At the starting point (SP), to induce cold stress, the sprayed plants were placed in a growth chamber with identical conditions (10°C, 70% humidity, 8000 Lux light, and 12-hour light / 12-hour dark cycle) (day 0). During the cold stress period, the spraying experiment was repeated every five days. Leaves from all treatments for 15 days (T15) and 30 days (T30) were collected. Three independent replicates were performed as biological replicates, and the collected plant material was frozen in liquid nitrogen and stored at -60°C.

[0067] Preparation method of 10mM CaCl2: Accurately weigh 0.28 g of anhydrous CaCl2 powder using an analytical balance, then dissolve each powder in 150 mL of distilled water. Stir the CaCl2 powder until completely dissolved, transfer to a 250 mL volumetric flask, and add an appropriate amount of water to make up to volume.

[0068] 5. Anthocyanin detection

[0069] Reference (MA D, REICHELT M, YOSHIDA K, et al. 2018. TWO R2R3-MYBproteins arebroad repressors of flavonoid and phenylpropanoid metabolism in poplar. ThePlant Journa[J],96:949-965.

[0070] ZHANG M, LI M, FU H, et al. 2022. Transcriptomic analysis unravels themolecular response of Lonicera japonica leaves to chilling stress. FrontPlant Sci [J], 13:1092857.)

[0071] Take MYBS3 overexpression and Ca 2+ Plant material subjected to cold stress was treated by grinding 50 mg of frozen leaves into powder in liquid nitrogen, sonicating with 3 ml of 0.1% methanol-hydrochloric acid for 1 hour, and then shaking overnight (200 rpm, 25°C). After centrifugation at 2,500 g for 10 minutes, 500 μL of the supernatant was vortexed with 500 μL of distilled water, and the mixture was further mixed with 1 ml of chloroform and centrifuged at 13,000 rpm for 5 minutes to remove chlorophyll. The resulting solution was measured at 530 nm for anthocyanin determination.

[0072] The results are as follows Figure 1 As shown, Figure 1 The graph shows the anthocyanin content in leaves overexpressing MYBS3. The graph indicates that after 36 hours of MYBS3 overexpression, the anthocyanin content increased by 273.55%. Empty vector control: pBI121 empty vector expression vector; MYBS3_overexpression: MYBS3 overexpression vector; ordinate: anthocyanin content.

[0073] Ca under cold stress 2+ The results of the analysis are shown in Table 1 below.

[0074] Table 1

[0075]

[0076] 6. Detection of luteolin content

[0077] (1) Blanch the sample at 105℃ for 15 min, then dry at 65℃ to constant weight;

[0078] (2) Grind the sample into powder using a mortar and pestle;

[0079] (3) Weigh 0.075g of powder and add 1.5ml of methanol;

[0080] (4) After ultrasonic extraction for 1 hour, centrifuge at 1200 rpm for 20 minutes;

[0081] (5) Extract the supernatant, filter it into a new centrifuge tube, and perform HPLC analysis on the resulting solution. The results are as follows: Figure 2As shown, Figure 2 The graph shows the luteolin content in leaves overexpressing MYBS3. The luteolin content increased by 148.44% after 36 hours of YBS3 overexpression. Empty vector control: pBI121 empty vector expression vector; MYBS3 overexpression: MYBS3 overexpression vector; the vertical axis represents luteolin content.

[0082] 7. Quantitative Detection of Relative Contents of MYBS3, ANS, and FNS Using Fluorescent Methods

[0083] After comparison, the gene number of honeysuckle anthocyanin synthase (ANS) was obtained as Lj2C202T5, and its nucleotide sequence is shown in SEQ ID NO.3. The gene number of honeysuckle flavonoid synthase (FNS) was obtained as Lj2A1050G29, and its nucleotide sequence is shown in SEQ ID NO.4. The sequences were obtained from the transcriptome data. Specific primers were designed based on the sequences of MYBS3, ANS, and FNS. The sequences are as follows: q-MYBS3-F: TCTCCGGCGATACTCCTGA, q-MYBS3-R: TGGCCACTTGAGTGGGTGTT; q-ANS-F: GCTATGGACCGCGTTAGGG, q-ANS-R: AGCTGCCCGCAAGCATTATT; q-FNS-F: CAGTCCTTCCATCGCCTCTC, q-FNS-R: AGAGGAATTGGCGGGTGAAG. RNA was extracted from preserved frozen leaves using an RNA extraction kit (AG Company), and cDNA was obtained by reverse transcription. MYBS3, ANS, and Ca2+ were detected using a quantitative real-time detection kit (AG Company). 2+ The processed MYBS3 expression level was analyzed, and the results are referenced. Figure 3-6 As shown.

[0084] Figure 3 To detect Ca under cold stress 2+ The results of processing the expression level of the target gene MYBS3 are shown in the figure. The results indicate that in Ca 2 + The expression level of MYBS3 in honeysuckle under cold stress increased by 208.78%. Control group: cold stress treatment for 0 days, experimental group: cold stress treatment for 15 days. The vertical axis represents the relative level of gene expression.

[0085] Figure 4 The figure shows the results of detecting the expression level of the target gene MYBS3 in this invention. The results show that after 36 hours of MYBS3 overexpression, the expression level of MYBS3 increased by 187.18%. Empty vector control: pBI121 empty vector expression vector; MYBS3 overexpression: MYBS3 overexpression vector. The vertical axis represents the relative level of gene expression.

[0086] Figure 5 The figure shows the results of detecting ANS expression levels in this invention. The results indicate that after MYBS3 overexpression for 36 hours, ANS expression levels increased by 193.16%. Empty vector control: pBI121 empty vector expression vector; MYBS3 overexpression: MYBS3 overexpression vector. The vertical axis represents the relative level of gene expression.

[0087] Figure 6 The figure shows the results of detecting FNS expression levels in this invention. The results indicate that after MYBS3 overexpression for 36 hours, FNS expression levels increased by 176.40%. Empty vector control: pBI121 empty vector expression vector; MYBS3 overexpression: MYBS3 overexpression vector. The vertical axis represents the relative level of gene expression.

[0088] Table 2 shows the content of each component after MYBS3 gene overexpression.

[0089] Table 2

[0090]

[0091] In this experiment, the anthocyanin content was increased in leaves overexpressing MYBS3, and the relative expression levels of MYBS3 and ANS were higher in the overexpressing leaves. It was also found that spraying Ca... 2+ Subsequent cold stress on honeysuckle resulted in an increase in MYBS3 expression. This indicates that MYBS3 can positively regulate the anthocyanin content of honeysuckle.

Claims

1. Application of MYBS3 gene overexpression in regulating content of anthocyanin and luteolin in honeysuckle flower, characterized in that: The nucleotide sequence of the MYBS3 gene is shown as SEQ ID NO. 1, and the regulation is positive regulation.

2. Use according to claim 1, characterized in that: The expression level of the MYBS3 gene is improved by constructing an overexpression vector.

3. Use according to claim 2, wherein: The overexpression vector is a pBI121 plasmid.

4. The application of MYBS3 gene overexpression as described in claim 1 in regulating the content of anthocyanins and luteolin in honeysuckle, characterized in that: Spraying Ca under cold stress 2+ , thereby increasing the expression level of MYBS3 gene in honeysuckle.

5. Use according to claim 4, wherein: First, spray CaCl2 on the Lonicera japonica plant, and then place the plant sprayed with CaCl2 in a cold stress growth chamber for culture, and repeat the spraying experiment every time interval during the cold stress.

6. The use according to claim 5, wherein the compound is ###0002### First, spray 10 mM CaCl2 on the Lonicera japonica plant, and then place the plant in a growth chamber with the same temperature of 10℃, humidity of 70%, light of 8000Lux, and light cycle of 12 hours light / 12 hours darkness for culture, and repeat the spraying experiment every five days during the cold stress. 7.A method for increasing the expression level of a honeysuckle MYBS3 gene, characterized in that, The method comprises the following steps: spraying Ca under cold stress 2+ Specifically, CaCl2 is sprayed on honeysuckle plants, and then the plants sprayed with CaCl2 are placed in a cold stress growth chamber for culture. During the cold stress, the spraying experiment is repeated every certain period of time. The nucleotide sequence of the MYBS3 gene is shown as SEQ ID NO.

1.

8. A method for increasing the content of anthocyanins and luteolin in honeysuckle, characterized in that, The method comprises the following steps: (1) constructing a recombinant vector containing the MYBS3 gene, wherein the nucleotide sequence of the MYBS3 gene is shown as SEQ ID NO. 1; (2) introducing the successfully constructed recombinant vector into Agrobacterium; and (3) Agrobacterium infection of the Lonicera japonica leaf.

Images