Application of kit for detecting SNP (Single Nucleotide Polymorphism) molecular marker in screening of high-yield dairy cows

By using a kit to detect SNP molecular markers, the frequency of dominant alleles can be increased generation by generation, thereby improving the progress of genetic improvement in breeding cattle and effectively increasing the economic benefits of breeding cattle.

CN121227902AActive Publication Date: 2025-12-30NORTHWEST A & F UNIV
View PDF 7 Cites 0 Cited by

Patent Information

Application Number
CN202511752822.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-26
Publication Date
2025-12-30
Estimated Expiration
2045-11-26

AI Technical Summary

Technical Problem

Traditional phenotypic selection methods are difficult to rapidly improve total milk yield during lactation in dairy cow breeding. They are highly susceptible to environmental interference, and genome-wide association studies have insufficient analytical power when sample size and density are insufficient, making it difficult to accurately locate genomic regions that affect traits.

Method used

A kit for detecting SNP molecular markers is provided. By selecting dominant alleles for molecular marker-assisted selection, the frequency of dominant alleles is increased generation by generation, thereby improving the high milk yield trait in lactating cattle, selecting superior breeding cattle with high milk yield during lactation, accelerating the progress of cattle genetic improvement, and thus effectively improving the economic benefits of cattle breeding.

Benefits of technology

This technology enables efficient and accurate molecular marker-assisted breeding, allowing for the rapid selection of superior breeding cattle with high milk production during lactation, thereby improving the production performance of offspring cattle and increasing the company's profits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121227902A_ABST
    Figure CN121227902A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of molecular biology, and particularly discloses application of a kit for detecting an SNP molecular marker in screening of high-yield cows, the nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO.1, N at the 2694th site in the SEQ ID NO.1 represents G or A, the polymorphism of the basic group at the site affects the milk yield of the cows in the lactation period, and the nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO.1. The total milk yield of the cattle with the AG genotype in the lactation period is higher than that of the cattle with the GG genotype. By optimizing the dominant alleles of the SNP, the frequency of the dominant alleles can be increased generation by generation, the total milk yield of the cattle in the lactation period is increased, the excellent cattle with the high milk yield character in the lactation period is bred, the genetic improvement progress of the cattle is accelerated, and therefore the economic benefits of cattle breeding are effectively improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular biology technology, specifically to the application of a kit for detecting SNP molecular markers in the screening of high-yielding dairy cows. Background Technology

[0002] Total milk yield during lactation is one of the most important economic traits in dairy cow production performance, directly determining farming efficiency and dairy industry competitiveness. Increasing milk yield per cow not only reduces the production cost per unit of product but also allows for long-term, stable yield increases through genetic modification. Total milk yield during lactation is a typical quantitative trait, influenced by numerous minor genes, environmental factors, nutritional management, and complex physiological regulation. Traditional phenotypic selection requires a long breeding cycle and is easily affected by environmental disturbances, making it difficult to achieve significant progress in the short term. Therefore, marker-assisted selection (MAS) or genomic selection provides a feasible path for the rapid improvement of complex traits such as total milk yield during lactation.

[0003] Genome-wide association studies (GWAS) are effective tools for revealing the genetic basis of complex traits. GWAS systematically scans the entire genome for marker loci significantly associated with a target phenotype, directly locating candidate genes or genomic regions influencing traits. This provides a basis for marker-assisted selection, candidate gene function studies, and molecular breeding. The statistical power of GWAS is highly dependent on sample size and locus coverage density: the larger the sample size and the higher the marker density, the stronger the ability to discover true effector loci. Next-generation sequencing (NGS) technology enables population-level whole-genome resequencing, directly obtaining high-density, genome-wide variation information (including high-density SNPs), significantly improving the resolution and localization accuracy of GWAS, especially in detecting low-frequency variations and accurately locating pathogenic or functional variations within exons.

[0004] Conducting GWAS based on high-depth whole-genome resequencing in the Chinese Holstein population can not only obtain a more complete variation spectrum, but also improve the detection capability of actionable loci affecting complex traits such as total milk yield during lactation. This provides more reliable molecular tools and strategies for breeding cattle and herd improvement. It is necessary to provide a pathway for breeding cattle breeds with high milk yield during lactation. Summary of the Invention

[0005] To develop a method for selecting cattle breeds with high milk yield during lactation, this invention provides an application of a kit for detecting SNP molecular markers in the screening of high-yielding dairy cows. By optimizing the dominant alleles of this SNP, this invention can increase the frequency of dominant alleles generation by generation, thereby enhancing the high milk yield trait in breeding cattle during lactation, selecting superior breeding cattle with high milk yield during lactation, accelerating the progress of bovine genetic improvement, and effectively improving the economic benefits of cattle breeding.

[0006] This invention provides an application of a kit for detecting SNP molecular markers in the screening of high-producing dairy cows. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1. In the sequence of SEQ ID NO.1, N at position 2694 represents G or A. The polymorphism of the base at this position affects the high milk yield trait during lactation in cows. Among them, the total milk yield during lactation of cows with the AG genotype is higher than that of cows with the GG genotype. The bovine reference genome version is: International Bovine Reference Genome Version 2.0.

[0007] This invention, by selecting the dominant allele of the SNP, can increase the frequency of the dominant allele generation by generation, improve the total milk yield of breeding cattle during lactation, select superior breeding cattle with high milk yield during lactation, accelerate the progress of cattle genetic improvement, and thus effectively improve the economic benefits of cattle breeding.

[0008] Furthermore, the kit for detecting SNP molecular markers includes the upstream primer shown in SEQ ID NO.2 and the downstream primer shown in SEQ ID NO.3.

[0009] Further, the application involves: extracting genomic DNA from the cattle to be tested; using the primer pairs shown in SEQ ID NO.2 to SEQ ID NO.3, and using the obtained genomic DNA as template DNA, performing PCR amplification to obtain PCR amplification products; sequencing the PCR amplification products to obtain sequencing results; determining the genotype of the SNP molecular marker based on the sequencing results; culling individuals with the GG genotype and retaining individuals with the AG genotype according to the SNP sites of the SNP molecular marker; wherein, cattle with the AG genotype have a higher total milk yield during lactation than cattle with the GG genotype, indicating higher production performance.

[0010] Furthermore, the PCR amplification system consisted of 10 μL: 1 μL DNA template, 3.4 μL double-distilled water, 5 μL 2×Taq PCR MasterMix with Loading Dye, and 0.3 μL each of upstream and downstream primers.

[0011] Furthermore, the PCR amplification program was as follows: pre-denaturation at 94℃ for 5 min, 35 cycles, each cycle first denaturing at 94℃ for 30 s, then annealing at 64.5℃ for 30 s, and finally extending at 72℃ for 45 s; after 35 cycles, a final extension at 72℃ for 5 min was performed.

[0012] The present invention also provides a primer pair, including the primers shown in SEQ ID NO.2 to SEQ ID NO.3, wherein the primer pair is used to amplify the SNP molecular marker.

[0013] The present invention also provides a detection kit containing the primer pair.

[0014] Furthermore, the test kit also includes 2×Taq PCR Master Mix with Loading Dye and double-distilled water.

[0015] This invention also provides the application of primer pairs in the identification of high milk yield traits in dairy cows, the screening of high-yielding cows, or in dairy cow genetic breeding.

[0016] The present invention also provides a method for detecting total milk production traits during bovine lactation, comprising the following steps: The SNP molecular markers described above on bovine chromosome 4 were detected. Based on whether the single nucleotide of the SNP site was G or A, the high milk yield trait during lactation was determined. Among them, cattle with the AG genotype had a higher total milk yield during lactation than cattle with the GG genotype, indicating higher production performance. The cattle mentioned are Chinese Holstein dairy cows, and the bovine reference genome version is: International Bovine Reference Genome Version 2.0.

[0017] This invention also provides a method for genetic improvement of cattle, comprising the following steps: The SNP molecular marker loci in the core breeding cattle herd were identified, and corresponding selections were made based on the molecular markers: breeding cattle individuals with the AG genotype at loci 115,029,140 on chromosome 4 of the International Bovine Reference Genome 2.0 were selected from the core breeding cattle herd, while breeding cattle individuals with the GG genotype were culled, in order to increase the frequency of allele A at this locus generation by generation, thereby increasing the total milk yield during lactation in offspring cattle and improving the production performance of offspring cattle.

[0018] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention discloses a molecular marker associated with high milk yield during lactation, located on a nucleotide sequence on bovine chromosome 4. Its effect on total milk yield during lactation is verified, ultimately establishing an efficient and accurate molecular marker-assisted breeding technology. This technology can be applied to the genetic improvement of breeding cattle to increase high milk yield during lactation, thereby increasing the total milk yield of offspring, increasing enterprise economic profits, and enhancing core competitiveness.

[0019] This invention provides a primer pair and kit for detecting the above-mentioned SNP molecular markers. With this primer pair and kit, an efficient and accurate molecular marker-assisted breeding technology can be established to quickly and accurately select for high milk yield traits during lactation, thereby accelerating the breeding process.

[0020] This invention, by selecting the dominant allele of the SNP, can increase the frequency of the dominant allele generation by generation, improve the total milk yield of breeding cattle during lactation, select superior breeding cattle with high milk yield during lactation, accelerate the progress of cattle genetic improvement, and thus effectively improve the economic benefits of cattle breeding. Attached Figure Description

[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0022] Figure 1 This is a graph showing the genotypic differences at position 2694 (5' end) in Chinese Holstein cattle.

[0023] Figure 2 Manhattan plot of genome-wide association analysis (GWAS) on chromosome 4 in Chinese Holstein cattle, based on a linear mixture model using EMMAX software; where: x-axis represents the chromosome number of the cattle; principal y-axis represents -log 10 P value. Detailed Implementation

[0024] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.

[0025] Example 1: A molecular marker of an SNP located on bovine chromosome 4 that is associated with high milk production during lactation and its application.

[0026] I. Experimental subjects, phenotypic determination, and DNA sample collection (1) Experimental animals The experimental cattle herds used in this invention are Chinese Holstein dairy cows from multiple ranches in Shaanxi, Ningxia, Anhui and Jiangsu provinces.

[0027] This experiment used a herd of 597 Chinese Holstein dairy cows, with detailed herd pedigree records. The herd maintained normal feed and water intake, and all feeding methods and conditions remained consistent throughout the experiment, adhering to standard practices.

[0028] (2) Phenotype Total milk production during lactation is measured by the dairy farm's milking parlor.

[0029] (0) Bovine tissue sample collection To extract DNA, blood samples were collected from 597 Chinese Holstein dairy cows and stored at -80°C for subsequent DNA extraction and sequencing.

[0030] II. Development of SNP Molecular Markers (1) Sample DNA extraction DNA from collected blood samples was extracted using a Magnetic Universal Genomic DNA kit (purchased from TIANGENBIOTECH (BEIJING) CO.,LTD.). Five 96-well deep-well plates were prepared, each containing 200 μL Buffer NAL + 25 μL proteinase K, 500 μL Wash 1 + 20 μL magnetic beads, 500 μL Wash 2, 500 μL Wash 3, and 80 μL Elution Buffer, respectively. 350 μL of sample was transferred to the deep-well plate containing 200 μL Buffer NAL + 25 μL proteinase K. The Kingfisher (Thermofisher, USA) instrument was started, the corresponding DNA extraction program was selected, and each deep-well plate was placed in its corresponding position on the instrument. The program was run. After lysis was complete, the program was paused, and 400 μL Buffer MBD was added as prompted. The program was then resumed. After the program finished, the DNA solution in the Elution Buffer deep-well plate was transferred to a 1.5 mL centrifuge tube for storage.

[0031] (2) Whole genome resequencing The whole-genome resequencing data were all completed by BGI Genomics Co., Ltd. in Shenzhen. The specific methods and steps are as follows: ① Library construction: The qualified DNA extracted in step (1) is randomly fragmented and processed into a sequencing library through steps such as DNA fragment end repair, 3' end addition of polyA, sequencing adapter configuration, and PCR amplification.

[0032] ② Sequencing: Resequencing was performed on BGI's DNB SEQ-T7 platform, with an average sequencing depth greater than 10×, yielding raw sequencing data in FASTQ format.

[0033] (3) Resequencing data analysis ① Use the Fastp software (v0.23.4) with default parameters to perform quality control on the raw sequencing data obtained in step (2), including filtering out adapter sequences and low-quality reads, to obtain the quality-controlled sequencing data in FASTQ file format; ②Use the mem module in the BWA-mem2 software (v2.2.1) with default parameters to align the quality-controlled sequencing data from step ① to the International Bovine Reference Genome 2.0, and obtain the aligned BAM file; ③ Use the sort function of Samtools software (v1.17) and the MarkDuplicates function of GATK software (v4.4.0.0) to sort the BAM files after alignment in step ② and remove duplicate sequences; ④ SNP calling was performed using the HaplotypeCaller module of GATK software (v4.4.0.0) to accurately identify SNPs and obtain a VCF file containing information on all SNP sites; the VariantFiltration module of GATK software was used to further filter the variants, and finally 23,842,307 SNPs were identified.

[0034] (4) Genome-wide association analysis (GWAS) The selected Plink (v1.90) and EMMAX software were used to perform GWAS analysis on the relationship between variant sites and traits using a linear mixed model. The SNP locus information results (VCF file) obtained in step (3) were converted into Plink binary format files using Plink software (v1.90), and variants with a variant detection rate of less than 10% and a minor allele frequency (MAF) of less than 5% were filtered out. GWAS analysis was performed on the entire population, using SNP variants. Association analysis was performed using the efficient mixed-model association expedited (EMMAX) software based on a linear mixed model, in which the kinship matrix and population structure were included as random effects for correction. The significance thresholds for all traits were calculated according to the formula. P =0.05 / n Evaluation (where n is the number of independent valid SNPs). 1×10 −6 (Bonferroni correction) serves as a genome-wide significance threshold, annotating regions within 200 kb upstream and downstream of significant sites.

[0035] (6) Association analysis between different genotypes and high milk yield during lactation Table 1. Correlation analysis of the SNP site g.2694 G>A of the molecular marker with the trait of high milk yield during lactation. To identify SNP loci affecting milk production during lactation, we performed a genome-wide association analysis, the results of which are shown below. Figure 2GWAS analysis revealed a significant associated site, g.2694 G>A (the G>A mutation at positions 115,029,140 on chromosome 4 in the International Bovine Reference Genome 2.0 version), located on chromosome 4. XRCC2 Located on the exons of a gene, this site is therefore a focus of attention. According to Figure 1 Analysis of Table 1 shows that the SNP site g.2694 G>A of the molecular marker is highly significantly correlated with milk production during lactation. P The value <0.001 indicates that this molecular marker significantly affects the high milk yield trait during the lactation period in cattle. It is hoped that by assisted selection of this SNP site in cattle, the total milk yield during the lactation period can be increased during the breeding process.

[0036] Additionally, according to Table 1 and... Figure 1 Furthermore, it was found that the proportion of individuals with the GG genotype was relatively high and the proportion of individuals with the AG genotype was relatively low in the Chinese Holstein dairy cow population. This indicates that for the trait of high milk production during lactation, the AG genotype is a less frequent genotype in the Chinese Holstein dairy cow population, meaning that the AG genotype may be related to the total milk production during lactation in some Chinese Holstein dairy cow populations. This suggests that in the Chinese Holstein dairy cow population, for the trait of high milk production during lactation, the GG genotype may be detrimental to the trait of total milk production during lactation, a conclusion that corroborates the previous one.

[0037] Based on the above analysis, it is clear that cattle with the AG genotype have a high total milk yield during lactation. Therefore, in breeding processes, it is necessary to cull breeding cattle with the GG genotype and retain those with the AG genotype to gradually increase the frequency of allele A at this locus. Currently, the frequency of the AG genotype in Chinese Holstein dairy cattle is approximately 7.21%, indicating significant potential for genetic improvement.

[0038] III. Amplification and Sequencing of Target DNA Sequence (1) Primer design The DNA sequence of SEQ ID NO.1 on bovine chromosome 4 was downloaded from the Ensemble website (https: / / asia.ensembl.org / ). Primers were designed using the primer design software Primer Premier 6.0 and synthesized by Sangon Biotech (Shanghai) Co., Ltd. The DNA sequences of the designed primers are shown below:

[0039] P001-F: 5'-GCGAACACTTACATACTCCT-3' (SEQ ID NO. 2); P002-R: 5'-GTGACTCTATTACTCCTCTACC-3' (SEQ ID NO. 3).

[0040] (2) PCR amplification PCR amplification: Add 1 μL of DNA template, 3.4 μL of double-distilled water, 5 μL of 2×Taq PCRMaster Mix with Loading Dye, and 0.3 μL each of upstream primer P001-F and downstream primer P002-R to a 10 μL reaction system. The PCR reaction conditions are: pre-denaturation at 94℃ for 5 min to allow the DNA double strands to fully unwind; then perform 35 cycles of amplification. In each cycle, denature at 94℃ for 30 s to allow the DNA double strands to unwind into single strands, then anneal at 64.5℃ for 30 s to allow the primers to specifically bind to the template DNA single strands, and finally extend at 72℃ for 45 s to synthesize a new DNA strand under the action of DNA polymerase. After 35 cycles, perform a final extension at 72℃ for 5 min to ensure that the newly synthesized DNA strand is fully extended.

[0041] (3) DNA sequencing DNA sequence sequencing and identification: Performed at BGI Genomics Co., Ltd. in Shenzhen, the gene fragments were sequenced using both forward and reverse reactions. The obtained sequences were compared with the Ensemble genome sequence to identify mutations at corresponding SNP sites. The sequencing results are shown below:

[0042] SEQ ID NO.1: N(G / A) TCCGTATCGTCTACATCGTATACGACAAACATGGACGTCGAGGAGGTCGAAACCCCTTGGACGTCAAGGGGTTTGGGTCGCTGAAGACGTTCACAGTAGACCTGTGTCTCGGACGACCCGCCGCACACCCGGTCCGCCCGTCAGGAATGGTCACTCCCGGTCCCGAACCATCCAACCATTGCGGAGAGGAGTGGGGAACC ATTCTTGGTTCCACAAAGAGTCCACCGGGGACATCCTCGGTAGAGGAGTAATAGAGTCACAAAGAACGGAAGGTGGGAGGGAGAGTGAAGGGGTGAGAGTACGTCGGAGTACCCTAAGAGGGGGATTTTTTGTTTTAGGAACAGCTCCCTGACGAAAACAACACTCAACCTCCCCTTGGTTTGACAGCCGTCCGTTATTTTT CAGCAGTCCGATTGTCGGGAAGATCCACGTCATAAACGAGAAGTCGGTATAATACCTTAAATTTTACTACCGTAAGATTAACAATTAGTTCAATTTAATGTAACCTAGTATAATGACAGTAAGTGTGGGTGAACACACGGGAGTTATTTACAATAAAACGATAATTAGAGGAACGGGCTGACCTTCCATCTTCAAGGAACT TTCTCTATCTTGGTGTAGACAAACGACTACTTCTCAGTGGACACGTCACCAGTGCGGCCCCAGTTTCCCAATCGCAGAAACTGACCGACTCCCCTTCTGCGGCCCGCCATTTACCGCGACATCCGCCCTTCTAACTCACCGACCACGCGGCTCGGAGGCCCCTACACATCACTGAAGGTATCCCGACTTAGACCCTGCCTC The one marked in SEQ ID NO.1 N Mutation sites are indicated by underlining (the mutated bases are in parentheses, representing allele mutations). The positions of the designed primer sequences are indicated by bolding at the beginning and end of the sequence.

[0043] IV. Analysis of the SNP site g.549 G>A effect of molecular markers According to Table 1 and Figure 1It is known that for the high milk yield trait during lactation, cows with the AG genotype at SNP site g.2694 G>A in the Chinese Holstein dairy herd have a higher total milk yield during lactation (compared to the GG genotype). Higher total milk yield during lactation improves the overall production performance of the herd. This will significantly increase the economic benefits of dairy farming and create wealth for enterprises. By selecting the allele (A) of this SNP in individuals with SNP markers within the Chinese Holstein dairy herd, it is possible to ultimately improve economic efficiency and thus increase enterprise profits.

[0044] This invention utilizes the detection of the mutation site at position 2694 in the SEQ ID NO:1 sequence to conduct preliminary association analysis between its genotype and the total milk production trait during lactation in cattle, providing a new molecular marker for marker-assisted selection in cattle.

[0045] Although preferred embodiments of the invention have been described, those skilled in the art, once they have learned the basic inventive concept, can make other changes and modifications to these embodiments.

[0046] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. Use of a kit for detecting a SNP molecular marker in the selection of high-yielding dairy cows, characterized in that, The nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO. 1, wherein N at position 2694 in the sequence of SEQ ID NO. 1 represents G or A, and the polymorphism of the base at the site affects the high milk yield trait during the lactation period of the cow, wherein the total milk yield during the lactation period of the cow with AG genotype is higher than that of the cow with GG genotype; The reference genome of the cow is the international cow reference genome version 2.

0.

2. Use of the kit for detecting the SNP molecular marker according to claim 1 in the selection of high-yielding dairy cows, characterized in that, The kit for detecting the SNP molecular marker comprises an upstream primer shown as SEQ ID NO. 2 and a downstream primer shown as SEQ ID NO.

3.

3. Use of the kit for detecting SNP molecular markers according to claim 1 in the selection of high-yielding cows, characterized by the fact that, The application comprises the following steps: extracting the genomic DNA of the cow to be tested; using the primer pair shown as SEQ ID NO. 2-SEQ ID NO. 3 to perform PCR amplification on the obtained genomic DNA of the cow to be tested as the template DNA, so as to obtain a PCR amplification product; and performing sequencing on the PCR amplification product, so as to obtain a sequencing result; Based on the sequencing result, the genotype of the SNP molecular marker is determined; according to the SNP site of the SNP molecular marker, the individual with GG genotype is eliminated, and the individual with AG genotype is reserved; wherein the total milk yield during the lactation period of the cow with AG genotype is higher than that of the cow with GG genotype, and the production performance is higher.

4. Use of the kit for detecting the SNP molecular marker according to claim 3 in the selection of high-yielding dairy cows, characterized in that, The PCR amplification procedure is as follows: pre-denaturation at 94℃ for 5 min, 35 cycles, each cycle comprising denaturation at 94℃ for 30 s, annealing at 64.5℃ for 30 s, and extension at 72℃ for 45 s; after the 35 cycles, final extension at 72℃ for 5 min.

5. A pair of primers, characterized in that, The kit comprises the primers shown as SEQ ID NO. 2-SEQ ID NO. 3, and the primer pair is used for amplifying the SNP molecular marker in claim 1.

6. A detection kit containing the primer pair in claim 5.

7. The test kit according to claim 6, characterized in that The detection kit further comprises 2x Taq PCR Master Mix with Loading Dye and double distilled water.

8. The primer pair in claim 5 is applied to the identification of high milk yield trait of dairy cow, the screening of high-yield cow or the genetic breeding of dairy cow.

9. A method for detecting the total milk production trait in the lactating period of a cow, characterized in that, The application comprises the following steps: detecting the SNP molecular marker in claim 1 on chromosome 4 of the cow, and judging the high milk yield trait during the lactation period of the cow according to the SNP site of the SNP molecular marker, wherein the SNP site is single nucleotide G or A; wherein the total milk yield during the lactation period of the cow with AG genotype is higher than that of the cow with GG genotype, and the production performance is higher; The cow is Chinese Holstein cow, and the reference genome of the cow is the international cow reference genome version 2.

0.

10. A method of genetic improvement of cattle, characterized in that, The application comprises the following steps: determining the SNP molecular marker site in claim 1 of the breeding cow in the breeding cow core group, and making a corresponding selection according to the molecular marker: selecting the breeding cow individual with AG genotype at position 115,029,140 on chromosome 4 of the international cow reference genome version 2.0 in the breeding cow core group, and eliminating the breeding cow individual with GG genotype, so as to increase the frequency of allele A at the site generation by generation, thereby improving the total milk yield during the lactation period of the offspring cow and improving the production performance of the offspring cow.

Citation Information

Patent Citations

  • SNP molecular marker for dairy cow milk heat resistance screening and application in breeding field

    CN113897441A

  • SNP (Single Nucleotide Polymorphism) molecular marker for identifying lactation performance of Holstein cattle and application of SNP molecular marker

    CN118667965A

  • Molecular marker related to milk fat amount and milk yield character of dairy cow and application thereof

    CN118910288A

  • SNP (Single Nucleotide Polymorphism) molecular marker related to lactation character of buffalo and application thereof

    CN119614715A

  • SNP (Single Nucleotide Polymorphism) molecular marker located on pig chromosome 13 and related to right nipple number character and application of SNP molecular marker

    CN120158501A