Bacillus subtilis for preventing and treating papaya anthracnose and application thereof

By using the fermentation broth of Bacillus subtilis EB-Q01-05 isolated from healthy passion fruit, the problems of high cost and environmental pollution associated with chemical pesticide control of papaya anthracnose have been solved, achieving safe and effective biological control.

CN121249531APending Publication Date: 2026-01-02GUANGXI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511678435.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-17
Publication Date
2026-01-02

AI Technical Summary

Technical Problem

In existing technologies, chemical pesticides are costly and ineffective in controlling papaya anthracnose, and long-term use leads to environmental pollution. There is an urgent need for biological control methods.

Method used

Bacillus subtilis EB-Q01-05, isolated from healthy passion fruit, was used in the form of fermentation broth for the prevention and control of anthracnose in papaya.

Benefits of technology

It has achieved effective control of papaya anthracnose, avoided environmental pollution, and has safety and long-term efficacy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121249531A_ABST
    Figure CN121249531A_ABST
Patent Text Reader

Abstract

The invention discloses bacillus subtilis for preventing and treating papaya anthracnose, which is bacillus subtilis EB-Q01-05, the preservation number of the bacillus subtilis EB-Q01-05 is CGMCC (China General Microbiological Culture Collection Center) No.36026, and the application of the bacillus subtilis EB-Q01-05 for preventing and treating the papaya anthracnose in the aspect of preventing and treating the papaya anthracnose. The bacillus subtilis EB-Q01-05 for preventing and treating the papaya anthracnose, disclosed by the invention, is obtained by being separated from healthy passion fruits, and has a relatively good antagonistic effect on the papaya anthracnose.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of microbial technology, specifically to a strain of Bacillus subtilis for the prevention and control of anthracnose in papaya and its application. Background Technology

[0002] Anthracnose is a major disease affecting papaya production and storage, severely impacting fruit yield and quality. The fungus *Colletotrichum spp.* exhibits a clear latent infection pattern; fruits that appear normal in the field often develop the disease during post-harvest storage and transportation. Symptoms include water-soaked spots that gradually turn dark brown. Later, the affected areas become wrinkled and sunken, producing numerous small black granules with concentric rings. Under warm, humid conditions, these black spots easily rupture, releasing orange-red conidial masses. Severe infection can lead to complete fruit rot, significantly impacting yield and quality and causing substantial economic losses. Statistics show that post-harvest loss of marketable fruit due to anthracnose can reach 40% to 100% in developing countries.

[0003] Currently, the control of anthracnose in papaya mainly relies on chemical control, which is costly and ineffective. Long-term, repeated, and excessive use of chemical pesticides causes soil, water, and air pollution, increases pesticide residues, and severely disrupts the ecological balance. Biological control refers to the use of beneficial organisms or their metabolites to control plant diseases and pests. It has advantages such as safety for humans and animals, no environmental pollution, and low likelihood of developing pesticide resistance. Therefore, there is an urgent need in production to utilize antagonistic bacteria for the biological control of anthracnose in papaya. Summary of the Invention

[0004] To address the aforementioned technical problems, this invention provides a strain of Bacillus subtilis EB-Q01-05 isolated from healthy passion fruit for controlling papaya anthracnose. This strain exhibits antagonistic activity against papaya anthracnose, and its antagonistic effect can be utilized for safe, effective, and environmentally friendly biological control of papaya anthracnose.

[0005] To achieve the above objectives, the technical solution provided by the present invention is as follows:

[0006] A strain of Bacillus subtilis for controlling anthracnose in papaya, Bacillus subtilis EB-Q01-05, with accession number CGMCC No.36026, was deposited on September 22, 2025, at the China General Microbiological Culture Collection Center, located at No.3, No.1 Beichen West Road, Chaoyang District, Beijing.

[0007] The above describes the application of Bacillus subtilis EB-Q01-05 in the prevention and control of papaya anthracnose.

[0008] Preferably, the application is the use of the fermentation broth of Bacillus subtilis EB-Q01-05, which is used to control anthracnose in papaya, in the prevention and control of anthracnose in papaya.

[0009] Preferably, the fermentation broth is prepared by inoculating Bacillus subtilis EB-Q01-05, which is used to control anthracnose in papaya, into LB medium and culturing with shaking to activate it, and then inoculating the activated bacterial solution into LB medium and incubating at 28°C and 200 r·min. -1 The fermentation broth was obtained by shaking and incubating for 48 hours.

[0010] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0011] The Bacillus subtilis EB-Q01-05 strain used in this invention to control papaya anthracnose was isolated from healthy passion fruit and has a good control effect on papaya anthracnose.

[0012] Preservation Information

[0013] Bacillus subtilis EB-Q01-05 was deposited on September 22, 2025, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 36026. Attached Figure Description

[0014] Figure 1 This is the culture characteristics and Gram staining results of Bacillus subtilis EB-Q01-05 of the present invention; A is the colony, and B is the Gram stain.

[0015] Figure 2 This invention constructs a phylogenetic tree of EB-Q01-05 and related closely related species based on the 16S and atpD gene sequences.

[0016] Figure 3 This invention presents the results of extracellular enzyme activity detection of Bacillus subtilis EB-Q01-05; wherein, A represents β-1,3-glucan activity detection; B represents protease activity detection; C represents xylanase activity detection; D represents cellulase activity detection; and E represents chitinase activity detection.

[0017] Figure 4This invention relates to the inhibitory effect of Bacillus subtilis EB-Q01-05 on the mycelial growth of *Anthracnose causal agent* of papaya; wherein, A: control (positive); B: control (negative); C: Bacillus subtilis EB-Q01-05 (positive); D: Bacillus subtilis EB-Q01-05 (negative).

[0018] Figure 5 This invention demonstrates the in vitro protective efficacy of Bacillus subtilis EB-Q01-05 against anthracnose in papaya; A is the control (CK); B is Bacillus subtilis EB-Q01-05. Detailed Implementation

[0019] The following detailed description, in conjunction with the accompanying drawings, outlines specific embodiments. However, it should be understood that the scope of protection of this invention is not limited to these specific embodiments. Unless otherwise specified, all raw materials and reagents used in the examples are commercially available. Figure 3 , Figure 4 In the accompanying illustrations, "front" refers to a top view of the petri dish showing the test results or inhibition effect, and "back" refers to a bottom view of the petri dish showing the test results or inhibition effect.

[0020] The anthracnose fungus of papaya was isolated and purified from typical anthracnose-infected papaya leaves collected from a papaya orchard in Wuwei Town, Jiangnan District, Nanning City, Guangxi Province. It was identified as the anthracnose fungus of papaya by Koch's law and preserved in the State Key Laboratory of Subtropical Agricultural Biological Resources Conservation and Utilization at -80℃ for future use. All anthracnose fungi used in subsequent experiments were of this fungus.

[0021] The culture medium used in the examples is as follows:

[0022] LA medium: Trypton 10 g, Yeast Extract 5 g, NaCl 10 g, agar 15 g, deionized water to a final volume of 1000 mL, autoclave at 121°C for 20 minutes.

[0023] PDA medium: 20 g glucose, 20 g agar, 6 g potato starch, deionized water to a final volume of 1000 mL, autoclave at 121°C for 20 minutes.

[0024] LB medium: Trypton 10 g, Yeast Extract 5 g, NaCl 10 g, deionized water to a final volume of 1000 mL, autoclave at 121°C for 20 minutes.

[0025] β-1,3-glucanase medium: 5 g yeast extract, 10 g peptone, 0.4 g Congo red, 5 g NaCl, 20 g agar, and deionized water to a final volume of 1000 mL. pH 5.5-6.0. Autoclave at 121°C for 20 minutes.

[0026] Protease-producing culture medium: 12 g skim milk powder, 20 g agar, deionized water to a final volume of 1000 mL, autoclave at 115°C for 20 minutes.

[0027] Xylanase medium: xylan 5 g, KNO3 2 g, K2HPO4 1 g, KCl 0.5 g, MgSO4·7H2O 1 g, FeSO4 0.01 g, Congo red 0.3 g, sterilized in an autoclave at 121℃ for 20 minutes.

[0028] Cellulase medium: 10 g sodium carboxymethyl cellulose, 10 g peptone, 20 g agar, 5 g yeast extract, 1 g KH2PO4, 5 g NaCl, and deionized water to a final volume of 1000 mL. pH 7.0. Sterilize in an autoclave at 121°C for 20 minutes.

[0029] Chitinase culture medium: 5 g chitin, 2 g (NH4)2SO4, 1 g sodium citrate, 0.2 g MgSO4·7H2O, 6 g KH2PO4, 1 g K2HPO4, sterilized in an autoclave at 121℃ for 20 minutes.

[0030] Example 1

[0031] Isolation and purification of strains

[0032] Under aseptic conditions, healthy passion fruit stems collected from Nama Town, Liangqing District, Nanning City, Guangxi Province, were cut into 5mm x 5mm pieces. These pieces were then immersed in 75% alcohol for 30 seconds for disinfection, followed by rinsing in 4% sodium hypochlorite solution for 10 minutes. Finally, they were rinsed 4-5 times with sterile water, excess water was absorbed with sterile filter paper, and the mixture was then chopped and diluted to a 10:10 concentration. -3 10 -4 10 -5 Diluted to 10 times the volume, take 10 drops -3 10 -4 10 -5 100 µL of each dilution was spread onto LA medium plates, with each concentration repeated three times. After incubation at 28°C for 2-3 days, the colonies were transferred to LA medium for further cultivation based on differences in colony morphology, color, and growth time. After new colonies grew, they were picked and placed into new LA medium for further cultivation and purification to obtain the purified strain, which was named EB-Q01-05.

[0033] Identification of strains

[0034] The obtained strain EB-Q01-05 forms nearly round colonies on LA medium. The colonies are dry, easily picked up, not raised, and have a few rod-shaped wrinkles. The colonies are off-white with uneven edges and are opaque. Gram staining is purple, indicating a positive result. Figure 1 ).

[0035] Total DNA was extracted from the purified strain EB-Q01-05 obtained in Example 1. Colony PCR was performed using primers 27F: AGAGTTTGATCCTGGCTCAG, 1492R: TACGGCTACCTTGTTACGACTT; atpD-F: GCCACGTGGAAGTTCTGAGA, atpD-R: GTCCGTACAATCGCAATGGC (SEQ ID NO.1-SEQ ID NO.4). The 16S rRNA and atpD gene of EB-Q01-05 were amplified by these two primer pairs. After detection by 1.5% agarose gel electrophoresis, the fragments were recovered. Using the Takara TA cloning kit, following the kit instructions, the recovered bacterial fragments were ligated into the vector pUC-19T and transformed into competent E. coli DH5α cells. 450 µL of LB medium was added, and the cells were incubated at 37°C and 200 rpm for 1 h. 50 µL of the culture was then plated onto a plate containing 100 µg / mL ampicillin and 20 µg / mL... The strains were screened using IPTG and LA plates containing 20 µg / mL X-gal. They were cultured at 37°C until single colonies formed, and then identified by routine colony PCR. The correct colonies were cultured into LB medium containing Amp resistance and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. The sequencing results were compared with the NCBI database. The neighbor-joining method in MAGA11.0 software was used to construct the strains and their related genera and species.

[0036] Molecular identification results of strain EB-Q01-05

[0037] Using the strain's DNA as a template, the 16S rDNA and atpD gene sequences were amplified. The target fragments were recovered, cloned, and sequenced. Sequencing results showed that the 16S rDNA and atpD gene sequences of strain EB-Q01-05 were 1514 bp and 1076 bp in length, respectively, as described in SEQ ID NO.5 and SEQ ID NO.6. The sequencing results were compared using BLAST in NCBI, and strain EB-Q01-05 showed the highest similarity to Bacillus subtilis. Simultaneously, a co-phylogenetic tree was constructed based on the 16S rDNA and atpD genes (…). Figure 2EB-Q01-05 clustered with Bacillus subtilis NCBI3610 and Bacillus subtilis168, consistent with the comparison results. Based on the morphological characteristics of the colony and the positive Gram staining purple, strain EB-Q01-05 was identified as Bacillus subtilis and named Bacillus subtilis EB-Q01-05, with accession number CGMCCNo.36026.

[0038] Example 2

[0039] Bacillus subtilis EB-Q01-05 extracellular enzyme assay

[0040] Assay for β-1,3-glucanase, protease, xylanase and chitinase

[0041] Bacillus subtilis EB-Q01-05 was inoculated into 10 mL of LB medium and incubated at 28°C and 200 r·min. -1 After 12 hours of shaking incubation, the OD of the bacterial culture was adjusted from 600 to 0.8. 1 μL of the adjusted EB-Q01-05 bacterial culture was evenly distributed 2 cm from the center of each culture medium (β-1,3-glucanase, protease, xylanase, and chitinase production). Four biological replicates were set up, and the cultures were incubated at 28°C for 3 days. The presence of a clear zone at the colony edge was observed. The formation of a clear zone indicated the ability to produce β-1,3-glucanase, protease, xylanase, and chitinase. The diameter of the clear zone was measured, and the strength of the ability was determined based on the size of the clear zone.

[0042] Cellulase assay

[0043] Bacillus subtilis EB-Q01-05 was inoculated into 10 mL of LB medium and incubated at 28°C and 200 r·min. -1 After shaking incubation for 12 h, adjust the OD of the bacterial culture to 0.8 from 600. Take 1 μL of the adjusted EB-Q01-05 bacterial culture and spot it evenly onto the cellulase medium, 2 cm from the center. Set up four biological replicates and incubate at 28℃ for 3 days. Take 5 mL of a 1 mg / mL solution... -1 Congo red was applied to the culture medium for staining, and after standing for 15 min, the stain was discarded. Then, 5 mL of a 1 mol·L⁻¹ solution was added. -1The NaCl solution was dissolved and allowed to stand for 15 minutes before being discarded. The formation of a clear zone at the edge of the colony was then observed. If a clear zone was formed, the colony possessed the ability to produce cellulase. The diameter of the clear zone was then measured.

[0044] The results show that ( Figure 3 Bacillus subtilis EB-Q01-05 produced clear zones on the activity assay media for β-1,3-glucanase, protease, xylanase, and cellulase, indicating that this strain has the ability to produce these enzymes. However, no clear zone was observed on the chitinase activity assay media, indicating that Bacillus subtilis EB-Q01-05 does not produce chitinase.

[0045] Example 3

[0046] Inhibitory effect of Bacillus subtilis strain EB-Q01-05 on the mycelial growth of Papaya anthracnose fungus.

[0047] After activation, *Anthracnose causal agent* of papaya, stored at -80℃, was contrasted with *Bacillus subtilis* strain EB-Q01-05 on PDA medium at 28℃ for 7-8 days until the colony diameter of the control reached approximately 8 cm. The inhibitory effect of EB-Q01-05 on the growth of *Anthracnose causal agent* was then assessed. Results showed that strain EB-Q01-05 exhibited good inhibitory effects on the mycelial growth of *Anthracnose causal agent*. Further screening showed… Figure 4 EB-Q01-05 showed a significant inhibitory effect on the mycelium of Papaya anthracnose, with an inhibition rate of 76.65%.

[0048] Example 4

[0049] In vitro control efficacy of Bacillus subtilis EB-Q01-05

[0050] Preparation of antagonistic bacteria: Under aseptic conditions, a small amount of single colonies of EB-Q01-05 were picked up with an inoculation loop and inoculated into 250 mL Erlenmeyer flasks containing 100 mL of LB medium. The flasks were incubated at 28 °C and 200 rpm. -1 Activation was achieved by shaking culture for 12 hours. Then, under aseptic conditions, 3 mL of the activated bacterial culture was pipetted into 250 mL Erlenmeyer flasks containing 100 mL of LB medium and incubated at 28°C and 200 rpm. -1 The fermentation broth containing strain EB-Q01-05 was obtained by shaking culture for 48 hours and then used for further processing.

[0051] In vitro inoculation experiment: Healthy papaya fruits of similar size and maturity were selected. The fruit surface was first disinfected with 75% alcohol, then dried. The fruit tissue was punctured with a plum blossom needle, and inoculated with a fermentation broth containing strain EB-Q01-05 (1×10⁻⁶). 6 CFU·mL −1 Sterile water was added to the fermentation broth containing strain EB-Q01-05 to adjust the concentration to 1×10⁻⁶ bacteria per milliliter of broth. 6 Spray with EB-Q01-05 live bacteria, let it dry again, and then inoculate the wound with papaya anthracnose spore solution (1×10⁻⁶). 6 CFU·mL −1 The anthracnose strain of papaya was inoculated onto PDA medium and cultured at 28°C for 7 days. Sterile water was then added to the culture dish, and spores were scraped off using a sterile coverslip. The spores were then filtered through sterile three-layer lens paper to obtain a conidial suspension. The concentration of the conidial suspension was adjusted to 1×10⁻⁶ with sterile water. 6 (Spores / mL), 6 points were inoculated on each fruit, and each treatment was replicated 3 times. Sterile water was used as a blank (CK) control. After inoculation, the fruit was placed in a humidified box at 28℃ for observation and photography. On the 5th day after inoculation, the disease incidence of each treatment was recorded, and the disease incidence and control effect were calculated.

[0052] Incidence rate (%) = Number of outbreak sites / Number of vaccination sites × 100%

[0053] Prevention and control efficacy (%) = [(Incidence rate of aseptic water control - Incidence rate of treatment) / Incidence rate of aseptic water control] × 100%

[0054] The results show that ( Figure 5 The disease incidence rate in the blank (CK) control was 100%, while the disease incidence rate in the fermentation broth of strain EB-Q01-05 was 0, with an average control efficacy of 100%.

[0055] The foregoing description of specific exemplary embodiments of the invention is for illustrative and explanatory purposes. These descriptions are not intended to limit the invention to the precise forms disclosed, and it will be apparent that many changes and variations can be made in accordance with the foregoing teachings. The exemplary embodiments were chosen and described in order to explain the specific principles of the invention and its practical application, thereby enabling those skilled in the art to implement and utilize various different exemplary embodiments of the invention, as well as various different choices and variations. The scope of the invention is intended to be defined by the claims and their equivalents.

Claims

1. A strain of Bacillus subtilis for controlling anthracnose in papaya, characterized by: The strain is Bacillus subtilis EB-Q01-05, with accession number CGMCC No.36026.

2. The application of Bacillus subtilis EB-Q01-05, as described in claim 1, in the prevention and control of papaya anthracnose.

3. The application according to claim 2, characterized in that: Application of fermentation broth of Bacillus subtilis EB-Q01-05, used to control anthracnose in papaya.

4. The application according to claim 3, characterized in that: The fermentation broth is prepared by inoculating Bacillus subtilis EB-Q01-05, which is used to control anthracnose in papaya, into LB medium and culturing with shaking to activate the bacteria. The activated bacterial solution is then inoculated into LB medium and cultured at 28°C and 200 r·min. -1 The fermentation broth was obtained by shaking and incubating for 48 hours.