SNP (Single Nucleotide Polymorphism) molecular marker associated with pig feed conversion rate character and application of SNP molecular marker

The SNP locus chr1:263045500 of the Large White pig chromosome was screened by GWAS, primers were designed for genotyping, and individuals with C/C genotypes were screened for breeding. This solved the problem of low feed conversion rate in existing technologies and achieved efficient feed conversion rate improvement.

CN121249905APending Publication Date: 2026-01-02HUAZHONG AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511677717.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-17
Publication Date
2026-01-02

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively improve the feed conversion ratio of pigs, leading to increased feed consumption and impacting farming efficiency and food security.

Method used

The SNP locus located at chr1:263045500 on the Large White pig chromosome was screened using genome-wide association analysis (GWAS). Specific primers were designed for genotyping, and individuals with the C/C genotype were selected for breeding to improve feed conversion rate.

Benefits of technology

It significantly improved the feed conversion rate of Large White pigs, reduced feed consumption, and enhanced breeding efficiency and the industry's sustainable development capabilities.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121249905A_ABST
    Figure CN121249905A_ABST
Patent Text Reader

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker associated with a pig feed conversion rate character and application of the SNP molecular marker, and belongs to the technical field of molecular marker-assisted selection. The invention discloses application of an SNP (Single Nucleotide Polymorphism) molecular marker in detecting a pig feed conversion rate character. According to the invention, a Porcine 80K SNP high-density chip technology is adopted, DNA samples of 5256 large white pigs are subjected to genetic typing work, and an SNP site significantly related to the pig feed conversion rate is screened by using whole genome association analysis. A site genome version of the SNP molecular marker corresponds to a 263045500th nucleotide site Cgt on a chromosome 1 of an Ensembl Sscrofa 11.1 reference genome, and the SNP molecular marker is a single nucleotide sequence shown as SEQ ID NO.1. And when the genotype of the site is C / C, the pig shows a relatively high feed utilization rate.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of marker-assisted selection technology, and more specifically to an SNP molecular marker associated with pig feed conversion rate traits and its application. Background Technology

[0002] China is the world's largest producer and consumer of pork, with the highest annual pork slaughter volume globally. The pork industry plays a crucial role in ensuring national food security and promoting agricultural efficiency. With the continuous expansion of pig farming, the output of pork per unit time has significantly increased, but feed consumption has also grown simultaneously, creating a "grain-intensive" trend. Feed costs account for more than 60% of the total cost of pig production. Feed conversion ratio (FCR), a key economic trait measuring the amount of feed required per unit of meat output, directly impacts farming efficiency. Reducing FCR not only helps to significantly cut farming costs but also alleviates the "competition between humans and livestock for food" problem at the macro level, enhancing the industry's sustainable development capabilities.

[0003] At the technological application level, genome-wide association analysis (GWAS) has become a core molecular tool for locating gene loci associated with complex traits in modern pig breeding. Several studies have made significant progress in pig feed efficiency traits: for example, high-density SNP chips used for whole-genome scanning in large white pig populations have identified several loci significantly associated with feed efficiency; studies based on whole-exome sequencing have further revealed key variants co-occurring with traits such as slaughter weight and backfat thickness. Meanwhile, with the accumulation of breeding data, machine learning models have been successfully applied to long-term prediction of short-term feed efficiency data, significantly improving prediction accuracy. Combining genomic information with high-dimensional phenotypic data can further accelerate the genetic improvement of feed efficiency traits.

[0004] Therefore, providing an SNP molecular marker associated with pig feed conversion ratio and its application is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0005] In view of this, the present invention provides a SNP molecular marker associated with the pig feed conversion ratio trait and its application, further deepening the application of GWAS and molecular markers, screening out key SNP sites applicable to Large White pig populations, and providing a new molecular tool for achieving genetic improvement of feed conversion ratio.

[0006] This invention involves DNA collection and genotyping of 5,256 Large White pigs, followed by genome-wide association analysis (GWAS) to screen for SNP loci significantly associated with feed conversion ratio, aiming to provide new molecular markers for the breeding of Large White pigs with feed conversion ratio traits.

[0007] To achieve the above objectives, the present invention adopts the following technical solution: Feed conversion ratio (FCR) was determined in 5256 Large White pigs. DNA samples were sequenced using a Porcine 80K SNP microarray, yielding 187,255 SNP markers. After genotypic quality control, 97,476 high-quality markers were retained and used in GWAS analysis with all individual data to screen for SNP loci significantly associated with FCR. Based on the pig reference genome version Sus Scrofa 11.1 from the Ensemble database, a significant SNP located at chr1:263045500 was finally identified. Its nucleotide sequence is shown in SEQ ID NO.1. This SNP is located at position 201 and exhibits C / T polymorphism.

[0008] TAAAAGTTTCTATACCATTTCTTCTCCTGACCCACCATCATTACCACCAACAAGCAAAAAAATGAAAAGAACACTGAATGGAAAGAAAGGAAAGGAAAGGACATATTTAACCAAGTCCCAGTTCTGGCATC TTTCTATGCCATG GGAGCCTG GTCAGCCTTGGCCTTCCACCAATTCATAAGCACTCTCATGTCCTCCTC C CCAGCCCCTAGTTACCATAATCCTATCCTTTTCTCTATGAATCTGACTCTTTTAGTTTCCACATAAAAGGGAGATTATGCAGTATTTTCTTATTTTGAGTTTGGCATTTCACTAGCATAATGGACAAAGATGCAATAATGTAAGAGGTATAGGTTCTATGAGGTTGAACACATAGCACAATGACTCTGGTGAAGAAGACT; SEQ ID NO.1.

[0009] The SNPs obtained through screening in this invention can serve as effective molecular markers for pig feed conversion ratio. For the chr1:263045500 locus, individuals with the C / C genotype are preferred for breeding.

[0010] The SNP molecular marker described in this invention is located at chr1:263045500 in the genome version Ensembl Sscrofa 11.1, with a polymorphism of C / T, and is located at position 201 of the sequence shown in SEQ ID NO.1.

[0011] The primer sequences used to detect this SNP molecular marker are as follows: Forward primer: 5'-TTTCTATGCCATGGGAGCCTG-3'; SEQ ID NO.2.

[0012] Reverse primer: 5'-ATGTGTTCAACCTCATAGAACCT-3'; SEQ ID NO.3.

[0013] This invention also relates to the application of the SNP molecular marker or the primer in detecting feed conversion ratio traits in pigs, particularly suitable for Large White pig breeds. Preferably, individuals with the C / C genotype at the chr1:263045500 locus are selected for breeding, as this genotype is associated with higher feed conversion ratios.

[0014] In addition, the present invention provides a detection kit containing the above-mentioned primers, and a method for improving pig breeds, the method comprising detecting the SNP molecular markers on pig chromosome 1 and selecting individuals with C / C genotypes for breeding, thereby reducing feed consumption in offspring and improving feed conversion efficiency.

[0015] As can be seen from the above technical solution, compared with the prior art, this invention discloses a SNP molecular marker associated with the pig feed conversion ratio trait and its application. Genotyping of 5256 Large White pigs was performed using the Porcine 80K SNP chip. Genome-wide association analysis identified a SNP at locus 263045500 on chromosome 1 that was significantly associated with feed conversion ratio. Individuals with the C / C genotype at this locus exhibited higher feed conversion ratios, providing an effective molecular tool for the genetic improvement of feed efficiency in Large White pigs. Attached Figure Description

[0016] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0017] Figure 1 The phenotypic distribution of feed conversion ratio (FCR) in the Large White pig experimental group is shown on the x-axis, where the x-axis represents the phenotypic value.

[0018] Figure 2 Manhattan plot for genome-wide association analysis of feed conversion ratio trait, where SNPs located at chr1:263045500, above the threshold and with low P-values ​​were selected for subsequent analysis.

[0019] Figure 3 This is a QQ plot of genome-wide association analysis of the feed conversion ratio trait.

[0020] Figure 4 The genotyping results of 5256 Large White pigs at the selected SNP loci are shown. The vertical axis represents the FCR phenotypic value, and the horizontal axis (0, 1, 2) represents the three genotype groups: CC, CT, and TT. Detailed Implementation

[0021] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0022] Example 1: Genotyping Detection (1) Ear samples were collected from 5,256 large white pigs and DNA was extracted. The Porcine 80K SNP chip was used for genotyping, and a total of 187,255 SNP loci were obtained.

[0023] (2) Plink v1.90 software was used for genotyping quality control, with the following standards: SNP detection rate > 90%, minimum allele frequency (MAF) > 0.01, individual deletion rate (mind) < 0.1, and locus deletion rate (geno) < 0.1. Subsequently, missing genotypes were filled according to the default parameters of Beagle, and the filled data were again subjected to quality control with MAF > 0.01.

[0024] (3) After the above processing, 5256 individuals and 97,476 high-quality SNP loci were finally retained for subsequent genome-wide association analysis.

[0025] Example 2: Genome-wide association analysis of SNP sites and feed conversion ratio (1) The feed conversion ratio of 5256 Large White pigs was recorded using the Ossin equipment, and their phenotypic distribution is as follows: Figure 1 As shown, this data is used as the phenotypic input for GWAS analysis.

[0026] (2) Association analysis was performed using the mixed linear model (MLM) from the rMVP package. Field and gender were included as fixed effects, and the first three principal components were used as covariates. The model expression is: y = Xβ + Vα + Zμ + e Where y is the phenotypic value, β is the fixed effect, α is the SNP vector, μ is the random effect, X, V, Z are the correlation matrices, and e is the residual.

[0027] (3) The Bonferroni correction method was used to set the genomic significance threshold, i.e., 0.05 / N (N=97,476), and the significance threshold was calculated to be 6.29 (–log10(P)). The P values ​​of each SNP site were converted to –log10(P), and Manhattan plots and QQ plots were drawn using the R packages qqman and CMplot, respectively. Figure 2 , Figure 3 ).

[0028] (4) Further screening was conducted on SNPs (rs329857666) located on chromosome 1 above the significance threshold. The population phenotypic values ​​and individual distributions corresponding to different genotypes are shown in the figure. Figure 4 As shown in the figure, individuals with the C / C genotype at this locus exhibit higher feed conversion rates and are recommended as a preferred genotype for breeding.

[0029] Example 3: Target Sequence Amplification and Sequencing (1) Design amplification primers for SEQ ID NO.1: Forward primer: 5′-TTTCTATGCCATGGGAGCCTG-3′; SEQ ID NO.2.

[0030] Reverse primer: 5′-ATGTGTTCAACCTCATAGAACCT-3′; SEQ ID NO.3.

[0031] (2) PCR reaction system and procedure: The reaction mixture was 10 µL, containing 5 µL Taq Mix, 0.3 µL each of forward and reverse primers, 1 µL DNA template, and 3.4 µL ddH2O. The reaction program was as follows: pre-denaturation at 94 °C for 3 min; 35 cycles of 94 °C for 30 s, 59 °C for 30 s, and 72 °C for 30 s; and final extension at 72 °C for 5 min.

[0032] (3) The PCR product was subjected to bidirectional sequencing, and the sequence was obtained as shown in SEQ ID NO.4: TTTCTATGCCATGGGAGCCTGGTCAGCCTTGGCCTTCCACCAATTCATAAGCACTCTCATGTCCTCCTC YCCAGCCCCTAGTTACCATAATCCTATCCTTTTCTCTATGAATCTGACTCTTTTAGTTTCCACATAAAAGGGAGATTATGCAGTATTTTCTTATTTTGAGTTTGGCATTTCACTAGCATAATGGACAAAGATGCAATAATGTAAGAGGTATAGGTTCTATGAGGTTGAACACAT; SEQ ID NO.4.

[0033] Note: "Y" in the sequence indicates a C / T polymorphic site, and the bolded part is the primer binding region.

[0034] (4) Based on the above results, a method for improving the feed conversion rate of Large White pigs is established: by detecting the genotype of nucleotide 263045500 on chromosome 1, C / C type individuals are screened for breeding to effectively reduce feed consumption and improve feed conversion efficiency.

[0035] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A SNP molecular marker associated with the pig feed conversion ratio trait, characterized in that, The SNP molecular marker is located at chr1: 263045500 in the genome version Ensembl Sscrofa 11.1, and its polymorphic site is C or T.

2. The SNP molecular marker associated with pig feed conversion ratio trait according to claim 1, characterized in that, The SNP molecular marker is located at position 201 in the nucleotide sequence shown in SEQ ID NO.

1.

3. A primer for detecting the SNP molecular marker of claim 1 or 2, characterized in that, The primer sequences are: Forward primer: 5'-TTTCTATGCCATGGGAGCCTG-3'; Reverse primer: 5'-ATGTGTTCAACCTCATAGAACCT-3'.

4. The application of the SNP molecular marker according to any one of claims 1-2 or the primer according to claim 3 in detecting the pig feed conversion ratio trait.

5. The application according to claim 4, characterized in that, Breeding was carried out on strains with genotype C / C at the chr1:263045500 locus on chromosome 1, as strains with genotype C / C have high feed utilization rates.

6. The application according to claim 4, characterized in that, The breed of pig is the Large White.

7. The application of the SNP molecular marker according to any one of claims 1-2 or the primer according to claim 3 in the genetic breeding of pigs.

8. A kit for detecting the SNP molecular marker of claim 1 or 2, characterized in that, It contains the primers as described in claim 3.

9. A method for improving pig breeds, characterized in that, The process includes the following steps: detecting the SNP molecular marker located at chr1:263045500 in the genome version EnsemblSscrofa 11.1, with a polymorphic site of C or T, and selecting strains with genotype C / C for breeding.