Application of molecular marker related to average daily ingestion time character of pig fattening period

Abstract

The invention discloses application of a molecular marker related to the average daily ingestion time character of a pig fattening period, and relates to the technical field of biology, and the application is any one of A1) to A8): A1) detecting or assisting in detecting the average daily ingestion time of the pig fattening period; a2) identification, wherein the average daily ingestion time of the pig fattening period is identified in an auxiliary mode; a3) pig breeding; a4) detecting or assisting in detecting the polymorphism or genotype of the SNP; (A5) preparing a product for detecting or assisting in detecting the average daily ingestion time of the pigs in the fattening period; (A6) preparing a product for identifying and assisting in identifying the average daily ingestion time of the pigs in the fattening period; the invention discloses a molecular marker related to the average daily ingestion time character of a pig in the fattening period, which comprises the following steps of: (1) preparing a molecular marker, (2) preparing a molecular marker for the average daily ingestion time character of the pig in the fattening period, (3) preparing a molecular marker for the average daily ingestion time character of the pig in the fattening period, (4) preparing a molecular marker for the average daily ingestion time character of the pig in the fattening period, (5) preparing a product for breeding the pig, and (6) preparing a product for detecting or assisting in detecting the polymorphism or genotype of SNP (Single Nucleotide Polymorphism).

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to the application of a molecular marker related to the average daily feeding time trait of pigs during the fattening period. BACKGROUND

[0002] In the pig breeding industry, feed costs account for more than 60%, and feed conversion rate (FCR) is the core indicator of breeding profit. Studies have shown that the average daily feeding time (TFD) of pigs during the fattening period is positively correlated with the feed conversion rate, i.e. the shorter the average daily feeding time, the higher the feed conversion rate. Including this feeding behavior characteristic into the breeding selection index can increase the selection response of feed conversion rate by 4% (Reference: Kavlak AT, Strandén I, Lidauer MH, Uimari P. Estimation of social genetic effects on feeding behaviour and production traits in pigs. Animal. 2021 Mar; 15 (3): 100168. doi: 10.1016 / j.animal.2020.100168.).

[0003] Currently, the determination of the average daily feeding time relies on special automatic determination equipment, which is expensive and has a long determination period, resulting in a significant increase in breeding costs and a high degree of difficulty in actual operation. With the development of molecular biology technology and pig genome association analysis technology, it is possible to mine molecular markers related to the average daily feeding time and achieve precise and efficient breeding. However, as of now, there is no related report on molecular markers for the average daily feeding time of pigs during the fattening period. Therefore, it is necessary to develop specific molecular markers to meet the breeding practice needs. SUMMARY

[0004] The present application relates to the field of biotechnology, in particular to the application of a molecular marker related to the average daily feeding time trait of pigs during the fattening period.

[0005] To achieve the above-mentioned purpose, the present application provides the following technical solutions: the application of a molecular marker related to the average daily feeding time trait of pigs during the fattening period, wherein the application is any one of the following A1) to A8): A1) detecting or assisting in detecting the average daily feeding time of pigs during the fattening period; A2) identifying or assisting in identifying the average daily feeding time of pigs during the fattening period; A3) pig breeding; A4) detecting or assisting in detecting the polymorphism or genotype of SNPs; A5) preparing a product for detecting or assisting in detecting the average daily feeding time of pigs during the fattening period; A6) preparing a product for identifying, assisting in identifying the average daily feeding time of pigs during the fattening period; A7) preparing a product for pig breeding; A8) preparing a product for detecting or assisting in detecting the polymorphism or genotype of SNPs; The molecular marker corresponds to the SNP site at position 270462812 on chromosome 1 in the pig reference genome Sus_scrofa.Sscrofa11.1, which corresponds to the nucleotide at position 119 in the sequence SEQ ID NO: 1, and the nucleotide species is A or C.

[0006] Further, the method for identifying or assisting in identifying the average daily feeding time of pigs during the fattening period, characterized in that, comprising the following steps: S1) extracting the genomic DNA of the pig to be tested as a template; S2) designing specific primers for the 119bp site of the DNA molecule shown in the sequence SEQ ID NO: 1, and performing PCR amplification; S3) detecting the genotype of the 119bp site of the sequence SEQ ID NO: 1 of the pig to be tested; S4) identifying or assisting in identifying the average daily feeding time of the pig to be tested according to the genotype obtained in step S3: the average daily feeding time of the individual with AA genotype during the fattening period is greater than that of the individual with AC genotype, and the average daily feeding time of the individual with AC genotype during the fattening period is greater than that of the individual with CC genotype.

[0007] Further, the sequence of the specific primers in step S2 is SEQ ID NO: 2 and SEQ ID NO: 3, wherein SEQ ID NO: 2 is 5'-GCTCTTGTGTCTAAATGGAAACC-3', and SEQ ID NO: 3 is 5'-GGCTTGTTGTCTGGATGATGA-3'.

[0008] Further, the breeding method for breeding pigs with small average daily feeding time during the fattening period, the genotype of the pig to be tested is identified according to the method of claim 3, and the pig to be tested with C homozygous type at position 119 of the sequence SEQ ID NO: 1 is selected as the parent for breeding.

[0009] Further, the product is a kit.

[0010] The application provides application of a molecular marker related to a pig average daily feeding time during a fattening period, and has the following beneficial effects: the application discovers that a SNP site at position 270462812 of chromosome 1 in a pig reference genome Sus_scrofa.Sscrofa11.1 has a significant influence on the average daily feeding time during the fattening period of the pig; a method for identifying or assisting in identifying the average daily feeding time during the fattening period of the pig is provided based on the SNP site; a new molecular breeding marker is provided for marker-assisted breeding of the average daily feeding time during the fattening period of the pig, which is beneficial to improving breeding efficiency, effectively shortening a breeding cycle, and has important significance for selecting excellent pig breeds; The A270462812C is detected by using a gene sequencing method, and the genotype of an individual can be distinguished by performing a PCR reaction and sequencing, the genotype distinguishing is very accurate, the detection cost is not high, and the application value in breeding practice is very high, the average daily feeding time of the CC genotype pig is reduced by about 8.2 minutes than that of the AA genotype pig by using the method, and the method provided by the application can be used for breeding pigs, and early screening can be performed on the pigs to be selected, the problem that it takes a long time to select excellent pig breeds in actual production is effectively solved, the breeding cost is reduced, and the pig feeding behavior in actual production is effectively improved. The detection method of the application is simple in operation, low in cost, high in accuracy, and can realize automatic direct detection. The application will play a great role in pig breeding work. BRIEF DESCRIPTION OF DRAWINGS

[0011] Figure 1 is a Manhattan plot of the whole genome association analysis of example 1 of the application.

[0012] Figure 2 is a QQ plot of a representative data structure of the whole genome association analysis of example 1 of the application. DETAILED DESCRIPTION

[0013] The embodiments of the application are further described in detail below with reference to the examples. The following examples are used to illustrate the application, but cannot be used to limit the scope of the application.

[0014] The application provides application of a molecular marker related to a pig average daily feeding time during a fattening period, and has the following beneficial effects: the application discovers that a SNP site at position 270462812 of chromosome 1 in a pig reference genome Sus_scrofa.Sscrofa11.1 has a significant influence on the average daily feeding time during the fattening period of the pig; a method for identifying or assisting in identifying the average daily feeding time during the fattening period of the pig is provided based on the SNP site; a new molecular breeding marker is provided for marker-assisted breeding of the average daily feeding time during the fattening period of the pig, which is beneficial to improving breeding efficiency, effectively shortening a breeding cycle, and has important significance for selecting excellent pig breeds;

[0015] The experimental methods in the following examples are all conventional methods, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, etc. used in the following examples are commercially available, unless otherwise specified.

[0016] The data in the following examples are processed using SAS 9.0 statistical software, and the experimental results are expressed as mean ± standard deviation. One-way ANOVA test is used, and P<0.05 (*) indicates a significant difference.

[0017] All the animals in the following examples are from Henan Yifa Pastoral Co., Ltd.

[0018] The average daily feeding time in the following examples is the average daily feeding time during the fattening period in the fattening stage.

[0019] Example 1: Determination of SNP site on chromosome 1 in pig reference genome Sus_scrofa.Sscrofa11.1 The inventors previously performed whole genome sequencing on 560 pigs, and whole genome association analysis of the average daily feeding time during the fattening period. The model used was: Y = μ + G + B + P + e. Wherein Y is the trait measured value; μ is the population mean; G is the genotype effect; B is the measurement batch effect; P is the field year season effect. The results showed that 20 SNP sites were significantly associated with the average daily feeding time during the fattening period, as shown in Figure 1 and Figure 2 The inventors designed primers for amplification in the range of 200 bp upstream and downstream of the five most significant sites, respectively, and found that only one site on chromosome 1 could be amplified well.

[0020] After amplification, Seqman software was used for alignment, and a difference site (SNP site) was obtained, named A270462812C site, located at the 270462812th nucleotide on chromosome 1 in pig reference genome Sus_scrofa.Sscrofa11.1, i.e. the 119th nucleotide of sequence SEQ ID NO: 1. The nucleotide type of A270462812C site is A or C, and the genotype is AA, CC or AC. AA genotype is a homozygote with A nucleotide at A270462812C site. CC genotype is a homozygote with C nucleotide at A270462812C site. AC genotype is a heterozygote with A and C nucleotides at A270462812C site.

[0021] Example 2, Correlation analysis between A270462812C locus on chromosome 1 in pig reference genome Sus_scrofa.Sscrofa11.1 and average daily feeding time during pig finishing period To determine whether the A270462812C locus on chromosome 1 in pig reference genome Sus_scrofa.Sscrofa11.1 is correlated with the average daily feeding time during pig finishing period, 1012 Large White pigs were used as experimental materials, the genotype of the SNP locus in Example 1 and the average daily feeding time during pig finishing period of each were measured, and correlation analysis was performed.

[0022] I. Genotype identification 1. PCR amplification According to the information of the SNP on chromosome 1 in pig reference genome Sus_scrofa.Sscrofa11.1, a pair of primers was designed as follows: Forward primer F: 5'-GCTCTTGTGTCTAAATGGAAACC-3' (SEQ ID NO: 2); Reverse primer R: 5'-GGCTTGTTGTCTGGATGATGA-3' (SEQ ID NO: 3).

[0023] The genomic DNA of each Large White pig was used as a template for PCR amplification using the above-mentioned primers, and the PCR product was obtained.

[0024] 2. Cloning, sequencing and sequence analysis The PCR product of each individual was recovered and purified by agarose gel recovery kit (Tiangen Biotech Co., Ltd.), and the recovered DNA fragments were ligated to vector pGEM-T (Promega Corporation). The ligation product was transformed into E. coli DH5α competent cells (Mingri Bai Ao (Beijing) Technology Co., Ltd.), and positive clones containing the recovered fragments were obtained according to the carbenicillin resistance marker on the vector. Nucleotide sequence determination was performed on the recombinant plasmid using T7 and SP6 promoter sequences on the vector as primers (Yingwei Jieji (Shanghai) Trade Co., Ltd.).

[0025] The genotypes of the pigs to be tested were as follows: AA genotype: if the PCR product obtained by amplifying the genomic DNA of the test pig using upstream primer F and downstream primer R contains only the DNA fragment with the nucleotide sequence of SEQ ID NO: 1 and the 119th nucleotide of SEQ ID NO: 1 is G, and does not contain the DNA fragment with the nucleotide sequence of SEQ ID NO: 1 and the 119th nucleotide of SEQ ID NO: 1 is A, then the genotype of the A270462812C site on chromosome 1 in the aforementioned pig reference genome Sus_scrofa.Sscrofa11.1 of the test pig is AA.

[0026] CC genotype: if the PCR product obtained by amplifying the genomic DNA of the test pig using upstream primer F and downstream primer R does not contain the DNA fragment with the nucleotide sequence of SEQ ID NO: 1 and the 119th nucleotide of SEQ ID NO: 1 is C, and contains only the DNA fragment with the nucleotide sequence of SEQ ID NO: 1 and the 119th nucleotide of SEQ ID NO: 1 is A, then the genotype of the A270462812C site on chromosome 1 in the aforementioned pig reference genome Sus_scrofa.Sscrofa11.1 of the test pig is CC.

[0027] AC genotype: if the PCR product obtained by amplifying the genomic DNA of the test pig using upstream primer F and downstream primer R contains both the DNA fragment with the nucleotide sequence of SEQ ID NO: 1 and the 119th nucleotide of SEQ ID NO: 1 is G, and the DNA fragment with the nucleotide sequence of SEQ ID NO: 1 and the 119th nucleotide of SEQ ID NO: 1 is A, then the genotype of the A270462812C site on chromosome 1 in the aforementioned pig reference genome Sus_scrofa.Sscrofa11.1 of the test pig is AC.

[0028] The results are shown in Table 2. The genotype detection results of the A270462812C site of 1024 Large White pig individuals showed that 232 were AA genotype, 324 were CC genotype, and 456 were AC genotype. The genotype frequency and allele frequency of the A270462812C site in the detected pig population are shown in Table 1. As can be seen from Table 1, the heterozygosity of this site is high, and has great prospects for selection.

[0029] Table 1, Genotype frequency and allele frequency of A270462812C site in the detected pig population

[0030] II. Association analysis of pig genotype and average daily feeding time of pigs during the fattening period The average daily feeding time of the pig in the fattening period was determined by using the Osborn automatic determination device, the genotype and phenotype correlation analysis was performed by using the SAS software, the Duncan's multiple test was used for significance test (P<0.05), the data was represented by using the average value ± standard error, and P<0.05 was determined as significant difference.

[0031] As shown in Table 2, the SNP (A270462812C) site has a significant influence on the average daily feeding time of the pig in the fattening period, the average daily feeding time of the pig with AA genotype in the fattening period is greater than that of the pig with AC genotype, the average daily feeding time of the pig with AC genotype in the fattening period is greater than that of the pig with CC genotype, and the average daily feeding time of the pig with AA genotype in the fattening period is significantly greater than that of the pig with CC genotype (P<0.05). In the actual pig breeding, the average daily feeding time in the fattening period can be assisted to select according to the genotyping result of the SNP A270462812C site.

[0032] Table 2, correlation analysis of the single nucleotide polymorphism on the chromosome 1 in the pig reference genome (Sus_scrofa.Sscrofa11.1) and the average daily feeding time in the fattening period

[0033] Note: In the table, different lowercase letters represent significant difference (P<0.05), the same letter represents no significant difference (P>0.05), and the numerical value is represented by the average value ± standard error.

[0034] In summary, the genotype of the A270462812C site on the chromosome 1 in the pig reference genome (Sus_scrofa.Sscrofa11.1) can be determined to assist in identifying the average daily feeding time of the pig in the fattening period: the average daily feeding time of the pig with AA genotype in the fattening period is greater than that of the pig with CC genotype, and the average daily feeding time of the pig with AC genotype in the fattening period is greater than that of the pig with CC genotype. In the actual breeding work, the pig to be tested with the genotype of the SNP (A270462812C) site as CC can be selected as the parent for breeding.

[0035] SEQ ID NO:1 5'- GCTCTTGTGTCTAAATGGAAACCTGTTTCCACCTACTTGTCTGGCCAGGATGAAATTAAATATCCCAGCCTTGTAAAAATCATTCCAGAAAATAAAATCAGGAAAAGTACTGTTCAGCWTCGTGGGGAGAAGCCCACCTGTGGAATAATCCCCCCACCACAACCAGTCCTAACAACTGTGGAAGTTCTGGGAGGCCTCTGGTTCCCGAGGGGGAAAAATCCCACACAGACCTCACGGGCTGTGCTGTGAGCTCATCATCCAGACAACAAGCC -3'.

[0036] The W is A or C.

[0037] The application has been described in detail. Within the scope of equivalents, concentrations and conditions, the application can be implemented by those skilled in the art without unnecessary experiments, and without departing from the spirit and scope of the application. Although the application gives specific examples, it should be understood that further improvements can be made to the application. In summary, according to the principles of the application, the present application is intended to include any changes, uses or improvements to the application, including changes made outside the scope disclosed in the present application, using conventional techniques known in the art.

[0038] The embodiments of the application are given for the purpose of illustration and description, and are not intended to be exhaustive or to limit the application to the disclosed form. Many modifications and variations will be apparent to those of ordinary skill in the art. The embodiments were chosen and described in order to best explain the principles of the application and its practical application, and to enable others skilled in the art to understand the application for various embodiments with various modifications as are suited to the particular use contemplated.

Claims

1. The application of molecular markers related to the trait of average daily feed intake time during the fattening period of pigs, characterized in that, The application is any one of the following A1) to A8): A1) Detect or assist in detecting the average daily feeding time of pigs during the fattening period; A2) Identify and assist in identifying the average daily feeding time of pigs during the fattening period; A3) Pig breeding; A4) Detection or auxiliary detection of SNP polymorphisms or genotypes; A5) Prepare products for detecting or assisting in the detection of average daily feeding time during the fattening period of pigs; A6) Products for the preparation, identification, and auxiliary identification of average daily feeding time during the fattening period of pigs; A7) Preparation of pig breeding products; A8) Prepare products for detecting or assisting in the detection of SNP polymorphisms or genotypes; The molecular marker corresponds to the SNP site at position 270462812 on chromosome 1 in the pig reference genome Sus_scrofa.Sscrofa11.

1. This site corresponds to the nucleotide at position 119 bp in the sequence SEQ ID NO:1, and the nucleotide type is A or C.

2. The application of the molecular markers related to the average daily feed intake trait during the fattening period of pigs as described in claim 1, characterized in that, A method for identifying or assisting in the identification of the average daily feeding time of pigs during the fattening period, characterized by comprising the following steps: S1) Extract genomic DNA from the pig to be tested as a template; S2) Design specific primers for the 119bp site of the DNA molecule shown in SEQ ID NO:1 and perform PCR amplification; S3) Detect the genotype at the 119bp site of the pig sequence SEQ ID NO:1; S4) Based on the genotype identification or auxiliary identification obtained in step S3, the average daily feeding time of the pigs during the fattening period is as follows: the average daily feeding time of individuals with the AA genotype is greater than that of individuals with the AC genotype, and the average daily feeding time of individuals with the AC genotype is greater than that of individuals with the CC genotype.

3. The application of the molecular markers related to the average daily feed intake trait during the fattening period of pigs as described in claim 2, characterized in that, The specific primers in step S2 have sequences of SEQ ID NO:2 and SEQ ID NO:3, where SEQ ID NO:2 is 5'-GCTCTTGTGTCTAAATGGAAACC-3' and SEQ ID NO:3 is 5'-GGCTTGTTGTCTGGATGATGA-3'.

4. The application of the molecular markers related to the average daily feed intake trait during the fattening period of pigs as described in claim 3, characterized in that, A breeding method for selecting pigs with a short average daily feeding time during the fattening period, wherein the genotype of the pig to be tested is identified according to the method described in claim 3, and the pig to be tested with the C homozygous genotype at position 119bp of SEQ ID NO:1 is selected as the parent for breeding.

5. The application of the molecular markers related to the average daily feed intake trait during the fattening period of pigs as described in claim 4, characterized in that, The product in question is a reagent kit.

Images